Previous Article | Next Article 
Journal of Virology, July 2000, p. 6386-6393, Vol. 74, No. 14
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Functional Analysis of the env Open
Reading Frame in Human Endogenous Retrovirus
IDDMK1,222 Encoding Superantigen Activity
Matthias
Lapatschek,1
Susanne
Dürr,1
Roswitha
Löwer,2
Christine
Magin,2
Hermann
Wagner,1 and
Thomas
Miethke1,*
Institute of Medical Microbiology, Immunology
and Hygiene, Technical University of Munich, 81675 Munich,1 and Paul Ehrlich Institute,
63225 Langen,2 Germany
Received 5 January 2000/Accepted 26 April 2000
 |
ABSTRACT |
Mice harbor a family of endogenous retroviruses, the mouse mammary
tumor viruses (MMTV), which encode superantigens. These superantigens
are responsible for the deletion of T cells expressing certain V
chains of the T-cell receptor in the thymus. Human T cells are able to
recognize MMTV-encoded superantigens presented by human major
histocompatibility complex class II-positive cells. Owing to this and
to the similarity of the human and murine immune systems, it was
speculated that human endogenous retroviruses might also code for
superantigens. Recently, it was reported that a proviral clone
(IDDMK1,222) of the human endogenous retrovirus family
HTDV/HERV-K encodes a superantigen. The putative superantigen gene was
located within the env region of the virus. Stimulated by
these findings, we amplified by PCR and cloned into eucaryotic expression vectors open reading frames (ORFs) which were identical or
very similar to IDDMK1,222. When we transfected these
vectors into A20 cells, a murine B-cell lymphoma, we were able to
demonstrate mRNA expression and protein production. However, we did not
find any evidence that the ORF stimulated human or murine T cells in a
V
-specific fashion, the most prominent feature of superantigens.
 |
INTRODUCTION |
Superantigens (Sags) are
characterized as stimulating a large fraction of peripheral T cells
expressing a certain V
chain of the T-cell receptor (TCR)
(21). If they are expressed within the thymus, they induce a
V
-specific deletion of thymocytes (3). To activate T
cells or delete thymocytes, Sags have to be presented by major
histocompatibility complex class II (MHC-II)-positive cells (11,
12). They are produced by gram-positive bacteria, in particular
Staphylococcus aureus and Streptococcus pyogenes (21), as well as by a family of murine endogenous
retroviruses, the mouse mammary tumor viruses (MMTV) (1, 2).
Until now no other retrovirus was shown convincingly to encode a Sag.
Since human T cells are stimulated in a V
-specific pattern by
MMTV-encoded Sags presented by human MHC-II-positive cells
(17), and since the human and murine immune systems are very
similar, it was speculated that human endogenous Sags might also exist.
By analogy to the murine situation, it was envisaged that these
endogenous human Sags are encoded by endogenous retroviral elements
which reside in the human genome. It was suggested repeatedly that the
postulated endogenous human Sags might be responsible for the
initiation of human autoimmune diseases like systemic lupus
erythematosus, multiple sclerosis, or type I diabetes mellitus. Indeed,
in the murine model of experimental autoimmune encephalitis, relapsing paralysis can be triggered by bacterial Sags (7), and, in
humans, expression of an endogenous retrovirus family (MSRV) was shown to be associated with the occurrence of multiple sclerosis
(23). Furthermore, Conrad et al. showed that expression of a
proviral sequence designated IDDMK1,222 of the human
endogenous retrovirus family HTDV/HERV-K was associated with the onset
of type I diabetes mellitus (10). This association, however,
could not be confirmed in other studies (18, 20, 22). Conrad
et al. also demonstrated that IDDMK1,222 encodes a Sag
function and suggested that the Sag might be responsible for the
initiation of type I diabetes mellitus, since the Sag activated
V
7+ T cells in a test system (10). V
7
T-cell expansion was also detected in patients with type I diabetes
mellitus (9).
Intrigued by the hypothesis that a human endogenous Sag might exist, we
cloned the retroviral open reading frame (ORF) described by Conrad et
al. and tested the activity of its product as a Sag. Here we report
experiments to test whether a V
-specific subset of human T cells was
activated by the ORF product presented by murine A20 cells. To
circumvent the problem of allogenic stimulation, which is unavoidable
in a human-based test system, we had previously developed an assay
system consisting of syngeneic murine cells (30), including
the B-cell lymphoma line A20 as an antigen-presenting cell (APC) and T
cells. In this study we also took advantage of this test system to
elucidate whether the endogenous retroviral ORF product represents a
Sag, i.e., stimulates T cells in a V
-specific fashion.
 |
MATERIALS AND METHODS |
Reagents and antibodies.
Anti-Flag monoclonal antibody M2
(MAb) (catalog no. F3165) came from Sigma (Deisenhofen, Germany). The
fluorescein isothiocyanate (FITC)-labeled anti-human V
7 MAb (clone
ZOE) was purchased from Coulter (Hialeah, Fla.). The biotinylated
anti-human CD3 MAb (clone UCHT1), the biotinylated anti-murine V
8.1
and -8.2 MAb (clone MR5-2), the phycoerythrin (PE)-labeled anti-murine
V
10 MAb (clone B21.5), the biotinylated anti-murine V
14 MAb
(clone 14-2), and the FITC-labeled anti-murine CD3
MAb (clone
145-2C11) were bought from Pharmingen (San Diego, Calif.). The
hybridoma KT4, which produces an anti-murine V
4 MAb, was kindly
donated by H. Hengartner (Zürich, Switzerland). The antibody was
purified and biotinylated according to standard protocols.
