Previous Article | Next Article ![]()
Journal of Virology, August 2000, p. 7284-7297, Vol. 74, No. 16
Cancer Research Campaign, Department of
Molecular Biology, Paterson Institute for Cancer Research, Christie
Hospital, Manchester M20 4BX, United Kingdom
Received 10 March 2000/Accepted 19 May 2000
Human papillomaviruses (HPV) are unique in that they generate mRNAs
that apparently can express multiple proteins from tandemly arranged
open reading frames. The mechanisms by which this is achieved are
uncertain and are at odds with the basic predictions of the scanning
model for translation initiation. We investigated the unorthodox
mechanism by which the E6 and E7 oncoproteins from human
papillomavirus type 16 (HPV-16) can be translated from a single,
bicistronic mRNA. The short E6 5' untranslated region (UTR) was shown
to promote translation as efficiently as a UTR from Xenopus
The majority of eukaryotic mRNAs are
monocistronic, that is, they encode only a single functional open
reading frame (ORF). A few viral and cellular mRNAs have extended 5'
untranslated leader sequences (5'UTR) which can contain numerous small
ORFs. These types of mRNA present a problem for an understanding of the
translational machinery because, according to the scanning model for
translational initiation (29, 31, 32), ribosomal subunits
contact the 5' end of the mRNA (assisted by the cap structure and its
binding proteins) and then scan in a 5' to 3' direction until they
encounter a suitable start codon, at which point they initiate
translation. Upon termination of translation, ribosomes are not
immediately competent to reinitiate translation. Numerous examples
have been reported in which mRNA translation does not conform to the
basic predictions of the scanning model because the leader sequences are long and contain AUG codons upstream of the primary ORF
(reviewed in references 17, 23, and
39). Several different mechanisms have been
described by which the translation complexes are able to negotiate
leader sequences containing upstream AUGs (uAUGs). If upstream start
codons are in a sequence context which is a poor match for the
Kozak consensus A/GCCATGG (6, 26, 30), then a
proportion of scanning complexes may fail to initiate at the AUG and
continue scanning to the next AUG. This is known as leaky scanning.
Alternatively, initiation may occur at the AUG of an upstream ORF
(uORF), but following termination a proportion of the ribosomal 40S
subunits remain attached to the template and resume scanning, gradually
regaining competence to reinitiate translation at a downstream
site. This mechanism is known as termination-reinitiation. Ribosomes may also bypass the 5' end of the mRNA altogether and initiate from internal entry sites. Internal ribosomal entry sites (IRES) have been demonstrated in picornaviruses, hepatitis C virus, and
several cellular genes (23). Another mechanism, known as ribosomal shunting, has been observed in cauliflower mosaic virus, adenovirus, and Sendai virus, in which ribosomal initiation complexes first contact the 5' end of the mRNA, scan for a short distance, and
then translocate to a remote position without scanning through the
intervening sequences (11, 16, 35, 56, 57, 73).
In most circumstances, the presence of a uORF inhibits initiation at
downstream AUGs, and it often appears that the sole function of the
uORF is to regulate expression of the primary ORF of the mRNA
(17). Human papillomaviruses (HPVs), on the other hand, are
unique in that many of their mRNAs appear to be truly multifunctional, that is, they code for more than one functional protein through independent, tandemly arranged ORFs (2, 5, 22, 51, 69). The
mechanisms by which these mRNAs are translated and the implications of
this arrangement for posttranscriptional gene regulation are as yet
poorly understood.
HPVs are small, double-stranded DNA viruses which infect cutaneous or
mucosal epithelia. Some types of HPV infect genital mucosal epithelia,
giving rise to genital warts or cervical intraepithelial neoplasia
(CIN). While both conditions present significant medical challenges,
CIN is important because it is a precursor lesion to invasive carcinoma
of the cervix. HPV type 16 (HPV-16) and related types are classed as
high-risk viruses because of their association with high-grade CIN and
cervical carcinoma (reviewed in reference 70).
Transcriptional analysis of HPV infections from isolated lesions, cell
lines, and organotypic raft cultures has revealed that most HPV mRNAs
are bicistronic or polycistronic (1). This has generated
difficulties with understanding the HPV life cycle because it is not
possible to infer that a specific viral protein is expressed by simply
observing the abundance of mRNAs which contain the ORF. With the two
major oncoproteins, E6 and E7, the implications of
polycistronic transcripts are more far reaching. High-risk HPVs use a
single promoter to drive expression of mRNAs containing both E6 and E7,
while in low-risk viruses each of the two genes has its own promoter
(65). In a study of the high-risk HPV-16, we showed
previously that E7 synthesis is attenuated by the requirement for
translation from E6/E7 bicistronic mRNAs generated by the
P97 promoter (69). E7 synthesis was restricted whether or not the transcript had undergone a differential splicing event in the E6 ORF (the *I splice; see Fig.
1), and we contended that the sole
function of this splice is to restrict E6 expression in balance with
E7. We suggested that the bicistronic E6/E7 mRNA arrangement provides a
motor for the evolution of the high-risk virus types, both in the
acquisition of strong transforming activities of the E6 and E7 proteins
to overcome their restricted expression and in their high propensity to
deregulate in a coordinate, prooncogenic manner.
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Leaky Scanning Is the Predominant Mechanism for Translation of
Human Papillomavirus Type 16 E7 Oncoprotein from E6/E7
Bicistronic mRNA
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-globin. Insertion of a secondary structural element into the UTR
inhibited both E6 and E7 expression, suggesting that E7 expression
depends on ribosomal scanning from the 5' end of the mRNA. E7
translation was found to be cap dependent, but E6 was more dependent on
capping and eIF4F activity than E7. Insertion of secondary structural
elements at various points in the region upstream of E7 profoundly
inhibited translation, indicating that scanning was probably
continuous. Insertion of the E6 region between Renilla and
firefly luciferase genes revealed little or no internal ribosomal entry
site activity. However when E6 was located at the 5' end of the mRNA,
it permitted over 100-fold-higher levels of downstream cistron
translation than did the Renilla open reading frame.
Internal AUGs in the E6 region with strong or intermediate Kozak
sequence contexts were unable to inhibit E7 translation, but initiation
at the E7 AUG was efficient and accurate. These data support a model in
which E7 translation is facilitated by an extreme degree of leaky
scanning, requiring the negotiation of 13 upstream AUGs. Ribosomal
initiation complexes which fail to initiate at the E6 start codon
can scan through to the E7 AUG without initiating translation, but
competence to initiate is achieved once the E7 AUG is reached. These
findings suggest that the E6 region of HPV-16 comprises features that
sponsor both translation of the E6 protein and enhancement of
translation at a downstream site.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

View larger version (32K):
[in a new window]
FIG. 1.
(A) Structures of plasmids made to investigate
the efficiency of the endogenous E6 5'UTR and to determine whether
scanning from the 5' end of the mRNA was required for both E6 and
E7 translation. All inserts were under the control of the T7 promoter
and terminator. Details of individual constructs are given in the text.
(B) 5'UTR leader sequences from the constructs shown in A. The E6 start
codon is shown in bold, and endogenous HPV-16 sequences are
underlined. Transcription start points are marked by an arrow. HPV-16
refers to the endogenous leader sequence which results from
transcription from the P97 promoter in HPV-16. (C) Capped
RNAs from the constructs indicated were synthesized in vitro and
then translated in RRL in the presence of [35S]cysteine,
and labeled proteins were visualized by SDS-PAGE and autoradiography.
(D) The relative levels of E6 expression from the various constructs
were quantitated by PhosphorImager analysis and expressed relative to
the E6 levels found in pNL67. Data are from 10 replicate experiments
using two different RNA preparations, and error bars indicate standard
errors. (E) Capped RNAs from the constructs indicated were translated
as above and then subjected to RIPA using an E7 antibody, followed by
SDS-PAGE and autoradiography. Sizes are shown in kilodaltons. (F)
PhosphorImager quantitations of E7 expression from the indicated
constructs were expressed relative to the E7 levels found in pNL67.
