Previous Article | Next Article 
Journal of Virology, August 2000, p. 7636-7641, Vol. 74, No. 16
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Structural and Kinetic Analyses of the Protease from an
Amprenavir-Resistant Human Immunodeficiency Virus Type 1 Mutant
Rendered Resistant to Saquinavir and Resensitized to
Amprenavir
W.
Markland,1,*
B.
G.
Rao,1
J. D.
Parsons,1
J.
Black,1
L.
Zuchowski,1
M.
Tisdale,2 and
R.
Tung1
Vertex Pharmaceuticals, Cambridge, Massachusetts
02139-4242,1 and Glaxo Wellcome,
Stevenage SG12NY, United Kingdom2
Received 19 January 2000/Accepted 14 April 2000
 |
ABSTRACT |
Recent drug regimens have had much success in the treatment of
human immunodeficiency virus (HIV)-infected individuals; however, the
incidence of resistance to such drugs has become a problem that is
likely to increase in importance with long-term therapy of this chronic
illness. An analysis and understanding of the molecular interactions
between the drug(s) and the mutated viral target(s) is crucial for
further progress in the field of AIDS therapy. The protease inhibitor
amprenavir (APV) generates a signature set of HIV type 1 (HIV-1)
protease mutations associated with in vitro resistance (M46I/L, I47V,
and I50V [triple mutant]). Passage of the triple-mutant APV-resistant
HIV-1 strain in MT4 cells, in the presence of increasing concentrations
of saquinavir (SQV), gave rise to a new variant containing M46I, G48V,
I50V, and I84L mutations in the protease and a resulting phenotype that
was resistant to SQV and, unexpectedly, resensitized to APV. This
phenotype was consistent with a subsequent kinetic analysis of the
mutant protease, together with X-ray crystallographic analysis and
computational modeling which elucidated the structural basis of these
observations. The switch in protease inhibitor sensitivities resulted
from (i) the I50V mutation, which reduced the area of contact with APV and SQV; (ii) the compensating I84L mutation, which improved
hydrophobic packing with APV; and (iii) the G-to-V mutation at residue
48, which introduced steric repulsion with the P3 group of SQV. This analysis establishes the fine detail necessary for understanding the loss of protease binding for SQV in the quadruple mutant and gain
in binding for APV, demonstrating the powerful combination of virology,
molecular biology, enzymology, and protein structural and modeling
studies in the elucidation and understanding of viral drug resistance.
| |
TEXT |
The aim of this work was to
establish an understanding, at the atomic and molecular level, of the
shifting human immunodeficiency virus (HIV) protease resistance
phenotype established when two protease inhibitors (amprenavir [APV]
and saquinavir [SQV]) were sequentially added in an in vitro viral
resistance experiment. APV is a novel arylsulfononyl diaminopropane
peptidomimetic of the HIV protease inhibitor (PI) class. This compound
is a potent, low-molecular-weight, orally bioavailable drug with
excellent pharmacokinetic characteristics and a distinct in vitro
resistance pattern (8, 14). The field of work relating to
HIV replication and PI-associated resistance is large and ever
increasing (for reviews, see references 1, 2, and
13 and references therein). The signature set of HIV
type 1 (HIV-1) protease mutations associated with in vitro resistance
to APV are M46I/L, I47V, and I50V, the last of which distinguishes APV
from other PIs in terms of its resistance profile. In general, in vitro
experiments involving pairs of PIs have demonstrated increases in
phenotypic resistance to both agents associated with alterations in the
protease sequence consistent with those associated with each individual
PI (data not shown). In contrast, when a clonal APV-resistant HIV-1
strain (containing mutations at positions 46, 47 and 50 [14]) was passaged in the presence of increasing
concentrations of SQV, the triple-mutant virus (M46I, I47V, I50V)
further mutated. The resulting predominant HIV-1 variant encoded a
protease with the mutations M46I, G48V, I50V, and I84L (Table
1). Phenotypic analysis of a clonally
pure SQV-selected variant demonstrated an expected increase in the 50%
inhibitory concentration (IC50) of SQV from 14 to 1,655 nM but an unexpected 40-fold resensitization to APV (with the
IC50 decreasing from 2,135 to 55 nM), resulting in a return
to wild-type virus sensitivity to APV.
Mutant protease generation, crystallization, and enzymatic
analysis.