PE-conjugated streptavidin was purchased from Jackson ImmunoResearch
(West Grove, Pa.), and staphylococcal enterotoxin B (SEB) (BT202) was
from Toxin Technology (Sarasota, Fla.).
Cell culture.
The murine B-cell lymphoma A20 (16)
cell line was cultured in Clicks RPMI medium (Seromed Biochrom, Berlin,
Germany) with 10% fetal calf serum (FCS; BioWhittaker, Verviers,
Belgium), 2 mM glutamine (Seromed Biochrom), 100 U of penicillin and
100 µg of streptomycin (Seromed Biochrom) per ml, 50 µM
2-mercaptoethanol (GIBCO BRL, Paisley, Scotland), and 1 µg of
indomethacine (Sigma) per ml.
Human T cells were isolated from a healthy blood donor's buffy coat by
Ficoll (density, 1.077; Seromed Biochrom) separation followed by
negative selection via a magnetic cell sorting column with the Pan
T-cell isolation kit (Miltenyi Biotec, Auburn, Calif.). The purity of
the T-cell fraction was over 90%, as assessed by CD3-CD14 double
staining and flow cytometry.
Murine lymphocytes were freshly prepared from the mesenteric lymph
nodes of BALB/c mice (Harlan, Borchen, Germany) by teasing
through a
mesh metal sieve. Over 85% of the viable cells were
CD3
+ T
cells.
Plasmids and primers.
pEGFP-N1 was kindly donated by H. Häcker (Munich, Germany), pMMTV2Sag was a gift from W. Günzburg (Vienna, Austria), pCIneo-DMSag was generously provided
by B. Conrad (Geneva, Switzerland), and pRK5 came from Pharmingen.
The putative Sag gene in the plasmid pHKputSag1 was amplified from the
genome of a patient with type I diabetes mellitus using
the primers
HERV-1 (ACCCATCAGAGATGCAAAGAAAAGC) and R300
(CTTTACAAAGCAGTATTGCTGC),
resulting in a PCR product of
approximately 2.2 kb. To obtain
the coding region of the putative Sag
gene, a second PCR was performed
using the primers 5' Sag
(ATCCGCGGATCCCACCATGGTAACACCAGTCACATG)
and 3'Sag
(CTCGAGCTAATCTATAATAGTTCCGAA). The PCR product was cloned
into the mammalian expression vector pRK5. The resulting plasmid,
pHKputSag1, contained only the endogenous retrovirus Sag ORF with
a
Kozak sequence in the vector pRK5. The plasmid pHKputSag1-FLAG
contains
the Flag sequence but is otherwise identical to
pHKputSag1.
Plasmid pHKputSag2 contained the same sequence of the endogenous
retrovirus Sag ORF as pHKputSag1 but was cloned into the
HindIII and
XbaI sites of the vector pRC/CMV
(Invitrogen, Carlsbad,
Calif.) after amplification with
primers IDMM3 (TCCAAGCTTATGGTAACACCAGTCACATGG)
and IDDM4 (ACGTCTAGACTAATCTATAATAGTTCCGAATTC).
pHKputSag3 also
contained the same endogenous Sag ORF but
had a slightly different
sequence (see Fig.
1). This plasmid was
constructed as detailed
in reference
10, relying on
the same primers (IDDM1, GACTAAGCTTAAGAACCCATCAGAGATGC,
and IDDM2, AGACTGGATCCGTTAAGTCGCTATCGACAGC) and
subcloning into
pCIneo (Promega, Madison, Wis.). Primers were purchased
from TIB
Molbiol (Berlin, Germany) and ARK Scientific Biosystems
(Darmstadt,
Germany).
Transfection.
Twenty-four hours after passaging,
107 A20 cells in 400 µl of RPMI medium-10% FCS with 20 µg of plasmid DNA were electroporated in a 0.4-cm cuvette at 960 µF
and 280 V using a gene pulser (Bio-Rad, Hercules, Calif.). Transfection
efficiency was controlled with the pEGFP-N1 vector by flow cytometry
24 h posttransfection.
Detection of mRNA by reverse transcription and PCR.
Transfected cells (5 × 106 A20 cells, 20 µg of
plasmid DNA) were cultured overnight (37°C). After centrifugation
(300 × g for 5 min) the pellet was lysed with 600 µl of
RLT (RNA lysis/thiocyanate) buffer (Qiagen, Hilden, Germany). RNA was
extracted using the RNeasy kit (no. 74103) from Qiagen. The amount of
RNA was quantified photometrically (260 nm). Afterward, any
contaminating DNA was digested with DNase (20 U/2 µg of RNA, 10 min,
37°C; Roche, Mannheim Diagnostics GmbH, Mannheim, Germany), and cDNA
was synthesized using 1 µl of oligo(dT) (10 µM; Gibco Life
Technology Inc., Rockville, Md.), 1 µl of hexamer random primer (10 µM; Gibco), 4 µl of 5× transcription buffer (Gibc), 2 µl of
dithiothreitol (0.1 M; Gibco), 2 µl deoxynucleoside triphosphate (200 µM; Roche), 0.5 µl of Rnasin (Promega), and 1 µl of Superscript
II Plus (Gibco). The reaction mixture was incubated for 60 min at
37°C and subsequently heated to 95°C for 5 min.