Despite the posttranscriptional restrictions in their expression, both E6 and E7 oncoproteins are produced in sufficient quantities to permit virus replication and, in vitro, host cell immortalization. This suggests that, in addition to inhibiting E7 translation, the E6 region may function to facilitate E7 translation from its downstream position. In this study we have analyzed the mechanism by which E7 can be translated from bicistronic RNAs encoding E6 and E7 ORFs. We concluded that the majority of ribosomes which translate E7 contact first the 5' end of the mRNA and scan linearly through the E6 region without initiating translation at any of the 13 uAUGs preceding the E7 ORF. Once the E7 start codon is encountered, however, initiation is efficient and accurate. These results suggest that HPVs use an extreme form of leaky scanning in order to translate polycistronic mRNAs.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Construction of recombinant clones. The numbering system for HPV-16 is specified in reference 61. HPV-16 sequences were cloned from the archetypal Heidelberg isolate (a gift from H. zur Hausen) except for clones containing the *I splice, which were obtained from SiHa cells by reverse transcription (RT)-PCR as described previously (69).
pHET6 contains HPV-16 sequences from nucleotides (nt) 97 to 654 cloned into the transcription vector pET-3 (53). pHET7 contains HPV-16 sequences from nt 553 to 879 in pET-3. pNL67 was created from a pBluescriptII vector containing the E6/E7 region (pKE67) by insertion of an oligonucleotide linker between a KpnI vector site and the HPV-16 EcoO109I site at nt 112. The linker sequence was (top) 5'CgatatcTGCAATGTTTCAG and (bottom) 5'GTCCTGAAACATTGCAgatatcGGTAC, where the E6 ATG codon is shown in boldface. The linker contained an EcoRV site (shown in lowercase) which was used to recover the HPV E6/E7 fragment (nt 97 to 879) as an EcoRV-BamHI fragment. This fragment was inserted into transcription vector pET-7 (a gift from F. W. Studier) (53) between the StuI and BamHI sites. The T7 promoter initiates transcription at the site shown in Fig. 1B (53). pNL*I was derived from an RT-PCR clone containing HPV-16 nt 97 to 875 with the *I intron (nt 226 to 409) removed. The strategy was otherwise the same as for pNL67. To produce p
67, plasmid pET-7 was first modified by insertion of
oligonucleotides comprising the Xenopus
-globin 5'UTR. The oligonucleotides were (top)
5'GAATACAAAGCTTGCTTGTTCTTTTTGCAGAAGCTCAGAATAAACGCTCAACTTTGGCAG and (bottom)
5'GATCCTGCCAAAGTTGAGCGTTTATTCTGAGCTTCTGCAAAAAGAACAAGCAAGCTTGTATTC and were inserted between the StuI and
BamHI sites of pET-7 to produce pET7
. A BamHI
site was engineered immediately preceding HPV-16 nt 97 in pKE67, and
the E6/E7 region (nt 97 to 879) was recovered as a BamHI
fragment and ligated into the BamHI site of pET7
. p
*I
was produced by similarly cloning the *I RT-PCR fragment into pET7
.
For p
2o67, pET-7 was modified by insertion of an
oligonucleotide linker containing the Xenopus
-globin
leader sequence and secondary structural element between the
StuI and BamHI sites to produce
pET7
2o. The inserted sequence was
5'ATCGAATACAAGCTTGCTTGTTCTTTTTGCAGAGGTACCGGTACCGGTACCGGTACCGGTACCGGTACCGGTACCAGCTCAGAATAAACGCTCAACTTTGGCAGGATCC. A BamHI fragment containing the E6/E7 region (nt 97 to
879) was then inserted into the BamHI site of
pET7
2o. p
2o*I was produced by cloning the
*I RT-PCR fragment into the BamHI site of
pET7
2o.
To produce pNL67cat, p
67cat, and p
2o67cat, the
chloramphenicol acetyltransferase (CAT) gene from pSV2cat was amplified
by PCR using a forward primer that changed the CAT start codon to comprise an NsiI site, as found at the endogenous E7 start
codon. The 3' primer introduced a PstI site, and the CAT
PCR fragment was used to replace the E7 ORF from the NsiI
(nt 566) to PstI (nt 879) sites in pKE67. The resulting
plasmid was used to derive pNL67cat, p
67cat, and
p
2o67cat using the same strategies as described above
for pNL67, p
67, and p
2o67, respectively. Plasmids
pNL*Icat, p
*Icat, and p
2o*Icat were produced using a
similar strategy except that the CAT PCR fragment was used to replace
the E7 ORF in the context of the *I spliced RT-PCR clone prior to
cloning into the pET-7-derived transcription vectors.
pRV2o67 was constructed by insertion of a
KpnI-EcoO109I oligonucleotide containing a
secondary structure with a
G of
62.2 kcal/mol between
the KpnI (vector) and EcoO109I (nt 112) sites of
pKE67. The oligonucleotide linker contained an EcoRV site 5' to the secondary structural element. The E6/E7 region (nt 97 to 879)
plus secondary structural element were excised as an
EcoRV-BamHI fragment and inserted into pET-7
between the StuI and BamHI sites. The resulting
sequence at the 5' end of E6 is shown in Fig. 5B.
For pEco2o67, the vector pKE67 was first modified by the
insertion of the 5' linker as described for pNL67. This intermediate was further modified by insertion of a secondary structure
oligonucleotide (
G =
62.2 kcal/mol) into the
EcoO109I (nt 112) site (see Fig. 5C), followed by recovery
of the E6/E7 region as an EcoRV-BamHI fragment
and cloning into pET-7.
To produce pBgl2o67, PCR mutagenesis was first used to
create a BglII site at nt 154 (AGAGCT changed to
AGATCT) in pKE67. A secondary structural oligonucleotide
(
G =
76.8 kcal/mol) was then inserted into the
BglII site. The vector was further modified and cloned into
pET-7 as described for pNL67. A similar strategy was used to produce
pE6-3'2o67, where a BglII site was created at nt
552 (AGCTGT changed to AGATCT) followed by
insertion of a secondary structural oligonucleotide (
G =
62.2 kcal/mol) and cloning into pET-7. Note that the secondary structural element in pE6-3'2o67 shifts the E6 termination
codon two positions upstream. pBgl2o67TGA
was cloned in the same way as pBgl2o67 except the
oligonucleotide was modified slightly to introduce a frameshift
mutation, resulting in termination at nt 175. The structure of the
oligonucleotide is shown in Fig. 5B. pNde2o67 contained a
secondary structure oligonucleotide with a
G of
62.2
kcal/mol inserted at the nt 280 NdeI site.
The core of the Kozak consensus sequence for start codons is
A/GCCATGG (6, 26, 30). For the purposes of this
paper, AUG codons were considered to have a strong Kozak context if
there was an A at position
3 or G's at both
3 and +1. Codons were considered to have an intermediate context if they contained a G at
3
but no G at +1. All other contexts were considered to be weak. p
1,
p
2, p
3, and p
123 were created by PCR mutagenesis of pKE67. In
p
1, the initiation codon at position 148 was modified from
TTATGC to TTGTGC,
where the altered nucleotide is in italics, the initiation
codon is in boldface, and the modified codon in the E6 ORF is
underlined. In p
2, the start codon at nt 190 was changed from
GAATGT to GAGTGT.
For p
3, the mutation GATGGG to
GCTGGG was introduced at nt 270. In
p
123, all three mutations were combined. Note that p
1 and p
2
do not introduce amino acid changes into the E6 ORF, whereas p
3
results in an Asp-to-Ala substitution. The modified E6/E7 regions were
recovered and cloned into pET-7 as described above for pNL67.
The dual luciferase vector pGL3R2 and the c-myc IRES vector
pGL3utr were gifts from A. E. Willis (71). To produce
pGLE6SD, mutations were first introduced pKE67 at nt 223 and 227 to
eliminate the *I splice donor sites present in E6. The alteration was
ACGTGAGGTAT to
ACGCGAGCTAT, where the *I splice donor
is shown in bold and the modified nucleotides are shown in italics.
This mutation has been shown previously to prevent *I splicing
(60). The region nt 97 to nt 658 was recovered by PCR and
cloned between the EcoRI and NcoI sites of
pGL3R2, as shown in Fig. 6A. The 5' junction was
gaattcAACTGCAATGTTT, where the EcoRI
cloning site is shown in lowercase and the E6 AUG is in boldface. The
3' junction was TCA GCT CCC ATG GCC, where
the firefly luciferase (F-luc) initiation codon is shown in
boldface and the NcoI cloning site is in italics. This
junction fused Ser31 of E7 (underlined) in-frame to the F-luc ATG via
an Ala-Pro linker. p
RL67 was derived from pGLE6SD by deletion of the
EcoRV-EcoRI Renilla luciferase (R-luc) fragment. Monocistronic F-luc and E7-F-luc fusion vectors, designated p
RL and p
RL
6, respectively, were produced in order to control for a potential impairment of firefly luciferase activity resulting from the fusion between the 31 N-terminal amino acids from E7 and
F-luc. p
RL was produced from pGL3R2 by deletion of the
EcoRV-EcoRI R-luc fragment. p
RL
6 was
derived from pGLE6SD by deletion of an
EcoRV-PvuII (nt 553) fragment comprising R-luc
and E6. The relative activities of p
RL and p
RL
6 were used to
establish a correction factor for use with E7-F-luc fusion vectors.