A synthetic HIV-1 protease gene encoding the 46I, 48V,
50V, 84L mutations was generated using standard methods of PCR
mutagenesis (4). Essentially, internal mutagenic primers
46/48/50 top (5' CCGAAGATCATTGTTGGCGTTGGTGGT 3') and
46/48/50 bot (5' ACCACCAACGCCAACAATGATCTTCGG 3') or 84 top
5' (CCTGTAAACCTGATTGGTCGTAAC 3') and 84 bot 5'
(GTTACGACCAATCAGGTTTACAGG 3') were mixed with appropriate
external primers, the HIV-1 protease gene, nucleotides, and
Taq polymerase. PCRs were undertaken to generate two mutant
protease genes containing the 46I, 48V, and 50V mutations together and
the 84L single mutation separately, which were then recombined via an
intervening unique restriction enzyme site (KpnI). Complete
sequencing of the fully mutated gene demonstrated that only the desired
mutations were present. An NdeI-EcoRI fragment
containing the open reading frame for the mutated protease was recloned
into the expression vector pSPC27 (10). The quadruple-mutant
protease was expressed in Escherichia coli BL21DE3 in a
10-liter fermentor and purified from inclusion bodies by the modified
method of Hui et al. (5).
The quadruple-mutant and wild-type protease values for
Km (275 and 115 µM, respectively) and
kcat (5.6 and 12.2 s
1,
respectively) are similar, giving catalytic efficiencies of
20 and 106 mM
1s
1, respectively (Table
2) (see references
8 to
10 for methodological
details). Although the catalytic
efficiency for the mutant is
approximately fivefold poorer overall, the
mutant product is still
a relatively efficient protease. A comparison
of the inhibitory
constants for each of the marketed HIV-1 protease
inhibitors (APV,
SQV, indinavir, ritonavir, and nelfinavir)
demonstrated that the
quadruple-mutant protease was effectively
inhibited by all of
the PIs except SQV (Table
3). The
Ki value
for SQV was 300-fold
higher in the quadruple-mutant protease than in
the wild-type
protease and is consistent with the viral phenotype seen
in tissue
culture assays. Table
4 shows
the additive effects of the individual
mutations that make up the
quadruple mutant. A comparison of the
Ki
mutant/wild-type ratio for each of the individual mutant proteases
with
that of the combined quadruple-mutant protease for APV or
SQV
demonstrates approximate additivity compared to the final
kinetic
character of the quadruple-mutant product. These data
also indicate
that the I50V mutation negatively affects the inhibitory
affinity of
APV or SQV for mutant protease while the M46I and
I84L mutations are
likely to compensate for this mutation (especially
for the APV-protease
interaction). It can also be seen that the
G48V mutation has the most
significant effect on the
Ki ratio
for SQV.
X-ray diffraction studies and molecular modeling of the mutant
protease-PI complexes.
Crystals of the mutant protease-PI
complexes were generated by refolding the protease, using the rapid
dilution method, in the presence of APV by using the hanging-drop
method (detailed in reference 6). Data collection,
refinement, and model building were performed as detailed in reference
6. SQV was modeled into the active site of the
mutant protease by superposing the backbone coordinates of the mutant
and the HIV-1 protease-SQV complex structure (modeling details
described previously). A model based on the X-ray diffraction data
collected (data not shown) with the quadruple-mutant HIV-1 protease-APV
complex is shown in Fig. 1. This figure
shows the active site of the protease (a homodimer), with each pair of
mutated residues (M46I, G48V, I50V, and I84L) indicated by van der
Waals surfaces and the drug interactant from each pair highlighted. APV
is shown in yellow, and SQV is shown in blue. Figure
2 is a close-up of the hydrophobic
contact between the side chain of I50 (gold) and the P2' phenyl ring
(green) of the benzenesulfonamide moiety of APV in the S2' pocket. A
detailed description of this interaction and the effect of the valine
mutation has been given elsewhere (10); essentially, there
is a reduction in the interaction between APV and the mutant protease.
A similar reduction in the interaction occurs between the mutant
protease and the iso-butyl group of SQV. The I84L mutation
within the protease compensates for this loss of hydrophobic packing,
at least for APV, by reintroducing a comparable area of hydrophobic
contact (Fig. 3). Modeling suggests that
this would also be the case for SQV if it could line up in the pocket
as normal, but the G48V mutation precludes this. The major change
leading to SQV resistance is the G48V mutation, which introduces a
bulky side chain into the S3 pocket. This leads to steric hindrance of
the P3 quinoline group of SQV (bicyclic blue ring in Fig.