Two microliters of the generated cDNA was used for PCR amplification to
detect the transcribed retroviral ORF using the 5'
primer 5'-Sag and
the 3' primer 3'-Sag. The PCR mixture consisted
of 10 µl of
deoxynucleoside triphosphate (1 mM; Roche), 1.5 µl
of each of the
primers 5'-Sag and 3'-Sag (50 µM; TIB Molbiol),
29 µl of
H
2O, 1 µl of
Pfu Turbo (Invitrogen), and 5 µl of 10×
buffer (Invitrogen). The cycle conditions were 94°C and
30 s for
denaturation, 55°C and 60 s for annealing, and
72°C and 120 s
for elongation. The PCR was run for 30 cycles.
The PCR products
were visualized with an ethidium bromide-stained 1%
agarose
gel.
Western blotting.
Transfected cells (5 × 106 A20 cells, 20 µg of plasmid DNA) were cultured
overnight (37°C) and subsequently lysed in NP-40 (1%, vol/vol). Cell
lysates were separated by sodium dodecyl sulfate-12.5% polyacrylamide
gel electrophoresis using Laemmli sample buffer (15.1 g of Tris per
liter, 9.4 g of glycine per liter, 0.5% sodium dodecyl sulfate).
After being transferred onto nitrocellulose by semidry electroblotting
for 2 h (250 mA), the filters were blocked (5% milk powder in
TBST [2.4 g of Tris per liter, 8 g of NaCl per liter, 0.1%
Tween, pH 7.6], 1 h at 37°C and 1 h at room temperature)
and incubated with the anti-Flag MAb M2 (diluted 1:1,000, overnight,
4°C). After three washings with 1× TBST, goat anti-mouse serum
coupled with peroxidase was added (diluted 1:5,000, 1 h, room
temperature; Dianova, Hamburg, Germany). The blot was washed again
three times with 1× TBST and visualized by using the enhanced
chemiluminescence reagent (NEN Life Science Products, Boston, Mass.) as
described by the manufacturer.
Mixed-lymphocyte culture.
Twenty-four hours after
transfection, the A20 cells were arrested in growth by a 1-h incubation
with 80-ng/ml mitomycin C. After three washings they were subsequently
cocultured at a stimulator-responder ratio of 2:1 or 1:1 with human T
cells in RPMI medium containing 5% autologous human serum for a total
culture period of 8 days with 10 U of interleukin-2 (IL-2) per ml added
after 3 days of culture. The BALB/c lymphocytes were cocultured with
the mitomycin-treated A20 cells at a stimulator-responder ratio of 2:1
in RPMI medium-10% FCS with 10 U of IL-2 per ml for 4 to 5 days.
FACS analysis.
After the mixed-lymphocyte culture, viable T
lymphocytes were retrieved from the coculture by gradient
centrifugation with Ficoll at a density of 1.077 for human and 1.090 for murine lymphocytes. The cells were then stained with the
anti-V
-antibodies (diluted 1:100) mentioned above and counterstained
with anti-CD3 (diluted 1:100). In the case of biotinylated antibodies,
a second staining step with streptavidin-PE (diluted 1:100) was added.
The fluorescence-activated cell sorter (FACS) analysis was performed
with a Facscalibur cytometer (Becton Dickinson, Franklin Lakes, N.J.).
Proliferation assay.
The proliferative response of murine T
cells was measured on day 4 or 5 by pulsing microcultures with 37 kBq
of [3H]thymidine (NEN, Zaventem, Belgium) for 8 h.
Thereafter, cultures were harvested on fiberglass filters, and the
amount of [3H]thymidine incorporation was determined by
direct beta counting (Matrix 96; Packard Instrument Co., Meriden,
Conn.).
 |
RESULTS |
Cloning and sequencing of the ORF sequence.
The putative
HTDV/HERV-K Sag was amplified from the genome of peripheral blood
lymphocytes from a patient with type I diabetes mellitus using the
primers listed in Materials and Methods. PCR products of the
appropriate size were obtained from patients as well as healthy blood
donors (data not shown). The PCR products were cloned into the
mammalian expression vector pRK5, resulting in the plasmid pHKputSag1;
into the vector pRC/CMV, resulting in the plasmid pHKputSag2; and into
the vector pCIneo, resulting in the plasmid pHKputSag3. As demonstrated
in Fig. 1, the sequences of the ORFs
encoding the putative Sag are identical or very similar to the one
published by Conrad et al. (10), reflecting the multicopy nature of the endogenous retrovirus family HTDV/HERV-K. The plasmids and a plasmid containing the established Sag gene from MMTV2 were used
to transiently transfect A20 cells for the functional characterization of the ORF. The different vector backbones were used to exclude potential unspecific activation of transfected cells due to
nonphysiological high expression of a foreign protein by potent
eucaryotic promoters. Besides the MMTV2-encoded Sag, the bacterial Sag
SEB, was included as a positive control.

View larger version (80K):
[in this window]
[in a new window]
|
FIG. 1.
Sequence comparison of the IDDMK1,222-borne
ORF and ORFs cloned from different type I diabetes mellitus patients.
Underlined residues indicate point mutations in pHKputSag3.
|
|
Transcription and protein expression of the ORF in A20 cells.
At first we verified that the plasmids were transcribed in the
transfected cells. A plasmid encoding the enhanced green fluorescent protein (EGFP) was used to measure the transfection efficiency of A20
cells. As shown in Fig. 2, around 50% of
all living cells were transfected. Using reverse transcription and PCR,
we showed (Fig. 3) that A20 cells
electroporated with the different plasmids expressed mRNA encoding the
respective ORF products. Since there is no antibody available which
would recognize the product of the ORFs, we inserted a Flag sequence at
the 5' end of the coding sequence, giving rise to the plasmid
pHKputSag1-FLAG (Fig. 1). A protein with the predicted size of 18 kDa
was detected by Western blotting using an anti-Flag MAb only in A20
cells transfected with pHKputSag1-FLAG (Fig.