All constructs used in this study were verified by DNA sequencing using
an ABI Prism 373A automated sequencer. Constructs were propagated in
Escherichia coli XL1-Blue except for those containing
secondary structures, which were maintained in E. coli SURE
(both strains from Stratagene).
In vitro transcription and translation.
RNA was synthesized
in vitro using a Promega Ribo-Max kit according to the manufacturer's
instructions. To produce capped RNA, m7G(5')ppp(5')G was
added to 30 mM, and the GTP concentration was limited to 0.75 mM for 30 min at 37°C, and then the GTP concentration was increased to 7.5 mM
for a further 60 min of incubation. The reaction was then treated with
DNase, the RNA was purified using Qiagen RNAeasy columns, and the yield
was determined spectrophotometrically. Purified RNA (25 µg/ml) was
translated in 25-µl reactions in the presence of
[35S]cysteine (11 µCi per reaction) in 67% rabbit
reticulocyte lysate (Promega Flexi-Lysate) for 60 min at 30°C.
Reactions contained 70 mM added KCl unless otherwise stated and 2.0 mM
Mg2+ (final concentration). Reactions were found to
initiate accurately and were insensitive to moderate changes in RNA
concentration under these conditions (data not shown). Upon termination
of the reaction, phenylmethylsulfonyl fluoride (PMSF) and aprotinin
were added to concentrations of 0.5 mM and 1 µg/ml, respectively. For direct visualization of labeled material, 0.5 µl of translation reaction mixture was mixed with polyacrylamide gel electrophoresis (PAGE) loading buffer and resolved by 20% PAGE, followed by
autoradiography or PhosphorImager (Storm; Molecular Dynamics) analysis.
For immunoprecipitation, 2 µl of translation reaction was diluted to
50 µl with radioimmunoprecipitation assay (RIPA) buffer (1% NP40,
0.5% deoxycholate, 0.1% sodium dodecyl sulfate [SDS], 50 mM
Tris-HCl, 150 mM NaCl, 0.5 mM PMSF and 1 µg of aprotinin per ml).
Antibody was added to 1:50 dilution followed by incubation at 4°C
overnight. Protein A Sepharose beads (20 µl) were added, and
incubation was continued for 1 h at 4°C. After extensive washing
with RIPA buffer, the beads were boiled in 20 µl of PAGE loading
buffer and resolved by 20% PAGE. Antibodies used for
immunoprecipitation were E7 N-terminal antipeptide 2-18 polyclonal
rabbit antibody 145-3R (67); RP
E7 rabbit polyclonal raised against an E. coli-expressed MS2-E7 fusion protein
(68). Hu+ and Hu
were human sera previously characterized
as positive and negative, respectively, for E7 antibodies
(68). A10-60 guinea pig polyclonal E7 antipeptide 17-36 antibody (67) was also used.
Vaccinia virus infection and transfection assay. HeLa cells (3 × 105) in a 25-cm2 flask were infected with 10 PFU of vaccinia virus vTF7-3 (15) (a gift from B. Moss) per cell for 60 min. Cells were then transfected with 5 µg of plasmid expression vector using 30 µl of SuperFect reagent (Qiagen) according to the manufacturer's protocol. At 24 h postinfection, cells were lysed in 150 µl of PAGE loading buffer and disrupted by passing through a Qiashredder column (Qiagen); 20 µl of lysate was resolved by SDS-15%-PAGE, followed by Western blotting to Immobilon P membrane. E7 protein was detected using mouse monoclonal antibody ED17 (Santa Cruz). The blots were developed using 1:2,000 biotinylated anti-mouse IgG (DAKO) then 1:2,000 streptavidin-horseradish peroxidase (DAKO) and revealed by enhanced chemiluminescence (ECL) (Pharmacia-Amersham).
Transfection and luciferase assay. For transfection of dual luciferase vectors, six-well plates were inoculated with HeLa cells at 105 cells/well. The following day they were transfected with 2 µg of DNA using 10 µl of SuperFect reagent (Qiagen). Cells were harvested at 48 h posttransfection, and equal amounts of protein were analyzed for luciferase activities using a Promega "Stop and Glo" dual luciferase kit. Results were normalized by assigning the F-luc activity from pGL3R2 a value of 1 and expressing all other readings relative to this value.
RNA structural modeling. The secondary structural model for the HPV-16 mRNA sequence from nt 97 to nt 660 was produced according to the method of Zucker (25, 75) using the GCG MFOLD software. Because reliable predictions cannot be made from a sequence of this length, the sequence was broken up into segments comprising 100 nt, each succeeding segment overlapping the previous by 50 nt. Up to 20 alternative structures for each window were sought, and structures that were represented most frequently were identified. The boundaries of any stem-loop structures were identified, and each stem-loop was modeled again in isolation. Once the features of consistently predicted structures had been identified, aligned sequences of HPV-31 and HPV-18 (14) were examined for the presence of similar structures. Phylogenetically conserved base pairings were then used to constrain the model.
| |
RESULTS |
|---|
|
|
|---|
The short E6 5'UTR is fully efficient in supporting initiation at
the E6 AUG.
In our previous analysis of HPV-16 E6/E7 translation,
we had shown that the E7 ORF is not translated by ribosomes which have reinitiated after translating E6. We showed that ribosomes which bypass
the E6 start codon are capable of proceeding efficiently to
translate E7 (69). The ability of ribosomal scanning
complexes to leaky-scan through the E6 AUG may be facilitated by the
proximity of the E6 start codon (at nt 104) to the 5' end of the
mRNA (at nt 97). We wished to investigate whether the short E6 5'UTR
allowed readthrough of the E6 start codon by leaky scanning and
whether such readthrough would facilitate E7 expression from an E6/E7 bicistronic transcript. A T7 polymerase-driven expression vector was
constructed in which the natural leader sequence is closely mimicked
(pNL67 in Fig. 1A and B). This construction necessitated the addition
of a single G residue onto the E6 5'UTR, since this is required for T7
promoter functionality (53), and an A>T transversion at
position 98 to create an EcoRV restriction site. For
comparison, a construct was produced in which the highly efficient
5'UTR from Xenopus
-globin mRNA (13) was
cloned upstream of the E6 5'UTR (p
67 in Fig. 1A and B). In order to
study the effect of the E6 5'UTR in the context of E6*I spliced
transcripts, equivalent constructs were produced in which the *I intron
had been removed (pNL*I and p
*I in Fig. 1A). As controls,
monocistronic constructs were used which produce only E6 (pHET6) or
only E7 (pHET7).
67 (Fig. 1C, lanes 3 and 4). This indicated
that the E6 5'UTR, as mimicked in pNL67, was fully efficient for
loading ribosomal scanning complexes onto the E6 AUG. The E6*I protein
was not detected in these experiments, supporting previous observations
that this protein may have limited stability (51).
The E7 protein could not be visualized well by direct autoradiography
in these experiments because its expression level is restricted when it
is translated from bicistronic mRNA (69) and because an
endogenous protein-tRNA complex in RRL interferes with migration.
Accordingly, E7 protein synthesis was visualized by RIPA using an
antipeptide antiserum (67). Analysis of E7 synthesis (Fig.
1E and F) showed that addition of the efficient
-globin leader
sequence did not compromise E7 synthesis, as would have been expected
if this sequence had prevented the leaky scanning of the E6 AUG. In
fact, E7 synthesis was slightly decreased with the
-globin leader,
but no more so than the E6 synthesis. The E7 experiments also allowed
the examination of the effect of splicing. In support of our previous
findings, splicing of the *I intron had little or no effect in
facilitating E7 synthesis when either the NL or
-globin leader
sequences were present (Fig. 1E and F).
The E6 5'UTR is scanned by ribosomes that translate the E7
ORF.
