This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhu, Q.
Right arrow Articles by Dudley, J. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhu, Q.
Right arrow Articles by Dudley, J. P.

 Previous Article  |  Next Article 

Journal of Virology, July 2000, p. 6348-6357, Vol. 74, No. 14
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.

CDP Is a Repressor of Mouse Mammary Tumor Virus Expression in the Mammary Gland

Quan Zhu, Keqin Gregg, Mary Lozano, Jinqi Liu, and Jaquelin P. Dudley*

Section of Molecular Genetics and Microbiology and Institute for Cellular and Molecular Biology, The University of Texas at Austin, Austin, Texas 78705

Received 7 January 2000/Accepted 19 April 2000


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Mouse mammary tumor virus (MMTV) transcription is highest in the lactating mammary gland but is detectable in a variety of other tissues. Previous results have shown that MMTV expression is suppressed in lymphoid and other tissues through the binding of the homeodomain-containing repressor special AT-rich binding protein 1 to a negative regulatory element (NRE) in the MMTV long terminal repeat (LTR). Another homeoprotein repressor, CCAAT displacement protein (CDP), also binds to the MMTV NRE, but a role for CDP in MMTV transcriptional suppression has not yet been demonstrated. In this paper, we show that the level of CDP decreases during development of the mammary gland and that this decline in CDP level correlates with the known increase in MMTV expression observed during mammary gland differentiation. Moreover, CDP overexpression was able to suppress MMTV LTR-reporter gene activity up to 20-fold in transient-transfection assays of mouse mammary cells. To determine if this effect was due to direct binding of CDP to the promoter-proximal NRE, we performed DNase I protection assays to map two CDP-binding sites from +835 to +845 and +920 to +931 relative to the first base of the LTR. Mutations engineered into each of these sites decreased CDP binding to the proximal NRE, whereas a combination of these mutations further reduced binding. Subsequently, each of these mutations was introduced into the full-length MMTV LTR upstream of the luciferase reporter gene. Analysis of stable transfectants of LTR constructs showed that CDP binding site mutations in the proximal NRE elevated reporter gene expression two- to sixfold compared to wild-type LTR constructs. Thus, MMTV expression increases during mammary gland development, in part due to decreased CDP levels and CDP binding to the LTR. Together, these experiments provide the first evidence that CDP acts as a repressor of MMTV transcription in the mammary gland.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Mouse mammary tumor virus (MMTV) is a type B retrovirus that primarily induces mammary carcinomas and, at a lower frequency, T-cell lymphomas in mice (20, 33). Current data suggest that MMTV induces mammary tumors by the insertional activation of nearby cellular oncogenes (18, 50, 62). The disease specificity of MMTV appears to be linked directly to high viral expression in specific tissues (68). Milk-borne MMTV is expressed primarily in the lactating mammary gland (55). The high level of viral transcription increases MMTV insertions, leading to cell transformation in mammary tissue. A mutant form of MMTV (type B leukemogenic virus) that induces T-cell lymphomas shows high-level expression in T cells (4, 5, 17). Previous work showed that the tissue-specific expression of the MMTV genome is governed by regulatory elements located in the long terminal repeat (LTR). These known elements include a hormone response element (HRE), several negative regulatory elements (NREs), a mammary gland enhancer, and NF-1, Oct-1, and TFIID binding sites (13, 14, 46-48, 52, 59).

Virtually all MMTV proviruses acquired in mouse T-cell lymphomas contain LTR deletions or rearrangements encompassing a 491-bp region (-655 to -165; +541 to +1031 relative to the first base of the C3H LTR) (5, 33, 36, 45). These deletions and rearrangements result in higher levels of MMTV expression in T cells compared to endogenous wild-type MMTVs (13, 33). Transient and stable transfection experiments showed that this region contains negative regulatory elements (NREs) (13, 33). Removal of NREs relieved the suppression of MMTV transcription in normally semipermissive or nonpermissive tissues. Transgenic mouse experiments with p1BCAT, a naturally occurring LTR deletion (-655 to -165) mutant linked to the gene for chloramphenicol acetyltransferase, revealed that this LTR deletion mutation allows high-level viral expression in semipermissive tissues (e.g., thymus) and lower expression in tissues that are normally nonpermissive (brain, heart, and skeletal muscle) (55). Transient-transfection assays with sequential LTR deletion mutants have defined two NREs, promoter distal and promoter proximal (see Fig. 1) (13). Gel shift assays with these NREs detected binding of two major protein complexes identified as CCAAT displacement protein (CDP) and special AT-rich binding protein 1 (SATB1) (13, 41). A substitution mutation (924) in the proximal NRE (pNRE) that decreased SATB1 binding increased basal expression ca. 2.5-fold compared with the wild-type promoter in transient-transfection assays with LTR-reporter genes. The 924 mutant LTR showed a more dramatic elevation of reporter gene expression compared to wild-type LTR expression in the lymphoid tissues of transgenic mice (41). These data indicated that SATB1 functions as a suppressor of MMTV expression. However, the role of CDP in MMTV transcriptional control is unknown.

CDP (also known as Clox or Cux) is a homologue of the Drosophila protein Cut (2, 10, 61), which functions as a cell fate-determining factor during development (49). Elimination of Cut activity transforms external sensory organs into internal chordotonal organs (12), and ubiquitous Cut expression causes transformation of chordotonal organs into external sensory organs (11). When overexpressed in tissue culture cells, CDP was capable of repressing target gene expression (43). Moreover, CDP-like binding activity was strongly induced in committed, differentiating B cells, keratinocytes, myeloid cells, chondroblasts, and myoblasts but was down-regulated in the corresponding differentiated cell types (1, 2, 57, 64). These results suggest that CDP acts as a general repressor of genes that are expressed in differentiated cells (8).