4).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 2.
Transfection efficiency of A20 cells. A20 cells were
transfected with the EGFP-encoding plasmid pEGFP-N1. After 24 h
the cells were analyzed by FACS for the expression of EGFP. Shadowed
area, cells transfected with an empty vector; solid line,
EGFP-transfected cells.
|
|

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 3.
Transcription of pHKputSag1, pHKputSag1-FLAG, and
pCIneo-DMSag in A20 cells. A20 cells were transfected with pHKputSag1,
pHKputSag1-FLAG, and pCIneo-DMSag (20 µg of DNA/20 × 106 cells). After 24 h RNA was prepared. After reverse
transcription (+RT) and treatment with DNase, ORF cDNA was amplified by
PCR. All three plasmids are transcribed (top panel). The omission of
reverse transcription ( RT) prevents detection by PCR (middle panel),
indicating that the PCR products were not derived from the transfected
plasmid. The glyceraldehyde-3-phosphate-dehydrogenase gene (GAPDH) was
also amplified to show that approximately equal amounts of RNA were
used for reverse transcription and PCR amplification (bottom panel).
The experiment was repeated twice with identical results.
|
|

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 4.
Translation of the Flag ORF in A20 cells. A20 cells were
transfected with the indicated plasmids. After 24 h, cells were
lysed with NP-40 and the cell lysate was analyzed by Western blotting
using MAb M2, which is specific for the Flag epitope. A predicted
18-kDa band is visible in the case of the flagged ORF
(pHKputSag1-FLAG). pCIneo-DMSag and pHKputSag1 served as negative
controls. The experiment was repeated with identical results.
|
|
Test for Sag function using human T cells.
Since the
postulated Sag function was described in humans, we initially
stimulated human T cells with murine A20 cells transfected with the
vectors described above, in a manner similar to a protocol described by
B. Conrad (personal communication). Twenty-four hours after
transfection, A20 cells were arrested in their growth and used to
stimulate purified human T cells (see Materials and Methods). Because
Conrad et al. had reported that human V
7+ T cells were
induced to proliferate (10), this human T-cell subpopulation
was analyzed by FACS 8 days after stimulation of the culture. However,
in comparison to the vector controls (pRK5, pRC/CMV, and pCIneo), we
were unable to observe any increase of the V
7+ T-cell
population, although, as depicted in Fig.
5, we tested a variety of different
ORF-containing plasmids including the construct pCIneo-DMSag, which was
kindly provided by Conrad and which he had used in his studies.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 5.
Human peripheral blood V 7+ T cells do not
expand upon stimulation with different ORF constructs. Purified human
peripheral blood T cells (1.25 × 106 or 2.5 × 106 cells/well) were stimulated with mitomycin C (80 µg/ml)-treated A20 cells (2.5 × 106 cells/well)
transfected with the indicated ORF-bearing constructs. T cells were
cultured for 8 days. IL-2 (10 U/ml) was added for the last 5 days.
After double staining with an FITC-labeled anti-V 7 MAb and
PE-labeled anti-CD3 MAb, the percentage of V 7+ T cells
was measured by FACS. pRK5 is the vector backbone for pHKputSag1 and
pHKputSag1-FLAG; pRC/CMV is the backbone for pHKputSag2; and pCIneo is
the backbone for pHKputSag3 and pCIneo-DMSag. Stim:Resp,
stimulator-responder ratio.
|
|
Test of Sag function using the murine test system.
All
established Sags of bacterial origin have been found to stimulate human
as well as murine T cells. As mentioned earlier, the Sags encoded by
MMTV stimulate human and murine T cells (17). The V
chains of the TCRs involved in the recognition of the different Sags
are conserved between humans and mice (15, 17). At present there is no evidence that a species-specific Sag exists, i.e., a Sag
which is active only in one species. We therefore used our well-defined
murine test system, which circumvents the problem of alloreactivity
encountered in human-based test systems or of xenoreactivity observed
in human- and murine-based test systems. In order to analyze whether
the ORF product of IDDMK1,222 belongs to the Sag family,
syngeneic murine peripheral T cells were stimulated with transfected
A20 cells for 5 days and subsequently analyzed by FACS for a
V
-specific outgrowth of T cells. As already mentioned, the system
was controlled by two established Sags: first, the exogenous bacterial
Sag, SEB, which stimulates all murine V
8+ T cells
(21), and second and more important, the Sag ORF product of
MMTV2, which stimulates all murine V
14+ T cells (3,
14). The positive control plasmid bearing the ORF of MMTV2 was
used in exactly the same way as all the plasmids bearing ORFs of human
endogenous retroviruses. A typical result of the T-cell stimulation
assay is demonstrated in Fig. 6. As was
expected, SEB expanded all V
8+ T cells, which resulted
in a relative reduction of the other three tested T-cell subsets,
consisting of V
4-, -10-, and -14-positive T cells. The MMTV2-encoded
Sag stimulated all V
14+ cells; again, the relative
numbers of the other T-cell subsets were reduced. In contrast, none of
the constructs encoding the putative endogenous human Sag changed the
V
repertoire of peripheral T cells (Fig. 4), as determined by
comparison with peripheral T cells which were stimulated by A20 cells
transfected with the noncoding parental plasmids pRK5, pRC/CMV, and
pCIneo. Notably, the Sag-encoding construct kindly provided by B. Conrad also did not stimulate T cells in a V
-specific manner.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 6.