If the ribosomal initiation complexes which engage the E7 AUG
scan through the E6 AUG without initiation, it would be expected that
blocks to scanning located upstream of E6 would also inhibit E7
expression. The constructs p
2o67 and
p
2o*I were produced, containing an element capable of
forming a stable hairpin structure (
G =
65.4 kcal/mol)
inserted into the
-globin leader sequence upstream of E6 (Fig. 1A
and B). A similar element has been shown previously to present an
effective block to scanning ribosomal initiation complexes
(47). Insertion of this element into the E6/E7 RNA resulted
in a profound inhibition of E6 synthesis, as expected (Fig. 1D and C,
lane 5). Insertion of the secondary structural element was also found
to inhibit E7 synthesis from both spliced and unspliced RNAs (Fig. 1F
and E, lanes 14 and 17). While this inhibition did not appear to be as
profound as the inhibition of E6, this may be due to the more sensitive
assay used for E7 detection. We concluded that E7 was translated
predominantly by ribosomal initiation complexes which scanned
through the region upstream of the E6 AUG. Taken together with our
previously published evidence that E7 is not translated by
termination-reinitiation (69), these observations suggest
that E7 is translated by ribosomes that scan in from the 5' end of the
mRNA and bypass the E6 start codon by a mechanism that does not
require proximity of the E6 AUG to the 5' end.
The E6 ORF allows a high level of readthrough to E7.
In the
preceding experiments, it was not possible to assess the abundance of
E7 proteins relative to E6 because different methods were required for
their detection. A new set of constructs was produced in order to
obtain an estimate of the levels of E6 and E7 synthesis relative to
each other and thereby facilitate an analysis of the degree of
readthrough permitted by the E6 region. These constructs were analogous
to the series described above except that the E7 AUG was fused to the
CAT gene, taking care to retain the initiation codon in the
endogenous E7 context (see Materials and Methods). The increased size
of the E7-CAT protein alleviated the problem of PAGE migration
interference by endogenous RRL protein-tRNA complex. Translation of the
E7-CAT protein was visible by direct autoradiography of the same gels
as E6. This allowed, after correction for the numbers of cysteine
residues present in each protein, direct determination of the relative levels of E6 and E7-CAT translation (Fig.
2). Using pNL67cat, the construct which
mimics the natural E6 5'UTR, E7-CAT translation ran at a consistent 25 to 35% of E6 translation, suggesting that the E6 ORF permits a high
degree of readthrough. E7 translation initiation appears therefore to
be remarkably efficient, considering there are some 13 AUG codons
upstream of the E7 start codon. This relative rate of initiation
was maintained when the E6 5'UTR was substituted for the highly
efficient
-globin leader sequence in p
67cat (Fig. 2A, lanes 2 and
3), and splicing in pNL*Icat and p
*Icat had little apparent effect
on initiation at the E7 AUG (E7CAT in Fig. 2A, compare lanes 2 with 5 and 3 with 6). Insertion of the secondary structure into the
-globin
leader inhibited both E6 and E7-CAT expression (Fig. 2,
p
2o67cat and p
2o*Icat), confirming the
observation that initiation at the E7 AUG depended on scanning through
the UTR.
|
Translation of E7 from bicistronic RNA is cap dependent.
We
next investigated whether E7 translation relied upon a cap structure at
the 5' end of the bicistronic mRNA. Capped and uncapped bicistronic
mRNAs were synthesized from pNL67 and then used to program RRL
reactions. To some of the translation reactions, free
m7G(5')ppp(5')G cap analogue was added in order to inhibit
eIF4F binding to the mRNA (Fig. 3). E6
and E7 protein synthesis was detected by PAGE, RIPA, and
autoradiography as above. For E6, translation of capped and uncapped
transcripts resulted in an 8- to 10-fold increase in E6 synthesis
(Fig. 3A). Addition of free cap analogue strongly
inhibited E6 synthesis from capped but not uncapped pNL67 RNAs, as
expected. Synthesis of E7 from pNL67 bicistronic transcripts was also
potentiated by capping, although the magnitude of this effect was less
than had been observed with E6 (Fig. 3B). This indicated that synthesis
of both E6 and E7 from bicistronic transcripts is dependent on an
m7G(5')ppp(5')G cap structure on the 5' end of the mRNA, even though E7
has a reduced cap dependency relative to E6. This observation supported the idea that the majority of ribosomes that ultimately translate E7
first contact the 5' end of the mRNA and are assisted by eIF4F complexes.
|
Heat shock and potassium chloride concentrations have differential
effects on E6 and E7 synthesis.
It has been shown previously that
heat shock rapidly inhibits translation due to inactivation of
translational initiation factors eIF4F and eIF2. In RRL, the
predominant effect of heat shock is the prevention of cap recognition
by eIF4F by inactivation of its eIF4E subunit (34, 46).
Moreover, with adenovirus late mRNAs, heat shock has been shown to
reveal a ribosomal shunt mechanism sponsored by the tripartite leader
(73). Therefore, the effects of heat shock on E6 and E7
translation were investigated, initially using pNL67-derived RNAs. Heat
shock lysates were incubated at 42°C for 30 min prior to programming
with RNA. As shown in Fig. 4A and B, heat
shock strongly inhibited E6 expression and, to a lesser degree, E7
expression. In order to confirm this apparent difference between E6 and
E7, the experiments were repeated using pNL67cat RNAs, which allowed
accurate quantitation of the relative levels of E6 and E7 translation.
Heat shock inhibited both E6 and E7-CAT expression (not shown), but the
effect on E7-CAT expression was less pronounced than on E6 expression,
so that the E7/E6 ratio increased to near unity in heat shock (Fig.
4C). These observations supported the view that E7 translation is
dependent on cap recognition by eIF4F and further suggested that E7
translation has a reduced dependency on canonical translational
initiation factors compared to E6.
|
Most ribosomes that initiate at the E7 AUG scan first through the
E6 region.
We examined whether initiation at the E7 AUG was
dependent upon scanning thorough the E6 region by inserting stable
secondary structures upstream of the E6 AUG and within the E6 ORF
itself, using pNL67 a base construct. The series of constructs is shown in Fig. 5A and B. Secondary structures of this stability are expected to block ribosomal
scanning but not translating ribosomes (27, 37). RNAs were
isolated and translated as before. Insertion of a secondary structure
upstream of the endogenous 5'UTR in pRV2o67 resulted in
complete abolition of E6 protein synthesis (Fig. 5C, lane 4, and Fig.
5D) as anticipated. Similarly, insertion of a secondary structure 10 nt
downstream of the E6 AUG in pEco2o67 also abolished E6
synthesis (Fig. 5C, lane 5, and Fig. 5D), probably because of the
proximity of the secondary structure to the start codon
(27). Secondary structures inserted in the body of the E6
ORF (pBgl2o67 and pNde2o67) and at its 3' end
(pE63'2o67) resulted in production of E6 protein at levels
30 to 40% of wild type (Fig. 5C, lanes 7 to 9, and Fig. 5D). This was
perhaps caused by interference of E6 translation by scanning complexes that are approaching the E7 ORF and queue upstream of the scanning block (see below) (27).
|
The E6 region does not encode an efficient IRES.
If ribosomal
initiation at the E7 AUG were sponsored by an internal ribosomal
initiation site as opposed to a leaky scanning mechanism, then
initiation should occur independently of the presence of upstream
cistrons. The E6 ORF was examined for its ability to act as an IRES for
E7 translation by cloning the E6 region between the
Renilla luciferase (R-luc) and firefly luciferase (F-luc) genes in vector pGL3R2 (71), producing pGLE6SD
(Fig. 6A). This vector contained the
entire E6 ORF and leader sequence from the transcription initiation
site at nt 97 under control of the simian virus 40 (SV40) early
promoter. In addition, this construct contained splice site mutations
in the E6 ORF to prevent *I intron splicing. Because previous reports
have implicated downstream coding sequences as integral parts of some
IRES elements (50), the 3' end of the HPV insert in pGLE6SD
included the first 93 nt of the E7 ORF fused in-frame to the F-luc
gene. Monocistronic control constructs containing F-luc or the E7/F-luc
fusion protein were produced and used to correct for any loss of
luciferase activity resulting from the inclusion of the E7 sequences in
the fusion protein. As a positive control for IRES activity, we used
pGL3utr, which contains the c-myc IRES inserted between the
R-luc and F-luc genes (71). These constructs were used to
transfect HeLa cells, and the levels of Renilla and firefly
luciferase were determined at 48 h posttransfection. As shown in
Fig. 6B, F-luc expression was minimal from the bicistronic vector
pGL3R2, as expected. Addition of the c-myc UTR resulted in a
greater than 40-fold increase in expression from the downstream F-luc
cistron, in line with previously published observations
(71). However, when the E6/E7 region was substituted between
the R-luc and F-luc genes (pGLE6SD), a less than fourfold increase in
firefly luciferase activity was observed, revealing little or no IRES
activity.
|
RL67 in Fig. 6A), compared with the levels
obtained when R-luc was positioned upstream of the reporter gene (in
pGL3R2). As shown in Fig. 6B, placement of the E6 ORF upstream of the
reporter allowed a greater than 100-fold-higher level of readthrough
than was permitted by the R-luc ORF. Reference to the monocistronic
controls allowed us to estimate that 1 in 4 ribosomes contacting the 5'
end of the p
RL67 mRNA initiated at the E7 AUG, whereas in the
R-luc-F-luc mRNA, only 1 in 500 ribosomes initiated at the AUG of the
downstream cistron. The results from these transfection experiments
agreed well with the estimates made using the RRL system. We concluded
that although the E6 region of HPV-16 does not comprise an
efficient IRES, it does allow a remarkable degree of scanning
through to the E7 AUG when placed at the 5' end of the mRNA.
