INTRODUCTION

Top Abstract Introduction Materials and Methods Results and Discussion References

ETn (early transposon) elements were first described in 1983 as a family of middle repetitive sequences transcribed during early mouse embryogenesis (4). ETn expression peaks between 3.5 and 7.5 days and is found primarily in undifferentiated cells of the inner cell mass and embryonic ectoderm (3). These elements were initially classified as retrotransposon-like because they contain long terminal repeats (LTRs) and retrovirus-like primer binding sites and are flanked by target site duplications (11, 26). However, sequence analysis of full-length copies revealed no long open reading frames (ORFs) and no significant homology to known retroviral genes (26). Although this enigmatic structure might indicate that these elements are old and extensively mutated, this is not the case. Copies cloned at random can be closely related to each other, which suggests a relatively recent dispersion in the genome. Furthermore, it is evident that some ETn elements remain active as retrotransposons. At least eight mouse mutations at different loci are due to ETn insertions (1, 9, 10, 18, 24, 27, 28) and several somatic insertions have also been reported (17, 22, 29). Despite the bona fide mutagenic activity of ETns, very little has been done to investigate their mode of retrotransposition. ETn transcripts are presumably recognized by reverse transcriptase and other proteins encoded by another type of endogenous retrovirus or retrotransposon, but the identity of these putative coding-competent elements is unknown. Interestingly, it was noted several years ago (23) that new ETn insertions into the immunoglobulin (Ig) region in cell lines are members of a subfamily which differ completely from the first randomly isolated elements in the 3' part of the LTR and approximately 300 bp of sequence just internal to the 5' LTRa region which typically contains the retroviral packaging signal (8). It was therefore suggested that this sequence difference allows members of the "active" ETn subfamily to be preferentially packaged and to retrotranspose (23).

Here we report that ETn elements contain a small region of similarity to the 3' end of pol genes from simian type D retroviruses. This finding led us to characterize full-length mouse endogenous retroviral genomes, termed MusD elements, with extensive similarity to the gag, pro, and pol genes of primate type D viruses. Interestingly, another group has recently detected type D mouse endogenous sequences associated with particles budding from a cell line established from a thymic lymphoma (21). Only short regions (~500 bp) of pol sequence were reported in that study, but they are closely related to the sequences identified here, indicating that the elements belong to the MusD family. The LTRs, 5' internal segment, and 3' internal region of these type D sequences are very similar to the analogous regions in the active ETn subfamily. The origin of ETn elements and their ability to retrotranspose are discussed in light of these findings.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results and Discussion References

PCR, library screening, and DNA sequencing. To amplify the 3.4-kb deleted region, a gag primer based on the sequence of mouse EST AA142642 (gag3, aaaggatccgcGGTTGCAAGCAGGCCGTGCC, nucleotides 374 to 395) and a pol primer based on the MusD sequence from the mouse T-cell receptor locus (accession no. AE000665) (pol2, tccccgcgGATCCGCTGCAGCTGCCCT) were used in an Elongase (Life Technologies) PCR with C57BL/6 DNA as template. BamHI and SstII sites were incorporated at the 5' end of each primer (lowercase letters). PCR conditions were as follows: 200 µM concentrations of each deoxynucleoside triphosphate, 200 nM concentrations of each primer, 60 mM Tris-SO₄ (pH 9.1), 18 mM (NH₄)₂SO₄, 2 mM MgSO₄, and 2 µl of Elongase enzyme mix with 100 ng of C57BL/6 DNA in a 50-µl volume; 25 cycles of 30 s at 94°C and 3 min 30 s at 68°C. PCR products of the expected size were obtained and subcloned.

Genomic Southern analysis. Genomic DNA from various mouse strains was obtained from Jackson Laboratories or isolated using standard protocols. Four micrograms of each DNA was digested with EcoRI, electrophoresed overnight in a 0.8% agarose gel, and transferred onto zeta-probe nylon membrane (Bio-Rad) in 20× SSC. For Fig. 7a, a ³²P-labeled 250-bp Eco0109I-PstI fragment from the protease region of MusD1 was used as a probe with hybridization conditions as described previously (14) at a temperature of 65°C. The final posthybridization wash was at 65°C in 0.1× SSC. This probe has no similarity to ETns and was not homologous to any mouse proviral sequence in GenBank. The blot decayed for 6 months before being rehybridized with a ³²P end-labeled oligonucleotide of the sequence 5' ACCTAGCAAGTTAATTAAAGAGCA 3' for Fig. 7b. The hybridization was performed at 50°C (14°C below the T_m) in 5× SSPE (0.9 M NaCl, 50 mM NaH₂PO₄, 5 mM EDTA), 0.5% SDS, 0.1% Ficoll, 0.1% bovine serum albumin, 0.1% polyvinylpyrrolidone, 60 µg of boiled, sheared salmon sperm DNA/ml, and 2 × 10⁶ dpm/ml of probe. The blot was washed twice for 10 min in 5× SSC-0.1% SDS at room temperature and then for 15 min in 3× SSC-0.1% SDS prewarmed to 50°C.