Murine peripheral T cells are not stimulated
V -specifically by different ORF constructs. A20 cells were
transfected with the indicated plasmids (20 µg of DNA/107
cells). After 24 h the cells were treated with mitomycin C (80 µg/ml) and used as APCs at a density of 5 × 106
cells/well. Murine peripheral lymph node cells were added (2.5 × 106 cells/well) and after 5 days of culture in the presence
of 10 U of IL-2 per ml, the cells were harvested. After double staining
with an MAb specific for the V 4, V 8, V 10, or V 14 chains of
the TCR and with an MAb specific for CD3 protein, the individual
T-cell subpopulations were quantified by FACS ( , V 4+;
, V 8+; , V 10+; ,
V 14+ T cells). Each bar represents the mean of at least
five independent experiments; error bars indicate standard errors. pRK5
is the vector backbone for pHKputSag1 and pHKputSag1-FLAG; pRC/CMV is
the backbone for pHKputSag2; and pCIneo is the backbone for pHKputSag3
and pCIneo-DMSag.
|
|
Since in this approach, we analyzed the expansion of a substantial
portion of but not the entire V

repertoire, we might have
missed the
responding subset of T cells. Therefore, we also measured
the induced
proliferation of the peripheral T cells as a parameter
for Sag
response. As depicted in Fig.
7, only the
control Sags,
SEB and the ORF product encoded by MMTV2, stimulated T
cells to
proliferate above background levels (levels reached with the
expression
vectors lacking a coding sequence, pRK5, pRC/CMV, and
pCIneo).
None of the plasmids encoding the putative endogenous
retrovirus
Sag, including the plasmid supplied by Conrad, induced
proliferation
of the T cells. In addition, a more extensive analysis of
the
V

repertoire, including the V

4, -6, -7, -8, -9, -10, -13, and
-14 T-cell subsets, also failed to show a V

-specific expansion
of T
cells (data not shown).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 7.
Proliferation of murine T cells stimulated by different
ORF-bearing plasmids. The experiment was performed as described for
Fig. 6. After a culture period of 4 days, the cells were pulsed for
8 h with [3H]thymidine (37 kBq) and the amount of
incorporation of [3H]thymidine was determined. Each bar
represents the mean of quadruplicates; error bars indicate standard
errors. The experiment was repeated twice with comparable results.
|
|
MHC-II expression is not changed by the ORF.
In order to
activate T cells, bacterial as well as retroviral Sags need to be
presented by MHC-II-expressing APCs (1, 21). To exclude the
possibility that, during transfection or due to the expression of the
ORF itself, MHC-II molecules are modulated from the surface of A20
cells, the expression of MHC-II molecules 24 h after transfection
was analyzed. Figure 8 and Table
1 show that the expression level of
MHC-II molecules is not influenced by the ORF.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 8.
Expression of MHC-II molecules on A20 cells is not
influenced by the ORF. Transfected A20 cells were analyzed for the
expression of MHC-II molecules 24 h after electroporation. Cells
were stained with an FITC-labeled anti-MHC-II antibody and the
expression level of MHC-II was recorded with the cytometer. Solid
lines, isotype controls; shadowed areas, expression of MHC-II. Four
representative histograms are shown; the other transfected cells
expressed MHC-II at the same level (Table 1).
|
|
 |
DISCUSSION |
It is well known that many retroviral sequences are inherent to
the human genome, including the B/D-type retrovirus-related family
HTDV/HERV-K, which consists of approximately 50 proviruses with
full-length genomes (28). Although all proviruses sequenced so far are defective and noninfectious, retroviral proteins like reverse transcriptase and proteins of the env and
gag regions are expressed in germ cell tumors (5, 13,
24, 26, 27, 29). Furthermore, the expression of HTDV/HERV-K
proviruses in germ cell tumor cell lines leads to the formation of
retrovirus particles (6, 19). The existence of these
retroviral products, in particular the possibility that such proteins
might possess a Sag function, has stimulated the idea that they might
be involved in triggering autoimmunity in humans.
A recent paper stated that a novel sequence of the human endogenous
retrovirus family HTDV/HERV-K was associated with the onset of type I
diabetes mellitus and that this sequence encoded a Sag which activated
human V
7+ T cells (10). Stimulated by this
hypothesis, we tried to repeat these interesting findings. Although we
and others could not confirm that the development of type 1 diabetes
depends on the specific expression of HTDV/HERV-K proviruses (18,
20, 22), in that study we could not exclude the possibility that
the expressed sequences harbor a Sag function (20). In the
present study we have cloned into eucaryotic expression vectors
sequences identical or very similar to the sequence published by Conrad
et al. Together with an IDDMK1,222 expression clone kindly
provided by Conrad, we tested these plasmids in several systems that
would reveal a Sag function. None of the test systems indicated the
existence of a Sag function in the HERV-K sequences, although the
MMTV2-derived sequence exerted a Sag function similar to that of the
bacterial Sag.
Several issues should be considered to ensure that the negative results
obtained were not caused by the experimental design. First, did we use
the wrong species for the evaluation of the ORF as a Sag? Until now,
all established Sags have stimulated T cells of different species,
i.e., Sags are not species specific (17, 21). In order to
avoid the stimulation of responder T cells by alloantigen (since the
frequency of V segments of the TCR in peripheral blood lymphocytes
seems to be influenced by HLA genes) (4), we chose to use a
murine test system instead of the human test system used by Conrad et
al. The system used here responded rapidly to the MMTV2-encoded Sag as
well as to the bacterial Sag SEB (Fig. 6). Although one could expect to
observe an expansion of murine T-cell subsets expressing the V
4 or
V
10 chain of the TCR because these chains are closely related to the human V
7 chain (8), we were unable to detect such an
expansion with the IDDMK1,222 expression plasmid or with
any related plasmid. To minimize the chance that the
IDDMK1,222-borne ORF is the first species-specific Sag, we
used a xenogeneic system consisting of human T cells and murine A20
cells as APCs. As shown by Subramanyam et al., Sags can be presented by
xenogeneic APCs (25).