Out-of-frame AUGs located within the E6 region are not recognized
by scanning ribosomal initiation complexes.
We had shown
previously that two minicistrons located immediately upstream of the E7
AUG had no inhibitory effect on E7 synthesis from a *I spliced
bicistronic template (68). An analysis of the start
codons in the E6 region showed that there are 12 cistrons internal
to the E6 ORF, all but one of which are out of frame with respect to E6
(Fig. 7A). Three of these had AUGs which
we categorized as having intermediate or strong matches with the Kozak
consensus for efficient translational initiation. If these codons
were recognized efficiently by scanning ribosomal complexes which had
missed the E6 start codon, then the expected result would be a
suppression of E7 synthesis. We investigated whether these AUGs were
recognized and thus presented an impediment to E7 synthesis by deleting
the start codons of these three ORFs, both singly and in
combination. As shown in Fig. 7B and C, removal of these internal start
codons had minimal effect on E7 synthesis. We concluded that the
ribosomal complexes which scan beyond the E6 AUG are not competent to
initiate at the three internal AUGs despite their rather good Kozak
consensus matches.
|
Recognition of the E7 AUG is accurate and nonleaky.
In a
previous study using E7 baculovirus expression vectors, we had shown
that when the E7 AUG is expressed using a synthetic leader with a poor
Kozak consensus context, leaky scanning of the E7 AUG occurs. The
result is a secondary initiation event at an in-frame internal
methionine at position 595, producing an N-terminally truncated E7
protein (E7
) which can be detected by some but not all E7 antisera
(68) (Fig. 8, left panel).
Substitution of the endogenous context of the E7 AUG abolished
synthesis of the truncated E7 product (Fig. 8, bE7Pvu). The experiments
described above using RRL employed the antipeptide antibody
145-3R, which detects only the full-length E7 protein. Using several
antisera that detect both full-length and E7
proteins, we
investigated whether the lack of recognition of start codons in the
E6 region was also reflected in a poor recognition of the E7 AUG. A
monocistronic construct in which E7 was in its natural context (pHet7)
permitted very little leaky scanning, as evidenced by only very low
abundance of the E7
product. With the bicistronic construct pNL67,
no E7
product was detected (Fig. 8, right panel), even on prolonged exposure of the autoradiograms (not shown). We concluded that although
start codons upstream of the E7 AUG were not recognized well,
ribosomal subunits which scan as far as the E7 AUG initiate accurately
and do not continue their leaky scanning behavior. This observation
suggests that scanning complexes may gain additional competence to
initiate as they approach the E7 AUG.
|
Secondary structural model of the E6 region of HPV-16.
The
secondary structure of the HPV-16 sequence from nt 97 to 660 was
modeled using the method of Zuker (25, 75). Windows of 100 nt, overlapping by 50 nt, were first modeled, and the model was refined
by examining each of the emergent secondary structures in isolation.
The model was further refined by using phylogenetic alignment with
HPV-31 and HPV-18. A graphic representation of the model is presented
in Fig. 9, with the following salient
features. No consistent structure could be predicted for the first
approximately 160 nt, suggesting a lack of pronounced secondary
structure. The region is also AT rich, consistent with a predicted low
degree of secondary structure. Four stem-loops labeled 1 to 4 were
consistently predicted in different plots for HPV-16 and were conserved
in both HPV-31 and HPV-18. Accordingly, the model shown was constrained to form the conserved stem-loop structures 1 to 3 and to leave the
first 160 nt unpaired. Other features which were consistently predicted
for HPV-16 were further stem-loop structures, labeled 180, 410, and
480. A "dog leg" structure, comprising a long stem with an unpaired
loop from nt 549 to 553, was present in all predicted structures for
HPV-16 encompassing this region, but it was not conserved
phylogenetically. This structure also included the E7 AUG at nt 562. The sites at which the secondary structures shown in Fig. 5 were
inserted are indicated in the model. It can be seen that all of the
inserted secondary structures with the exception of Nde2o
occurred at a position of low predicted endogenous secondary structure.
The Nde2o oligonucleotide was inserted into the descending
arm of conserved stem-loop 1. This may interfere with the folding of
the Nde2o structure and could account for its slightly
decreased effectiveness as a scanning block.
|
| |
DISCUSSION |
|---|
|
|
|---|
The HPV-16 genome is approximately 8 kb long, comprising eight ORFs, all encoded on the same DNA strand. The promoter locations for HPV-16 have not yet been completely defined (4, 18, 19, 65, 66), but it is clear from studies of a variety of papillomavirus types that there is not a 1:1 correspondence between promoters and ORFs (1). Therefore, HPVs must rely on posttranscriptional mechanisms to regulate expression of the various ORFs (1, 21, 59).
The structures of mRNAs from several HPV types have been defined using a variety of mapping techniques, and in all cases it appears that RNAs are produced that encode more than one ORF (7-9, 12, 20, 22, 40-44, 52, 54, 55, 62, 63). In several instances, for example E7, E2, and E5 in HPV-16, no RNAs have been defined in which the ORF is not preceded by an upstream coding ORF. Numerous investigators have noted that these polycistronic papillomavirus RNAs appear to be capable of producing more than one protein concurrently (2, 5, 22, 49, 51, 72), but the mechanisms underlying this have remained obscure. Termination-reinitiation (65, 72), leaky scanning (69), and shunting (49) have all been suggested previously as potential mechanisms.
In the high-risk genital HPV types, all known transcripts encoding E7 contain the E6 or E6* ORF upstream of the E7 start codon. In our previous study, we argued against termination-reinitiation by ribosomes that had translated the E6 ORF or its spliced variant E6*I as a mechanism by which ribosomes gain access to the E7 AUG. One of the main predictions of the termination-reinitiation hypothesis is that the *I splice would act to increase the efficiency of E7 synthesis (60, 65) because the E6 ORF is shortened and the intercistronic space has been increased (28, 38). The termination-reinitiation model is attractive, therefore, in that it provides a rationale for existence of the *I splice. The results in the present study (Fig. 1E and F) reconfirm that the *I splice has minimal effect on the efficiency of E7 synthesis in vitro and support the view that termination reinitiation does not play a major role in E7 translation. This point was further supported by experiments with the construct pBgl2o67TGA (Fig. 5A and B) in which a prematurely terminated E6 ORF was engineered to contain a region of secondary structure. If the predominant route to the E7 AUG is to scan rather than translate through the E6 region, then the inhibitory effects of the secondary structure ought to be revealed, as was observed in the experiments (Fig. 5D).
If the *I splice does not function to facilitate E7 expression, then what is its function? It has been reported that in transfected cells the C-terminally truncated product from the *I ORF can derepress p53 function by antagonizing the action of full-length E6 (48). However, we and others have been unable to detect the truncated E6* products immunologically even in systems where they are grossly overexpressed, suggesting that they may have limited stability (51, 67, 69). It remains uncertain whether these proteins have a physiologically relevant role. It is obvious that the *I splice prevents the bicistronic mRNA from synthesizing full-length E6 protein. Maintaining an appropriate balance between E6 and E7 expression may be a crucial function for the virus, and given the constraints of the bicistronic transcription unit, the *I splice may be the only way in which this can be achieved.
In our previous study we also showed that translation of the E6 (or E6*I) ORF is inhibitory to E7 synthesis (69). Evidence for this was that deletion of the E6 AUG potentiated E7 translation while forcing efficient translation of E6 by embedding its start codon in an encephalomyocarditis virus leader sequence resulted in reduced E7 translation. This could indicate that E7 synthesis requires leaky scanning of the E6 AUG, even though the Kozak consensus match of the E6 AUG is of intermediate strength. Alternatively, it could be that translation through the E6 ORF disrupts an IRES or other sequence element required for E7 translation.