EST database screening. The National Center for Biotechnology Information version of BLAST was used to screen the mouse EST database (on 14 December 1999). Query sequences were the 2,945-bp ETn segment not found in MusD elements and the 4,885-bp sequence of MusD2 not present in ETn elements. The results were examined, and redundant entries due to multiple matches to the same clone were eliminated.

Nucleotide sequence accession numbers. The sequences of MusD1 and MusD2 have been submitted to GenBank with the accession no. AF246632 and AF246633.

	RESULTS AND DISCUSSION

Top Abstract Introduction Materials and Methods Results and Discussion References

ETn elements have a small segment of type D retroviral pol homology. As mentioned above, no similarity to known retroviral genes has been reported for ETn elements. However, by conducting BLAST searches using ETn sequences translated into all possible reading frames, we detected a short but significant region of strong similarity to the 3' end of pol genes from simian type D retroviruses. Figure 1 shows the region of translated ETn sequence compared to Mason-Pfizer monkey virus (MPMV) (25). There is 65% amino acid identity in a 47-amino-acid region which corresponds to the very end of the pol gene. This segment is found in recently inserted ETn elements (Fig. 1) and in randomly isolated elements (e.g., accession no. M16478) (26). No other regions of similarity to retroviral genes were detected in ETn elements using this approach. Interestingly, in the original report describing the ETn sequence, it was mentioned that the closest similarity of the ETn LTR was to the LTR of MPMV (26). The two LTRs were reported to be 67% homologous but a sequence alignment was not shown. It was also reported that ETn and MPMV have the same primer binding site and a similar polypurine tract. Indeed, ETn no. M16478 and MPMV do have an identical 19-bp primer binding site but our computer comparisons detected an overall level of LTR identity of only 40 to 45%. If only portions of the ETn and MPMV LTRs are compared, the highest level of identity we could detect was 63% over a 135-bp region if two large gaps are allowed (data not shown). We are therefore uncertain as to how the figure of 67% was derived. No similarity was detected 3' to the primer binding site.

View larger version (8K): [in this window] [in a new window]   FIG. 1.   Similarity between ETn elements and primate type D retroviruses. The amino acid translation of nucleotides 3618 to 3764 of the ETn element at the tyrosinase locus (10) is compared to the 3' end of the pol protein of MPMV. Identical residues are in bold.

Identification of type D-related mouse provirus-like elements. The discovery of remnants of retroviral type D-related sequences in ETn elements led us to conduct a search of the mouse genomic databases for type D-related sequences. This search revealed a region from the mouse T-cell receptor (TCR) locus (accession no. AE000665, positions 95366 to 99319) containing a retrovirus-like sequence with a largely intact gag gene but a mostly deleted pol gene. This sequence was used to search the mouse EST database, and several matches were found, including an EST from mouse heart (accession no. AA142642, clone ID 604576) that extended ~130 bp into the deleted gag region. Using primers designed to amplify the deleted segment, we conducted PCR on C57BL/6 mouse genomic DNA and obtained a major product of 3.4 kb. One PCR product was cloned and sequenced, and the 3,398-bp clone revealed intact ORFs for the pro and pol genes throughout the extent of the clone. This sequence was compared to the four short pol region sequences published by Ristevski et al. (21). Two of those sequences (AF093700 and AF093701) were over 90% identical to our PCR clone, but one had a termination codon and one had a 24-bp deletion. This comparison was then used to design oligonucleotide probes which were used to screen a C57BL/6 P1 genomic library. Because our PCR product had ORFs but the related published segments had mutations, three oligonucleotides where chosen which matched the sequence of our clone but had mismatches with the published sequences to maximize the chances of isolating full-length functional genomic elements. Twelve positive clones were obtained but several rearranged during growth so only five clones were characterized further.