In addition, when Conrad sent us the pCIneo-DMSag expression plasmid
for testing, he recommended A20 cells as the most convenient APCs and
human T cells as the responder cell system, as described in this
article. However, we were unable to detect any Sag function of the
IDDMK1,222-borne ORF with any of the systems tested.
Second, the APC used here was the transiently transfected B-cell line
A20, whereas Conrad et al. utilized the transiently transfected
monocytic cell line THP1 (10). They also used the stably
transfected B-lymphoblastoid cell line Raji as the APC. Comparing both
APCs revealed that the V
7-specific expansion of human peripheral T
cells induced by the Raji cell line was weaker than that induced by
THP1 cells (10). Unfortunately, we did not receive the
stable transfectants. In addition, we were unable to achieve a
satisfactory transfection efficiency with the THP1 cell line, although
we tested several reagents recommended by manufacturers (data not
shown). The use of the B-cell line A20 as the APC might yield
false-negative results if the expression of the transgene failed and if
the cell line was not able to present a Sag. However, importantly, A20
cells can present the MMTV2-encoded Sag with the induction of a
V
14-specific expansion of T cells (Fig. 6). Furthermore, we were
able to confirm that the putative Sags were indeed expressed in A20
cells, since mRNAs of the ORFs were transcribed (Fig. 3) and protein
was produced (Fig. 4).
Third, the amount or the type of MHC-II molecules may be inadequate to
present the putative Sag. THP1 cells had to be stimulated with gamma
interferon to allow the upregulation of MHC-II molecules and
presentation of the putative Sag (10). In contrast, the A20
cell line used in this study as APC did express high levels of MHC-II
molecules and this did not change upon the transfection of different
ORF constructs (Fig. 8; Table 1). The presentation of Sags is not MHC
restricted. However, a hierarchy exists in that human HLA-DR class II
isotypes present Sags much better than HLA-DQ and HLA-DP isotypes
(21). The same is true for their murine counterparts, since
H2-IE is superior to H2-IA (2, 21). Since the A20 cell line
is derived from BALB/c mice, the MHC-II isotypes H2-IE and H2-IA are
expressed. Therefore, this cell line should be able to present Sags
successfully to T cells, and this is shown here for SEB and the
MMTV2-encoded Sag.
Fourth, could we have missed the murine T-cell subset, which was
activated by the ORF, since we did not analyze the complete V
repertoire? In that case, one should expect a relative reduction in the
T-cell subsets tested. As shown in Fig. 6, we observed a relative
reduction of the T-cell subsets V
4, V
10, and V
14 in response
to the expansion of V
8 by SEB and a relative reduction of
V
4, V
8, and V
10 in response to the expansion of V
14 by the
MMTV2-encoded Sag. In addition, we were unable to induce a substantial
proliferation of murine T cells upon stimulation by the putative
endogenous retroviral Sag (Fig. 7), which also indicated that no
undefined T-cell subset had expanded. In contrast, SEB- and
pMMTV2Sag-transfected cells induced a significant proliferation of the
murine responder T cells. To rule out that the endogenous retrovirus
Sag might be the first species-specific Sag, we stimulated human
T cells and again obtained no evidence that these ORF products activated a V
-specific T-cell repertoire (Fig. 5). Surprisingly, the
plasmid pCIneo-DMSag also showed no evidence of Sag activity.
Fifth, did the Flag in the pHKputSag1-FLAG construct impede Sag
activity of the IDDMK1,222-borne ORF? We used a flagged ORF to demonstrate translation of the ORF in A20 cells (Fig. 4). Since we
were worried that the Flag influences the function of the protein, we
added the Flag to either the 5' or 3' end of the ORF. Both constructs
as well as the unflagged ORF were negative in the T-cell stimulation
assay (Fig. 5 and 6; also data not shown). However, in A20 cells
transfected with the construct containing the Flag sequence at the 3'
end of the ORF, we were unable to detect the formation of mRNA in a
nonnested PCR approach, indicating that this construct was less
efficiently transcribed than that with the 5' Flag (data not shown).
One could argue that the 5'-flagged protein lost its Sag activity due
to the Flag and that the normal ORF gave rise to an unstable message.
However, we demonstrated that ORF mRNA levels were similar in A20 cells
transfected with pHKputSag1-FLAG, pHKputSag1, or pCIneo-DMSag (Fig. 3).
Since we tested the flagged ORF together with four different unflagged ORF constructs in three different vectors and failed to detect Sag
activity, we are convinced that the Flag is not responsible for our failure.
In summary we can only conclude from our data that the ORF located in
the env region of IDDMK1,222 does not belong to
the family of Sags.
 |
ACKNOWLEDGMENTS |
This work was supported by the Bundesministerium für
Bildung und Forschung grant 01 GB9403.