Although the presence of the E6 ORF upstream of E7 causes an attenuation of E7 synthesis, one of the more interesting findings of the current study is how efficient E7 synthesis actually is despite the presence of a functional, coding ORF upstream. The E6 region of HPV-16 is extremely permissive for readthrough to the E7 AUG, allowing the E7 protein to be synthesized at a rate of approximately 25 to 35% of the E6 level. This permissivity was demonstrated both in RRL and in transfected HeLa cells. By comparison, an unrelated cistron (Renilla luciferase) resulted in a readthrough of only 0.2% to a downstream cistron (Fig. 6). The E6 region must have properties which facilitate initiation at downstream sites. The model that is most consistent with the results presented here is one involving an extreme leaky scanning mechanism. Ribosomal initiation complexes bind first to the 5' end of the mRNA and then scan through the E6 region without initiating translation at the 13 AUG codons they encounter until E7 is reached. Once reached, initiation at the E7 AUG is efficient and accurate.
The high levels of readthrough to E7 were shown to be dependent upon
interactions with the 5' end of the mRNA. Evidence for this was that
synthesis of E7 was potentiated by capping of the transcript and was
inhibited by soluble cap analogues. Heat shock, which in RRL depletes
factors necessary for binding the cap structure (eIF4F) (34,
45), inhibited E7 translation. Moreover, insertion of stable
secondary structures in close proximity to the 5' ends of either the
-globin 5'UTR or the endogenous leader sequence resulted in
inhibition of E7 expression as well as that of E6. This showed that the
majority of ribosomes which translate E7 interact first with the cap
structure at the 5' end of the mRNA and scan at least a short distance
along the RNA. These observations are also consistent with the
inability of the E6 region to demonstrate significant IRES activity in
the dual luciferase assay (Fig. 6), where high readthrough to E7
depended on the E6 ORF being closest to the 5' end of the RNA.
Ribosomal shunting, or discontinuous scanning, occurs when ribosomal initiation complexes bind first to the 5' end of an mRNA, scan for a short distance, and then translocate to a site further downstream where they can resume scanning or initiate translation (16, 35, 73). In operational terms, shunting can be differentiated from scanning by the ability of shunting ribosomes to bypass an inserted secondary structural element which would inhibit scanning ribosomes (23). We inserted stable secondary structures at a number of locations within the E6 5'UTR and the E6 ORF. At each location, the secondary structures profoundly inhibited the level of E7 translation. This indicated that the majority of ribosomes which translate E7 scan continuously through the E6 region without initiating translation.
Some of the observations made in this study do not fit well with
predictions drawn from a simple version of the leaky-scanning hypothesis. First, one would expect that E6 synthesis must be compromised in order to permit scanning ribosomes to pass through to
E7. Previous studies have shown that when 5'UTR regions are short, they
can promote leaky scanning of the first AUG (33, 64). The
structure of the E6 primary transcript has a very short (7 nt) leader
sequence. This setting, along with the intermediate-strength Kozak
consensus context, would seem to suggest that the E6 AUG is susceptible
to leaky scanning. In HPV-18 and HPV-31, the E6 AUG is also found in
close proximity to the 5' end of the respective mRNAs (20, 41,
58), leading some authors to assume that E6 cannot be translated
from such structures (49). However, when a proven-efficient,
unstructured leader sequence from the
-globin gene (13)
was added the HPV-16 E6 5'UTR, we observed little change in the
efficiency of E6 AUG utilization in RRL. It was not possible to test
directly the behavior of the endogenous E6 5'UTR in cellular
transfections because the low activity of the HPV-16 P97
promoter in such assays necessitated the use of a heterologous
(SV40 early) promoter producing a fusion mRNA. Nevertheless, in HeLa
cells, the E6 region was found to promote high-level readthrough to E7
even though it was preceded by an SV40 leader sequence from the vector.
It therefore appears that the E6 5'UTR is fully capable of promoting
initiation at the E6 AUG and that, if E7 synthesis does indeed depend
on leaky scanning of the E6 AUG, then it depends on features of the E6
start codon other than proximity to the 5' end of the mRNA.
A second set of observations which is inconsistent with a simple leaky-scanning hypothesis concerns the role of upstream AUG codons. If ribosomal scanning complexes manage to miss the E6 AUG, there are still 12 more AUGs to encounter before the E7 AUG. In this study we examined the three of these which have start codons in Kozak contexts that we classified as intermediate or strong. Our data suggest that these cistrons are usually ignored, probably by ribosomes scanning past them. We reached a similar conclusion regarding the two cistrons (MC1 and MC2) located immediately upstream of E7 (69). This suggests that leaky scanning is promoted throughout the length of the region upstream of the E7 AUG. In the closely related HPV-31, there are eight AUG codons upstream of E7, of which three are in strong Kozak contexts and three are in intermediate contexts. These observations suggest that the extreme degree of readthrough permitted by the region upstream of E7 is not simply a function of the immediate sequence context of the upstream AUGs. Apparently neutral uAUGs have been observed previously: an optimal-context AUG codon in the cytomegalovirus pp150 gene 5'UTR has no apparent effect on downstream translation regardless of the intercistronic spacing. The mechanism for bypass in this case has not been determined (3).
Although E7 translation demonstrated a 5' end, cap, and eIF4F dependency, the magnitude of dependency was always lower for E7 than for E6. In some experiments, such as heat shock using pNL67cat, the E7/E6 ratio increased to almost unity. A possible explanation for this comes from examination of the secondary structural model shown in Fig. 9. This model predicted that the first 160 nt of the bicistronic mRNA are relatively unstructured. Previous studies have shown that a long, unstructured region at the 5' end of an mRNA can result in a reduced dependency on cap recognition by eIF4F (10, 36, 74). Most probably, 40S ribosomal subunits cannot attach to a 5' end efficiently when extensive secondary structure is present adjacent to the loading site. In this case the attachment depends on the import of eIF4F-associated helicase activities to unwind the structure. However, when little or no secondary structure is present in proximity to the 5' end, 40S subunits can attach without extensive reliance on eIF4F-associated helicases. It is possible, therefore, that E7 is less reliant on 5'-end binding by eIF4F because its mRNA has, in effect, a long leader sequence that has a relatively low level of secondary structure surrounding the 5' end.
We also noted that secondary structures placed very close to the
E7 AUG (in pE63'2o67) were two- to threefold more
inhibitory than similar structures placed further upstream. Moreover,
when secondary structures were placed upstream of both E6 and E7
cistrons (in p
2o67 and pRV2o67), E6 always
appeared to be more strongly inhibited than E7. This observation could
indicate that a minority of the ribosomes which translate E7 undergo an
internal initiation event, scanning only the region immediately
upstream of E7. In agreement with this, Fig. 6 shows that the IRES trap
vector pGLE6SD produced levels of E7-F-luc protein at levels three- to
fourfold over background. Such a secondary mechanism might have an
enhanced role during the natural life cycle of the virus or when
cap-dependent translation becomes severely restricted. An alternative
explanation may be that ribosomal scanning subunits undergo a
qualitative change as they approach the E7 AUG, which results in an
increased competence to initiate translation coincident with an
increased susceptibility to scanning blocks. This would be consistent
with the inability of scanning subunits to recognize start codons
as they transit the E6 ORF.
In summary, it appears that, with respect to E7 initiation, the E6 region has properties of both a translational inhibitor and a translational enhancer. Translational inhibition, which is a necessary consequence of the requirement to express E6 from the same transcript, is compensated for by an extraordinarily high degree of leaky scanning permitted by the E6 region.
| |
ACKNOWLEDGMENTS |
|---|
We are grateful to A. E. Willis, F. Studier, B. Moss, and H. zur Hausen for gifts of recombinant plasmids and viruses. We also thank A. E. Willis and J. E. G. McCarthy for helpful comments.
This work was supported by the Cancer Research Campaign.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Cancer Research Campaign, Department of Molecular Biology, Paterson Institute for Cancer Research, Christie Hospital, Manchester M20 4BX, United Kingdom. Phone: 44-161-446-3186. Fax: 44-161-446-3109. E-mail: sstacey{at}picr.man.ac.uk.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Baker, C., and C. Calef. 1997. Maps of papillomavirus mRNA transcripts, human papillomaviruses 1997. Los Alamos National Laboratory, Los Alamos, N. Mex. |
| 2. |
Barbosa, M. S., and F. O. Wettstein.
1988.
E2 of cottontail rabbit papillomavirus is a nuclear phosphoprotein translated from an mRNA encoding multiple open reading frames.