View larger version (10K): [in this window] [in a new window]   FIG. 2.   Representation of three MusD elements. Thick lines are MusD sequences, and the filled boxes indicate the LTRs. The location of the EST AA142642 is shown as a thin line, and locations of the PCR primers used to amplify the region deleted in AE000665 are shown as small arrows. The gag, pro, and pol genes are represented as ovals, with the ORF-destroying mutations shown as asterisks (for single-nucleotide-length differences or substitutions) and triangles (for the 4- and 14-bp deletions described in the text).

View larger version (26K): [in this window] [in a new window]   FIG. 3.   Dot matrix nucleotide comparison of MusD2 and MPMV. Extents of the MPMV genes are indicated. The stringency of comparison was 15 out of 23.

View larger version (38K): [in this window] [in a new window]   FIG. 4.   (A) DNA sequence of the 5' LTR and 5' internal region of MusD1. The LTR is outlined, and potential TATAA and polyadenylation signals are boxed. The putative Lys-tRNA primer binding site is underlined, and the region forming the stem-loop structure shown in panel B is overlined. The gag initiation codon is shown with a double underline. (B) Potential stem-loop structure with the ACC motif present in the loop.

Protein similarities to MPMV. Amino acid alignments of the gag, pro, and pol genes compared to proteins of the type D retrovirus MPMV are shown in Fig. 5. For the purposes of these comparisons, the ORF-destroying mutations in the MusD1 gag gene and the MusD2 pol gene were "corrected" by comparing them to the other sequences to keep the reading frame intact. Overall, the translated gag gene of MusD1 is 34% identical to MPMV gag (Fig. 5a). The degree of similarity in the 5' part of gag corresponding to MPMV core proteins p10 (matrix), pp24, and p12 is quite limited, but the degree of relatedness increases in the p27 (capsid), p14 (nucleocapsid), and p4 regions. This 3' half of the MusD1 gag gene is 50% identical at the amino acid level to MPMV. One of the most characteristic conserved sequences in retroviral gag genes is the Cys-His zinc finger motif in the nucleocapsid, which has the structure CX₂CX₄HX₄C (5). Type D retroviruses have two such motifs and the MusD1 gag gene has both, as shown in Fig. 5a. Another conserved region in gag genes is the major homology region, a 20-amino-acid stretch in the 3' part of the capsid protein (30). This region is highlighted in Fig. 5a. MusD1 has all of the most conserved residues except for the glycine residue at position 4 within the motif. All three MusD elements shown in Fig. 2 have a serine at that position.

View larger version (58K): [in this window] [in a new window]   FIG. 5.   Amino acid comparisons of MusD to MPMV. (A) Comparison of the translated MusD1 sequence to the MPMV gag products. MPMV p10, pp24, and p12 span residues 1 to 299 and p27, p14, and p4 span residues 300 to 657. The location of the 14-bp insertion added to maintain the MusD1 reading frame is indicated (residues 266 to 270 of MusD1). The major homology region is underlined, and the highly conserved residues are shown with filled circles. The conserved cysteine and histidine residues in the two zinc finger motifs are indicated with a filled triangle. (B) Comparison of the translated MusD2 sequence to the MPMV pro product. The enzymatic active site, the "flap" region, and the GRDLL conserved domains are shown by an arrowed line, a solid line, and a dashed line, respectively. (C) Comparison of the translated MusD2 sequence to the MPMV pol product. The four positions which were corrected based on other MusD sequences to maintain the ORF are indicated with a slanted line through the sequence. The highly conserved residues in the reverse transcriptase, the RNase H, and the integrase domains discussed in the text are indicated by filled circles, asterisks, and triangles, respectively.

ETns and MusD elements share LTRs and 5' and 3' internal segments. Because we had detected a small region of MusD pol sequence within ETn elements, we compared the two types of elements throughout their length. Figure 6 is a dot matrix DNA comparison of MusD2 versus the ETn recently inserted into the tyrosinase locus (10). The two sequences are highly related in the LTRs (5' LTRs are 94% identical) and in the 5' and 3' internal regions. The 5' internal stretch of homology extends to include the first 13 bp of the gag ORF, and the 3' region of homology includes the last 166 bp of the pol gene, which is the region originally detected in our BLAST searches. These 5' and 3' internal regions are 94 to 95% identical between the two element types. No other regions of similarity were detected, even at a reduced stringency of comparison.

View larger version (11K): [in this window] [in a new window]   FIG. 6.   Dot matrix nucleotide comparison of MusD2 and the ETn element at the tyrosinase locus (10). The stringency of comparison was 17 out of 23.