We thank Walter Günzburg and Hans Häcker for donating MMTV2
Sag- and EGFP-expressing plasmids, respectively. We also thank Bernard
Conrad for providing the plasmid pCIneo-DMSag.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institute of
Medical Microbiology, Immunology and Hygiene, Technical University of Munich, Trogerstr. 9, 81675 Munich, Germany. Phone: 49/89/4140-4187. Fax: 49/89/4140-4868. E-mail:
Thomas.Miethke{at}lrz.tu-muenchen.de.
 |
REFERENCES |
| 1.
|
Acha-Orbea, H.
1992.
Retroviral superantigens.
Chem. Immunol.
55:65-86[Medline].
|
| 2.
|
Acha-Orbea, H., and E. Palmer.
1991.
Mls a retrovirus exploits the immune system.
Immunol. Today
12:356-361[CrossRef][Medline].
|
| 3.
|
Acha-Orbea, H.,
A. N. Shakov,
L. Scarpellino,
E. Kolb,
V. Müller,
A. Vessaz-Shaw,
R. Fuchs,
K. Blöchlinger,
P. Rollini,
J. Billotte,
M. Sarafidou,
H. R. MacDonald, and H. Diggelmann.
1991.
Clonal deletion of V 14-bearing T cells in mice transgenic for mammary tumour virus.
Nature
350:207-211[CrossRef][Medline].
|
| 4.
|
Akolkar, P. N.,
B. Gulwani-Akolkar,
R. Pergolizzi,
R. D. Bigler, and J. Silver.
1993.
Influence of HLA genes on T cell receptor V segment frequencies and expression levels in peripheral blood lymphocytes.
J. Immunol.
150:2761-2773[Abstract].
|
| 5.
|
Boller, K.,
O. Janssen,
H. Schuldes,
R. R. Tönjes, and R. Kurth.
1997.
Characterization of the antibody response specific for the human endogenous retrovirus HTDV/HERV-K.
J. Virol.
71:4581-4588[Abstract].
|
| 6.
|
Boller, K.,
H. Konig,
M. Sauter,
N. Mueller Lantzsch,
R. Lower,
J. Lower, and R. Kurth.
1993.
Evidence that HERV-K is the endogenous retrovirus sequence that codes for the human teratocarcinoma-derived retrovirus HTDV.
Virology
196:349-353[CrossRef][Medline].
|
| 7.
|
Brocke, S.,
A. Gaur,
C. Piercy,
A. Gautam,
K. Gijbels,
C. G. Fathman, and L. Steinman.
1993.
Induction of relapsing paralysis in experimental autoimmune encephalomyelitis by bacterial superantigen.
Nature
365:642-644[CrossRef][Medline].
|
| 8.
|
Clark, S. P.,
B. Arden,
D. Kabelitz, and T. W. Mak.
1995.
Comparison of human and mouse T-cell receptor variable gene segment subfamilies.
Immunogenetics
42:531-540[Medline].
|
| 9.
|
Conrad, B.,
E. Weidmann,
G. Trucco,
W. A. Rudert,
R. Behboo,
C. Ricordi,
H. Rodriquez-Rilo,
D. Finegold, and M. Trucco.
1994.
Evidence for superantigen involvement in insulin-dependent diabetes mellitus aetiology.
Nature
371:351-355[CrossRef][Medline].
|
| 10.
|
Conrad, B.,
R. N. Weissmahr,
J. Boni,
R. Arcari,
J. Schupbach, and B. Mach.
1997.
A human endogenous retroviral superantigen as candidate autoimmune gene in type I diabetes.
Cell
90:303-313[CrossRef][Medline].
|
| 11.
|
Dellabona, P.,
J. Peccoud,
J. Kappler,
P. Marrack,
C. Benoist, and D. Mathis.
1990.
Superantigens interact with MHC class II molecules outside of the antigen groove.
Cell
62:1115-1121[CrossRef][Medline].
|
| 12.
|
Fraser, J. D.
1989.
High-affinity binding of staphylococcal enterotoxins A and B to HLA-DR.
Nature
339:221-223[CrossRef][Medline].
|
| 13.
|
Gotzinger, N.,
M. Sauter,
K. Roemer, and N. Mueller-Lantzsch.
1996.
Regulation of human endogenous retrovirus-K Gag expression in teratocarcinoma cell lines and human tumours.
J. Gen. Virol.
77:2983-2990[Abstract/Free Full Text].
|
| 14.
|
Gunzburg, W. H.,
F. Heinemann,
S. Wintersperger,
T. Miethke,
H. Wagner,
V. Erfle, and B. Salmons.
1993.
Endogenous superantigen expression controlled by a novel promoter in the MMTV long terminal repeat.
Nature
364:154-158[CrossRef][Medline].
|
| 15.
|
Herman, A.,
J. W. Kappler,
P. Marrack, and A. M. Pullen.
1991.
Superantigens: mechanism of T-cell stimulation and role in immune responses.
Annu. Rev. Immunol.
9:745-772[Medline].
|
| 16.
|
Kim, K. J.,
C. Kanellopoulos-Langevin,
R. M. Merwin,
D. H. Sachs, and R. Asofsky.
1979.
Establishment and characterization of BALB/c lymphoma lines with B cell properties.
J. Immunol.
122:549-554[Abstract/Free Full Text].
|
| 17.
|
Labrecque, N.,
H. McGrath,
M. Subramanyam,
B. T. Huber, and R. P. Sekaly.
1993.
Human T cells respond to mouse mammary tumor virus-encoded superantigen: V beta restriction and conserved evolutionary features.
J. Exp. Med.
177:1735-1743[Abstract/Free Full Text].
|
| 18.
|
Lan, M. S.,
A. Mason,
R. Coutant,
Q. Y. Chen,
A. Vargas,
J. Rao,
R. Gomez,
S. Chalew,
R. Garry, and N. K. Maclaren.
1998.