4) but not of the P2 furanyl group of APV
(yellow five-membered ring in Fig. 4). Residue 46 (containing the
M-to-I mutation) was demonstrated to be exposed to solvent and not
directly involved in interactions with either inhibitor; instead, it is
likely to be compensatory for the mutations within the protease-active
site for reasons such as domain flexibility (3, 12).
View larger version (60K):
[in this window]
[in a new window]
|
FIG. 1.
Structure of the active site of the HIV-1 protease dimer
shown complexed with APV (yellow) and SQV (blue). Van der Waals
surfaces are indicated for each pair of amino acids in the quadruple
mutant, with the drug-interacting residue of each pair highlighted.
|
|
View larger version (56K):
[in this window]
[in a new window]
|
FIG. 2.
Close-up view of the interaction between I50 (side chain
in gold) and the phenyl ring (green) of APV (also called VX-478) in the
S2' pocket of the enzyme. The valine mutant side chain is colored
turquoise. The flap water molecule is also indicated.
|
|
View larger version (48K):
[in this window]
[in a new window]
|
FIG. 3.
Close-up view of the interaction between mutant residue
L84 and both APV and SQV. This interaction partially compensates for
the loss of hydrophobic interaction between 50V and either APV or
SQV.
|
|
View larger version (42K):
[in this window]
[in a new window]
|
FIG. 4.
Close-up view of the steric repulsion of the P3 group of
SQV induced by the introduction of the V48 side chain into the S3
pocket.
|
|
One assumes that the smallest number of mutations that enabled the
efficient survival of the APV-resistant mutated virus in
the presence
of increasing amounts of SQV was the conversion to
the observed
quadruple-mutant SQV-resistant virus. Questions that
arise from such an
observation include the following. Given the
association between SQV
resistance and the pair of mutations G48V
and L90M, why did the latter
mutation not appear? What does this
say about the role of residue 47 in
APV resistance? And why should
APV sensitivity reappear when the
selection was for SQV resistance?
There are likely to be multiple and
potentially complicated pathways
toward the generation of PI resistance
in HIV, even in vitro.
This will depend on the starting sequence of the
virus, the particular
PI used, and the intensity of the selection
pressure applied to
the replicating virus. Speculation regarding the
shift from the
46I, 47V, and 50V mutations to the 46I, 48V, 50V, and
84L mutations
during the SQV selection is as follows. The starting
point in
the studies described here was the APV-resistant viral strain
(with mutations at residues 46, 47, and 50), which had remained
sensitive to SQV. M46I and I47V as single mutations have no effect
on
inhibitor binding for APV or SQV (
9) but appear to be
compensatory
for the I50V mutation in the triple mutant, since the
catalytic
efficiency of the triple-mutant protease is greater than that
of the I50V protease alone. This, together with the marked increase
in
Ki (270-fold) for APV, allows for an increased
vitality or
fitness of such a triply mutated HIV and hence survival in
the
presence of APV. The M46I mutation may result in the locking of
the
flap portion of the protease in the closed position (
3,
12),
while residue 47, also in the flap, is part of the S2/S2'
binding
pocket but does not interact directly with either APV
or SQV. Viral
survival of the APV-resistant triple mutant in the
presence of SQV
necessitated further mutation. The principal mutations
associated with
SQV resistance have been reported to be G48V and
L90M (
7,
11), although in these and our studies (data not
shown) the G48V
mutation appears to be the dominant change in
the enzymological
mechanism of resistance. The L90M mutation indirectly
affects the
interaction between the catalytic D25 side chains
and the central OH
group of all the PIs, including APV, while
the G48V mutation has a
direct steric effect on SQV, as described
above. In fact, the presence
of L90M together with I50V in HIV
protease leads to a marked increase
in
Ki for SQV (data not shown),
while addition
of L90M to I47V plus I50V in the protease causes
a reversal in this
trend (data not shown). A comparison of the
Ki
mutant to
Ki wild type ratio for the various
mutant proteases
with an added L90M mutation demonstrated the following
ranking
with respect to SQV: (L90M alone) < (I47V + L90M) < (M46I + I47V
+ I50V) < (M46I + I47V + I50V + L90M) < (M46I + M48V + I50V +
I84L) < (G48V + L90M) (data not shown). From the
above, it appears
reasonable that the G48V mutation would be favored
when converting
an APV-resistant strain to one resistant to SQV.