J. Virol.
62:3242-3249 |
| 3. | Biegalke, B. J., and A. P. Geballe. 1990. Translational inhibition by cytomegalovirus transcript leaders. Virology 177:657-667[CrossRef][Medline]. |
| 4. | Bohm, S., S. P. Wilczynski, H. Pfister, and T. Iftner. 1993. The predominant mRNA class in HPV16-infected genital neoplasias does not encode the E6 or the E7 protein. Int. J. Cancer 55:791-798[Medline]. |
| 5. | Brown, D. R., L. Pratt, J. T. Bryan, K. H. Fife, and K. Jansen. 1996. Virus-like particles and E1E4 protein expressed from the human papillomavirus type 11 bicistronic E1E4L1 transcript. Virology 222:43-50. |
| 6. |
Cavener, D. R., and S. C. Ray.
1991.
Eukaryotic start and stop translation sites.
Nucleic Acids Res.
19:3185-3192 |
| 7. |
Chiang, C. M.,
T. R. Broker, and L. T. Chow.
1991.
An E1M-E2C fusion protein encoded by human papillomavirus type 11 is a sequence-specific transcription repressor.
J. Virol.
65:3317-3329 |
| 8. |
Chow, L. T.,
M. Nasseri,
S. M. Wolinsky, and T. R. Broker.
1987.
Human papillomavirus types 6 and 11 mRNAs from genital condylomata acuminata.
J. Virol.
61:2581-2588 |
| 9. |
Chow, L. T.,
S. S. Reilly,
T. R. Broker, and L. B. Taichman.
1987.
Identification and mapping of human papillomavirus type 1 RNA transcripts recovered from plantar warts and infected epithelial cell cultures.
J. Virol.
61:1913-1918 |
| 10. |
Dolph, P. J.,
J. T. Huang, and R. J. Schneider.
1990.
Translation by the adenovirus tripartite leader: elements which determine independence from cap-binding protein complex.
J. Virol.
64:2669-2677 |
| 11. |
Dominguez, D. I.,
L. A. Ryabova,
M. M. Pooggin,
W. Schmidt Puchta,
J. Futterer, and T. Hohn.
1998.
Ribosome shunting in cauliflower mosaic virus. Identification of an essential and sufficient structural element.
J. Biol. Chem.
273:3669-3678 |
| 12. | Doorbar, J., A. Parton, K. Hartley, L. Banks, T. Crook, M. Stanley, and L. Crawford. 1990. Detection of novel splicing patterns in a HPV16-containing keratinocyte cell line. Virology 178:254-262[CrossRef][Medline]. |
| 13. |
Falcone, D., and D. W. Andrews.
1991.
Both the 5' untranslated region and the sequences surrounding the start site contribute to efficient initiation of translation in vitro.
Mol. Cell. Biol.
11:2656-2664 |
| 14. | Farmer, A., and G. Myers. 1996. Papillomavirus alignments and structural predictions, papillomaviruses 1996. Los Alamos National Laboratory, Los Alamos, N. Mex. |
| 15. |
Fuerst, T. R.,
E. G. Niles,
F. W. Studier, and B. Moss.
1986.
Eukaryotic transient-expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase.
Proc. Natl. Acad. Sci. USA
83:8122-8126 |
| 16. | Futterer, J., Z. Kiss Laszlo, and T. Hohn. 1993. Nonlinear ribosome migration on cauliflower mosaic virus 35S RNA. Cell 73:789-802[CrossRef][Medline]. |
| 17. | Geballe, A. P. 1996. Translational control mediated by upstream AUG codons, p. 173-197. In J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 18. | Grassmann, K., B. Rapp, H. Maschek, K. U. Petry, and T. Iftner. 1996. Identification of a differentiation-inducible promoter in the E7 open reading frame of human papillomavirus type 16 (HPV-16) in raft cultures of a new cell line containing high copy numbers of episomal HPV-16 DNA. J. Virol. 70:2339-2349[Abstract]. |
| 19. |
Higgins, G. D.,
D. M. Uzelin,
G. E. Phillips,
P. McEvoy,
R. Marin, and C. J. Burrell.
1992.
Transcription patterns of human papillomavirus type 16 in genital intraepithelial neoplasia: evidence for promoter usage within the E7 open reading frame during epithelial differentiation.
J. Gen. Virol.
73:2047-2057 |
| 20. |
Hummel, M.,
J. B. Hudson, and L. A. Laimins.
1992.
Differentiation-induced and constitutive transcription of human papillomavirus type 31b in cell lines containing viral episomes.
J. Virol.
66:6070-6080 |
| 21. | Hummel, M., H. B. Lim, and L. A. Laimins. 1995. Human papillomavirus type 31b late gene expression is regulated through protein kinase C-mediated changes in RNA processing. J. Virol. 69:3381-3388[Abstract]. |
| 22. | Iftner, T., G. Sagner, H. Pfister, and F. O. Wettstein. 1990. The E7 protein of human papillomavirus 8 is a nonphosphorylated protein of 17 kDa and can be generated by two different mechanisms. Virology 179:428-436[CrossRef][Medline]. |
| 23. | Jackson, R. J. 1996. A comparative view of initiation site selection mechanisms, p. 71-112. In J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 24. | Jackson, R. J. 1991. Potassium salts influence the fidelity of mRNA translation initiation in rabbit reticulocyte lysates: unique features of encephalomyocarditis virus RNA translation. Biochim. Biophys. Acta 1088:345-358[Medline]. |
| 25. |
Jaeger, J. A.,
D. H. Turner, and M. Zuker.
1989.
Improved predictions of secondary structures for RNA.
Proc. Natl. Acad. Sci. USA
86:7706-7710 |
| 26. | Kozak, M. 1987. At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. J. Mol. Biol. 196:947-950[CrossRef][Medline]. |
| 27. |
Kozak, M.
1989.
Circumstances and mechanisms of inhibition of translation by secondary structure in eucaryotic mRNAs.
Mol. Cell. Biol.
9:5134-5142 |
| 28. |
Kozak, M.
1987.
Effects of intercistronic length on the efficiency of reinitiation by eucaryotic ribosomes.
Mol. Cell. Biol.
7:3438-3445 |
| 29. | Kozak, M. 1978. How do eukaryotic ribosomes select initiation regions in messenger RNA? Cell 15:1109-1123[CrossRef][Medline]. |
| 30. | Kozak, M. 1986. Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44:283-292[CrossRef][Medline]. |
| 31. | Kozak, M. 1992. Regulation of translation in eukaryotic systems. Annu. Rev. Cell Biol. 8:197-225[CrossRef]. |
| 32. |
Kozak, M.
1989.
The scanning model for translation: an update.
J. Cell Biol.
108:229-241 |
| 33. | Kozak, M. 1991. A short leader sequence impairs the fidelity of initiation by eukaryotic ribosomes. Gene Expr. 1:111-115[Medline]. |
| 34. |
Lamphear, B. J., and R. Panniers.
1991.
Heat shock impairs the interaction of cap-binding protein complex with 5' mRNA cap.
J. Biol. Chem.
266:2789-2794 |
| 35. |
Latorre, P.,
D. Kolakofsky, and J. Curran.
1998.
Sendai virus Y proteins are initiated by a ribosomal shunt.
Mol. Cell. Biol.
18:5021-5031 |
| 36. |
Lawson, T. G.,
B. K. Ray,
J. T. Dodds,
J. A. Grifo,
R. D. Abramson,
W. C. Merrick,
D. F. Betsch,
H. L. Weith, and R. E. Thach.
1986.
Influence of 5' proximal secondary structure on the translational efficiency of eukaryotic mRNAs and on their interaction with initiation factors.
J. Biol. Chem.
261:13979-13989 |
| 37. |
Lingelbach, K., and B. Dobberstein.
1988.
An extended RNA/RNA duplex structure within the coding region of mRNA does not block translational elongation.
Nucleic Acids Res.
16:3405-3414 |
| 38. | Luukkonen, B. G., W. Tan, and S. Schwartz. 1995. Efficiency of reinitiation of translation on human immunodeficiency virus type 1 mRNAs is determined by the length of the upstream open reading frame and by intercistronic distance. J. Virol. 69:4086-4094[Abstract]. |
| 39. | Mathews, M. B. 1996. Interactions between viruses and the cellular machinery for protein synthesis, p. 505-548. In J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 40. | Nasseri, M., R. Hirochika, T. R. Broker, and L. T. Chow. 1987. A human papilloma virus type 11 transcript encoding an E1--E4 protein. Virology 159:433-439[CrossRef][Medline]. |
| 41. | Ozbun, M. A., and C. Meyers. 1997. Characterization of late gene transcripts expressed during vegetative replication of human papillomavirus type 31b. J. Virol. 71:5161-5172[Abstract]. |
| 42. |
Ozbun, M. A., and C. Meyers.
1998.
Temporal usage of multiple promoters during the life cycle of human papillomavirus type 31b.