HERV-K10s and immune-mediated (type 1) diabetes.
Cell
95:14-16[CrossRef][Medline].
|
| 19.
|
Lower, R.,
K. Boller,
B. Hasenmaier,
C. Korbmacher,
N. Muller-Lantzsch,
J. Lower, and R. Kurth.
1993.
Identification of human endogenous retroviruses with complex mRNA expression and particle formation.
Proc. Natl. Acad. Sci. USA
90:4480-4484[Abstract/Free Full Text].
|
| 20.
|
Lower, R.,
R. R. Tonjes,
K. Boller,
J. Denner,
B. Kaiser,
R. C. Phelps,
J. Lower,
R. Kurth,
K. Badenhoop,
H. Donner,
K. H. Usadel,
T. Miethke,
M. Lapatschek, and H. Wagner.
1998.
Development of insulin-dependent diabetes mellitus does not depend on specific expression of the human endogenous retrovirus HERV-K.
Cell
95:11-14[CrossRef][Medline].
|
| 21.
|
Marrack, P., and J. Kappler.
1990.
The staphylococcal enterotoxins and their relatives.
Science
248:705-711[Abstract/Free Full Text].
|
| 22.
|
Murphy, V. J.,
L. C. Harrison,
W. A. Rudert,
P. Luppi,
M. Trucco,
A. Fierabracci,
P. A. Biro, and G. F. Bottazzo.
1998.
Retroviral superantigens and type 1 diabetes mellitus.
Cell
95:9-11[CrossRef][Medline].
|
| 23.
|
Perron, H.,
J. A. Garson,
F. Bedin,
F. Beseme,
G. Paranhos-Baccala,
F. Komurian-Pradel,
F. Mallet,
P. W. Tuke,
C. Voisset,
J. L. Blond,
B. Lalande,
J. M. Seigneurin,
B. Mandrand, and The Collaborative Research Group on Multiple Sclerosis.
1997.
Molecular identification of a novel retrovirus repeatedly isolated from patients with multiple sclerosis.
Proc. Natl. Acad. Sci. USA
94:7583-7588[Abstract/Free Full Text].
|
| 24.
|
Schommer, S.,
M. Sauter,
H. G. Krausslich,
B. Best, and N. Mueller-Lantzsch.
1996.
Characterization of the human endogenous retrovirus K proteinase.
J. Gen. Virol.
77:375-379[Abstract/Free Full Text].
|
| 25.
|
Subramanyam, M.,
B. McLellan,
N. Labrecque,
R. P. Sekaly, and B. T. Huber.
1993.
Presentation of the Mls-1 superantigen by human HLA class II molecules to murine T cells.
J. Immunol.
151:2538-2545[Abstract].
|
| 26.
|
Tonjes, R. R.,
K. Boller,
C. Limbach,
R. Lugert, and R. Kurth.
1997.
Characterization of human endogenous retrovirus type K virus-like particles generated from recombinant baculoviruses.
Virology
233:280-291[CrossRef][Medline].
|
| 27.
|
Tönjes, R. R.,
C. Limbach,
R. Löwer, and R. Kurth.
1997.
Expression of human endogenous retrovirus type K envelope glycoprotein in insect and mammalian cells.
J. Virol.
71:2747-2756[Abstract].
|
| 28.
|
Tonjes, R. R.,
R. Lower,
K. Boller,
J. Denner,
B. Hasenmaier,
H. Kirsch,
H. Konig,
C. Korbmacher,
C. Limbach,
R. Lugert,
R. C. Phelps,
J. Scherer,
K. Thelen,
J. Lower, and R. Kurth.
1996.
HERV-K: the biologically most active human endogenous retrovirus family.
J. Acquir. Immune Defic. Syndr. Hum. Retrovirol.
13(Suppl. 1):S261-S267.
|
| 29.
|
Vogetseder, W.,
A. Dumfahrt,
P. Mayersbach,
D. Schonitzer, and M. P. Dierich.
1993.
Antibodies in human sera recognizing a recombinant outer membrane protein encoded by the envelope gene of the human endogenous retrovirus K.
AIDS Res. Hum. Retrov.
9:687-694[Medline].
|
| 30.
|
Wintersperger, S.,
S. Indraccolo,
T. Miethke,
W. H. Gunzburg, and B. Salmons.
1994.
A transient assay for gene expression studies in B lymphocytes and its use for superantigen assays.
BioTechniques
16:882-886[Medline].
|
Journal of Virology, July 2000, p. 6386-6393, Vol. 74, No. 14
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Voisset, C., Weiss, R. A., Griffiths, D. J.
(2008). Human RNA "Rumor" Viruses: the Search for Novel Human Retroviruses in Chronic Disease. Microbiol. Mol. Biol. Rev.
72: 157-196
[Abstract]
[Full Text]
-
Tai, A. K., Lin, M., Chang, F., Chen, G., Hsiao, F., Sutkowski, N., Huber, B. T.
(2006). Murine Vbeta3+ and Vbeta7+ T Cell Subsets Are Specific Targets for the HERV-K18 Env Superantigen.. J. Immunol.
177: 3178-3184
[Abstract]
[Full Text]
-
Wang-Johanning, F., Frost, A. R., Johanning, G. L., Khazaeli, M. B., LoBuglio, A. F., Shaw, D. R., Strong, T. V.
(2001). Expression of Human Endogenous Retrovirus K Envelope Transcripts in Human Breast Cancer. Clin. Cancer Res.
7: 1553-1560
[Abstract]
[Full Text]