However, a protease
with consecutive mutations at residues 46, 47, and
48 would probably
be affected negatively, requiring residue 46 or 47 to
change,
probably a reversion. We suggest that residue 47 is most likely
to revert, since the 46I/L mutation is a relatively common change
associated with PI resistance and is often linked with other protease
mutations, probably playing a compensatory role in proteases resistant
to other PIs as well as APV. This does not necessarily require
a
reassessment of residue 47 in APV resistance, since in the context
of
the triple mutation it appears to be compensatory for the I50V
mutation
in terms of the catalytic efficiency of the mutated protease.
We assume
that the I84L change recompensates, possibly in terms
of substrate
affinity, or that M46I provides sufficient compensation
within the
context of the quadruple mutation. Residues 50 and
84 are at the center
of the active site, with their side chains
at the interface of subsites
1 and 2 and capable of interacting
with residues P
2 through
P
2' (
10). 84L as a single mutation
has a minor
effect on the interaction of the protease with SQV
(fourfold increase
in
Ki). Why, then, does the 84L mutation appear?
In the absence of data for the G48V-plus-I84L combination, we
can only
speculate that this combination, either within the quadruple
background
or as a pair, has an effect on the affinity of the
protease for SQV or
the catalytic efficiency of the protease containing
the quadruple
mutation. The fact that this combination of mutations
elicited a
resensitization to APV, while understandable mechanistically
as
described here, is obviously coincidental, since the selection
pressure
of the experiment was for SQV resistance alone. Such
resensitization
was not observed with any other PI combinations
tested at the same time
(data not shown), hence the unexpected
phenotype described
here.
In conclusion, an interesting drug-resistant phenotype was observed
during the in vitro passage of APV-resistant HIV-1 in
the presence of
SQV, resulting in SQV resistance and APV resensitization.
A detailed
dissection of the protease from this virus at the enzymological
and
structural levels demonstrated facets of the PI-protease interaction
that were perfectly understandable as a gain or loss of individual
interatomic interactions within the context of the combined
quadruple-mutant
active site. We are optimistic that the establishment
of such
a detailed understanding of the HIV-1 protease-PI interaction
will lead to the design of more efficacious drugs with less resistance
potential.
| |
ACKNOWLEDGMENTS |
We thank Jim Griffith, John Fulghum, and Sam Pazhanisamy for work
related to this project and Ann Kwong and Vicki Sato for careful
reading of the manuscript and suggested improvements that were
gratefully received.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Vertex
Pharmaceuticals Incorporated, 130 Waverly St., Cambridge, MA
02139-4242. Phone: (617) 577-6124. Fax: (617) 577-6210. E-mail:
william_markland{at}vpharm.com.
| |
REFERENCES |
| 1.
|
Boden, D., and M. Markowitz.
1998.
Resistance to human immunodeficiency virus type 1 protease inhibitors.
Antimicrob. Agents Chemother.
42:2775-2783[Free Full Text].
|
| 2.
|
Condra, J. H.
1998.
Virological and clinical implications of resistance to HIV-1 protease inhibitors.
Drug Resistance Updates
1:292-299[CrossRef][Medline].
|
| 3.
|
Erickson, J. W., and S. K. Burt.
1996.
Structural mechanisms of HIV drug resistance.
Annu. Rev. Pharmacol. Toxicol.
36:545-571[CrossRef][Medline].
|
| 4.
|
Horton, R. M., and L. R. Pease.
1991.
Recombination and mutagenesis of DNA sequences using PCR, p. 217-247.
In
M. J. McPherson (ed.), Directed mutagenesis. A practical approach. IRL Press and Oxford University Press, Oxford, United Kingdom.
|
| 5.
|
Hui, J. O.,
A. G. Tomasselli,
I. M. Reardon,
J. M. Lull,
D. P. Brunner,
C. S. Tomich, and R. L. Heinrikson.
1993.
Large scale purification and refolding of HIV-1 protease from Escherichia coli inclusion bodies.