Genomic complexity of MusD and ETn elements. To examine the copy number and distribution of MusD elements in the genome, Southern blot analysis was performed on DNAs from different mouse strains cut with EcoRI. All DNAs were of Mus musculus origin except for one DNA sample from Mus spretus. The probe used was derived from the protease region so it will not detect ETn elements. The results, shown in Fig. 7a, indicate that MusD elements are highly repetitive in the genomes of both M. musculus and M. spretus. The banding pattern is too complex to accurately determine copy number, but we estimate that it is several hundred, given the strength of the hybridization signal. Variations in banding patterns also indicate that these elements are polymorphic between strains but the extent of this polymorphism is masked by the high copy number.

View larger version (120K): [in this window] [in a new window]   FIG. 7.   (A) Genomic Southern analysis of EcoRI-digested DNAs from different mouse strains by using a 250-bp MusD-specific probe (25-h exposure). (B) Rehybridization of the same blot with a 24-mer oligonucleotide probe specific for the type 2 ETn subfamily (10-day exposure).

Possible confusion between ETns and MusD sequences. As mentioned in the Introduction, it was noted in 1990 that ETn elements newly inserted into Ig regions in myeloma cell lines differed in the 3' part of the LTR and the 5' internal region with respect to the original, randomly isolated ETns (23). Thus, two subfamilies of ETn elements were defined, which we will call type 1 (original) and type 2 (Ig insertions). It was previously suggested that type 2 may be more active or mobile in the genome (23). Indeed, since 1990, several ETn insertions have been described and, in all cases for which DNA sequence is available, they appear to be type 2. However, the discovery of MusD elements complicates the matter, since the internal sequence was not determined in most reports of ETn insertions. Figure 8a illustrates how the ETn types differ from each other and from the MusD elements described here. The only two recently inserted ETn elements that have been completely sequenced (10) are 98% identical and serve as the prototype for type 2. As is clear from the figure, it would be difficult to distinguish between ETn type 2 and MusD elements without sufficient DNA sequencing in the interior of the element. Notably, the LTR sequences between the two element types are 94 to 96% identical. It is therefore possible that some of the recently inserted elements described as ETns may actually be MusD sequences. Figure 8b shows the 5' point of divergence between ETns and MusD elements. It is intriguing that this point occurs so close to the gag initiation codon, but the possible relevance of this is unknown.

View larger version (23K): [in this window] [in a new window]   FIG. 8.   (A) Representation of the relationship between MusD elements and ETns. The vertically striped region shows MusD-specific sequences. Diagonally striped boxes show ETn-specific sequences, and white boxes show regions specific to the type 1 ETn subfamily. (B) Nucleotide sequence of the three element types at the start of the gag gene. MusD is the MusD1 sequence, ETn type 2 is the tyrosinase locus element (10), and ETn type 1 is GenBank accession no. M16478 (26).

Expression patterns of ETn and MusD elements. It has been previously shown that transcription of ETn elements peaks between days 3.5 and 7.5 of embryogenesis (3). To compare the expression level of ETns and MusD sequences, we conducted BLAST searches of the mouse EST database by using the entire segments of the elements, which are specific for each. For ETn elements, this segment is ~3 kb (Fig. 8a), and the MusD-specific region is ~4.9 kb. The number of independent EST clones identified, using a cutoff probability value of e¹⁰, was determined and compared. This analysis suggests that ETn elements are expressed at a higher level during embryogenesis. A total of 32 ETn ESTs but only 6 MusD ESTs were found from several independent libraries representing different stages of embryonic development. Nine additional ETn ESTs but no MusD ESTs were identified in libraries from embryonic stem cells or embryonic carcinoma cells. From all tissue sources, a total of 88 ETn ESTs and 23 MusD ESTs were identified. Thus, it appears that the level of ETn transcripts is generally higher.

Summary and conclusions. We have shown that ETns share sequences with the novel family of MusD elements described here. Specifically, the LTRs and the 5' and 3' internal regions are essentially indistinguishable between the MusD elements and the type 2, or active, ETn subfamily. Southern blot analysis has also shown that type 2 ETn elements are younger than MusD sequences. It is therefore probable that ETn elements arose via recombination events resulting in a near total replacement of the MusD gene-coding sequences with sequences of unknown origin. Other recombination events affecting the LTRs and 5' internal region could have generated the type 1 ETn elements. However, more extensive phylogenetic analyses will be needed to determine the evolutionary history and relationships of these different types of sequences.