J. Virol.
72:2715-2722 |
| 43. |
Ozbun, M. A., and C. Meyers.
1999.
Two novel promoters in the upstream regulatory region of human papillomavirus type 31b are negatively regulated by epithelial differentiation.
J. Virol.
73:3505-3510 |
| 44. |
Palermo Dilts, D. A.,
T. R. Broker, and L. T. Chow.
1990.
Human papillomavirus type 1 produces redundant as well as polycistronic mRNAs in plantar warts.
J. Virol.
64:3144-3149 |
| 45. | Panniers, R. 1994. Translational control during heat shock. Biochimie 76:737-747[Medline]. |
| 46. |
Panniers, R.,
A. G. Rowlands, and E. C. Henshaw.
1988.
The effect of Mg2+ and guanine nucleotide exchange factor on the binding of guanine nucleotides to eukaryotic initiation factor 2.
J. Biol. Chem.
263:5519-5525 |
| 47. | Pelletier, J., and N. Sonenberg. 1985. Insertion mutagenesis to increase secondary structure within the 5' noncoding region of a eukaryotic mRNA reduces translational efficiency. Cell 40:515-526[CrossRef][Medline]. |
| 48. | Pim, D., P. Massimi, and L. Banks. 1997. Alternatively spliced HPV-18 E6* protein inhibits E6 mediated degradation of p53 and suppresses transformed cell growth. Oncogene 15:257-264[CrossRef][Medline]. |
| 49. |
Remm, M.,
A. Remm, and M. Ustav.
1999.
Human papillomavirus type 18 E1 protein is translated from polycistronic mRNA by a discontinuous scanning mechanism.
J. Virol.
73:3062-3070 |
| 50. | Reynolds, J. E., A. Kaminski, H. J. Kettinen, K. Grace, B. E. Clarke, A. R. Carroll, D. J. Rowlands, and R. J. Jackson. 1995. Unique features of internal initiation of hepatitis C virus RNA translation. EMBO J. 14:6010-6020[Medline]. |
| 51. |
Roggenbuck, B.,
P. M. Larsen,
S. J. Fey,
D. Bartsch,
L. Gissmann, and E. Schwarz.
1991.
Human papillomavirus type 18 E6*, E6, and E7 protein synthesis in cell-free translation systems and comparison of E6 and E7 in vitro translation products to proteins immunoprecipitated from human epithelial cells.
J. Virol.
65:5068-5072 |
| 52. | Rohlfs, M., S. Winkenbach, S. Meyer, T. Rupp, and M. Durst. 1991. Viral transcription in human keratinocyte cell lines immortalized by human papillomavirus type-16. Virology 183:331-342[CrossRef][Medline]. |
| 53. | Rosenberg, A. H., B. N. Lade, D. S. Chui, S. W. Lin, J. J. Dunn, and F. W. Studier. 1987. Vectors for selective expression of cloned DNAs by T7 RNA polymerase. Gene 56:125-135[CrossRef][Medline]. |
| 54. | Rotenberg, M. O., C. M. Chiang, M. L. Ho, T. R. Broker, and L. T. Chow. 1989. Characterization of cDNAs of spliced HPV-11 E2 mRNA and other HPV mRNAs recovered via retrovirus-mediated gene transfer. Virology 172:468-477[CrossRef][Medline]. |
| 55. | Rotenberg, M. O., L. T. Chow, and T. R. Broker. 1989. Characterization of rare human papillomavirus type 11 mRNAs coding for regulatory and structural proteins, using the polymerase chain reaction. Virology 172:489-497[CrossRef][Medline]. |
| 56. | Scharer Hernandez, N., and T. Hohn. 1998. Nonlinear ribosome migration on cauliflower mosaic virus 35S RNA in transgenic tobacco plants. Virology 242:403-413[CrossRef][Medline]. |
| 57. |
Schmidt Puchta, W.,
D. Dominguez,
D. Lewetag, and T. Hohn.
1997.
Plant ribosome shunting in vitro.
Nucleic Acids Res.
25:2854-2860 |
| 58. | Schneider Gadicke, A., and E. Schwarz. 1986. Different human cervical carcinoma cell lines show similar transcription patterns of human papillomavirus type 18 early genes. EMBO J. 5:2285-2292[Medline]. |
| 59. | Schwartz, S. 1998. cis-Acting negative RNA elements on papillomavirus late mRNAs. Semin. Virol. 8:291-300. |
| 60. |
Sedman, S. A.,
M. S. Barbosa,
W. C. Vass,
N. L. Hubbert,
J. A. Haas,
D. R. Lowy, and J. T. Schiller.
1991.
The full-length E6 protein of human papillomavirus type 16 has transforming and trans-activating activities and cooperates with E7 to immortalize keratinocytes in culture.
J. Virol.
65:4860-4866 |
| 61. | Seedorf, K., G. Krammer, M. Durst, S. Suhai, and W. Rowenkamp. 1985. Human papillomavirus type 16 DNA sequence. Virology 145:181-185[CrossRef][Medline]. |
| 62. | Sherman, L., and N. Alloul. 1992. Human papillomavirus type 16 expresses a variety of alternatively spliced mRNAs putatively encoding the E2 protein. Virology 191:953-959[CrossRef][Medline]. |
| 63. | Sherman, L., N. Alloul, I. Golan, M. Durst, and A. Baram. 1992. Expression and splicing patterns of human papillomavirus type-16 mRNAs in pre-cancerous lesions and carcinomas of the cervix, in human keratinocytes immortalized by HPV 16, and in cell lines established from cervical cancers. Int. J. Cancer 50:356-364[Medline]. |
| 64. |
Slusher, L. B.,
E. C. Gillman,
N. C. Martin, and A. K. Hopper.
1991.
mRNA leader length and initiation codon context determine alternative AUG selection for the yeast gene MOD5.
Proc. Natl. Acad. Sci. USA
88:9789-9793 |
| 65. |
Smotkin, D.,
H. Prokoph, and F. O. Wettstein.
1989.
Oncogenic and nononcogenic human genital papillomaviruses generate the E7 mRNA by different mechanisms.
J. Virol.
63:1441-1447 |
| 66. |
Smotkin, D., and F. O. Wettstein.
1987.
The major human papillomavirus protein in cervical cancers is a cytoplasmic phosphoprotein.
J. Virol.
61:1686-1689 |
| 67. | Stacey, S. N., C. Eklund, D. Jordan, N. K. Smith, P. L. Stern, J. Dillner, and J. R. Arrand. 1994. Scanning the structure and antigenicity of HPV-16 E6 and E7 oncoproteins using antipeptide antibodies. Oncogene 9:635-645[Medline]. |
| 68. | Stacey, S. N., A. Ghosh, J. S. Bartholomew, R. W. Tindle, P. L. Stern, M. Mackett, and J. R. Arrand. 1993. Expression of human papillomavirus type 16 E7 protein by recombinant baculovirus and use for the detection of E7 antibodies in sera from cervical carcinoma patients. J. Med. Virol. 40:14-21[Medline]. |
| 69. | Stacey, S. N., D. Jordan, P. J. Snijders, M. Mackett, J. M. Walboomers, and J. R. Arrand. 1995. Translation of the human papillomavirus type 16 E7 oncoprotein from bicistronic mRNA is independent of splicing events within the E6 open reading frame. J. Virol. 69:7023-7031[Abstract]. |
| 70. | Stern, P. L., and M. A. Stanley. 1994. Human papillomaviruses and cervical cancer. Oxford University Press, Oxford, U.K. |
| 71. | Stoneley, M., F. E. Paulin, J. P. Le Quesne, S. A. Chappell, and A. E. Willis. 1998. c-Myc 5' untranslated region contains an internal ribosome entry segment. Oncogene 16:423-428[CrossRef][Medline]. |
| 72. |
Tan, T. M.,
B. Gloss,
H. U. Bernard, and R. C. Ting.
1994.
Mechanism of translation of the bicistronic mRNA encoding human papillomavirus type 16 E6-E7 genes.
J. Gen. Virol.
75:2663-2670 |
| 73. |
Yueh, A., and R. J. Schneider.
1996.
Selective translation initiation by ribosome jumping in adenovirus-infected and heat-shocked cells.
Genes Dev.
10:1557-1567 |
| 74. |
Zhang, Y.,
P. J. Dolph, and R. J. Schneider.
1989.
Secondary structure analysis of adenovirus tripartite leader.
J. Biol. Chem.
264:10679-10684 |
| 75. |
Zuker, M.
1989.
On finding all suboptimal foldings of an RNA molecule.
Science
244:48-52 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»