J. Protein Chem.
12:323-327[CrossRef][Medline].
|
| 6.
|
Kim, E. E.,
C. T. Baker,
M. D. Dwyer,
M. A. Murcko,
R. D. Tung, and M. A. Navia.
1995.
Crystal structure of HIV-1 protease in complex with VX-478, a potent and orally bioavailable inhibitor of the enzyme.
J. Am. Chem. Soc.
117:1181-1182[CrossRef].
|
| 7.
|
Maschera, B.,
G. Darby,
G. Palu,
L. L. Wright,
M. Tisdale,
R. Myers,
E. D. Blair, and E. S. Furfine.
1996.
Human immunodeficiency virus: mutations in the viral protease that confer resistance to saquinavir increase the dissociation rate constant of the protease-saquinavir complex.
J. Biol. Chem.
271:33231-33235[Abstract/Free Full Text].
|
| 8.
|
Partaledis, J. A.,
K. Yamaguchi,
M. Tisdale,
E. E. Blair,
C. Falcione,
B. Maschera,
R. E. Myers,
S. Pazhanisamy,
O. Futer,
A. B. Cullinan,
C. M. Stuver,
R. A. Byrn, and D. J. Livingston.
1995.
In vitro selection and characterization of human immunodeficiency virus type 1 (HIV-1) isolates with reduced sensitivity to hydroxyethylamino sulfonamide inhibitors of HIV-1 aspartyl protease.
J. Virol.
69:5228-5235[Abstract].
|
| 9.
|
Pazhanisamy, S.,
J. A. Partaledis,
B. G. Rao, and D. J. Livingston.
1998.
In vitro selection and characterization of VX-478 resistant HIV-1 variants.
Adv. Exp. Med. Biol.
436:75-83[Medline].
|
| 10.
|
Pazhanisamy, S.,
C. M. Stuver,
A. B. Cullinan,
N. Margolin,
B. G. Rao, and D. J. Livingston.
1996.
Kinetic characterization of human immunodeficiency virus type-1 protease-resistant variants.
J. Biol. Chem.
271:17979-17985[Abstract/Free Full Text].
|
| 11.
|
Roberts, N. A.
1995.
Drug-resistance patterns of saquinavir and other HIV proteinase inhibitors.
AIDS
9:527-532[Medline].
|
| 12.
|
Rose, R. B.,
C. S. Craik, and R. M. Stroud.
1998.
Domain flexibility in retroviral proteases: structural implications for drug resistant mutations.
Biochemistry
37:2607-2621[CrossRef][Medline].
|
| 13.
|
Schinazi, R. F.,
B. A. Larder, and J. W. Mellors.
1997.
Mutations in retroviral genes associated with drug resistance.
Int. Antiviral Newsl.
5:129-142.
|
| 14.
|
Tisdale, M.,
R. E. Myers,
B. Maschera,
N. R. Parry,
N. M. Oliver, and E. D. Blair.
1995.
Cross-resistance analysis of human immunodeficiency virus type 1 variants individually selected for resistance to five different protease inhibitors.
Antimicrob. Agents Chemother.
39:1704-1710[Abstract].
|
Journal of Virology, August 2000, p. 7636-7641, Vol. 74, No. 16
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Maguire, M. F., Guinea, R., Griffin, P., Macmanus, S., Elston, R. C., Wolfram, J., Richards, N., Hanlon, M. H., Porter, D. J. T., Wrin, T., Parkin, N., Tisdale, M., Furfine, E., Petropoulos, C., Snowden, B. W., Kleim, J.-P.
(2002). Changes in Human Immunodeficiency Virus Type 1 Gag at Positions L449 and P453 Are Linked to I50V Protease Mutants In Vivo and Cause Reduction of Sensitivity to Amprenavir and Improved Viral Fitness In Vitro. J. Virol.
76: 7398-7406
[Abstract]
[Full Text]
-
Kantor, R., Fessel, W. J., Zolopa, A. R., Israelski, D., Shulman, N., Montoya, J. G., Harbour, M., Schapiro, J. M., Shafer, R. W.
(2002). Evolution of Primary Protease Inhibitor Resistance Mutations during Protease Inhibitor Salvage Therapy. Antimicrob. Agents Chemother.
46: 1086-1092
[Abstract]
[Full Text]
Top
Abstract
Text