CDP is a transcription factor that contains three DNA-binding domains, termed Cut repeats (CR), in addition to the homeodomain (2, 10, 49). Female mice engineered with a specific knockout of the CDP CR1 domain expressed a truncated CDP protein. These mice could produce normal offspring but had a high level of pup loss, suggesting that there was a specific defect in milk composition (60). Such results imply that CDP participates in cellular gene expression in the mammary gland. MMTV expression is suppressed in undeveloped mammary tissue but is activated in the lactating mammary gland (34). CDP also binds to the MMTV transcriptional control region (40, 41). Therefore, it is possible that CDP functions as a repressor to suppress MMTV expression in undeveloped breast tissue, and viral suppression is relieved when mammary cells are fully differentiated.

Here we examined the role of the CDP homeoprotein in the control of MMTV expression. We have shown that the levels of full-length CDP decline during mammary gland differentiation, a period when MMTV transcription increases (25, 55). DNase I mapping experiments using the MMTV pNRE revealed the presence of two CDP binding sites. Mutations in either of these sites reduced CDP binding to pNRE probes, and reporter gene constructs carrying these mutations elevated MMTV expression in transient- and stable-transfection assays. Our data provide the first evidence that the homeoprotein CDP acts as a transcriptional repressor in the mammary gland.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Cell culture and transfections. HC11 normal mouse mammary cells (6) from BALB/c mice were obtained from Jeff Rosen (Baylor College of Medicine, Houston, Tex.). Cells were grown in RPMI medium (GIBCO BRL, Gaithersburg, Md.) containing 10% fetal bovine serum (FBS; Hyclone, Logan, Utah), insulin (Sigma Chemical Co., St. Louis, Mo.) at 10 µg/ml, epidermal growth factor (GIBCO BRL) at 0.5 µg/ml, and gentamicin (Elkins-Sinn, Inc., Cherry Hill, N.J.) at 40 µg/ml. NMuMG cells (51) were grown in Dulbecco's high-glucose minimal essential medium (GIBCO BRL) containing 10% FBS, 10 mM HEPES (pH 7.4), insulin at 10 µg/ml, and antibiotics. On the day prior to transfection, cells were treated with trypsin and replated in growth medium at approximately 5 × 106/100-mm-diameter plate. Single cells were obtained with trypsin, growth medium was added, and the cell count was determined. For transient transfections, cells were pelleted and resuspended to 107/200 µl in medium (lacking FBS) containing 40 µg of pLC-LUC DNA (13) and 40 µg of DNA with various ratios of a CDP expression vector (pRc/CMV CDP) (39) or an expression vector lacking the CDP insert (pcDNA3) (Invitrogen, Carlsbad, Calif.). To normalize for DNA uptake in transient-transfection assays, 5 µg of pRSV/lacZ or up to 0.7 µg of pRL-TK (Promega, Madison, Wis.) was added to all samples in the same transfection. Cells were transfected by electroporation using a BTX electroporator (BTX, San Diego, Calif.) at 1,750 µF and 150 V. Each electroporation was plated into a 100-mm-diameter tissue culture dish and incubated for 48 h in growth medium prior to preparation of cytoplasmic and/or nuclear extracts. Transfections were normalized for DNA uptake by measurement of beta -galactosidase activity (pRSVlacZ) (65) or Renilla luciferase (pRL-TK) or by hybridization analysis of nuclear DNA from transfected cells with a probe for firefly luciferase and quantitation using a PhosphorImager. Assays for firefly and Renilla luciferase were performed using the Luciferase Reporter Assay System (Promega). beta -Galactosidase activity was measured using standard methods as described previously (13). Transfections for each DNA sample were performed in triplicate and pooled for assays. For stable transfections, 2 × 105 HC11 cells were plated in each well of six-well plates and incubated overnight until the cells were ca. 50% confluent. Subsequently, 4 µg of the test plasmid and 1 µg of pcDNA3 containing the geneticin resistance gene in 0.5 ml of RPMI medium without serum were added to 12 µl of DMRIE-C reagent (GIBCO BRL) in an equal amount of medium, mixed, and incubated at room temperature for 45 min. The cells were washed with RPMI medium, and then the DNA solution was incubated with the cells for 7 h at 37°C prior to the addition of 1 ml of complete RPMI medium with 20% FBS. After further incubation for 48 h, cells were selected in geneticin (GIBCO BRL) at 1 mg/ml for 3 weeks. All of the six wells containing ca. 70 colonies each were pooled and assayed for luciferase activity. The luciferase readings were normalized for DNA uptake in each pool using a quantitative PCR assay with primers specific for the C3H MMTV LTR (5' GGCATAGCTCTGCTTTGC 3' and 5' TACTTCTAGGCCTGTGGTCA 3') (66, 67).

Plasmid constructions. Substitution mutations were introduced into the MMTV C3H LTR in the pLC-LUC vector by PCR-based mutagenesis as described by Hoguchi (32) and modified by Bramblett et al. (13). The naming system used here corresponds to numbering from the first base of the MMTV LTR as reported by Majors and Varmus (44). In plasmids that contain two mutations, e.g., 835/924, the plasmid previously described to contain the 924 mutation (13) was used as the template to introduce the second mutation.

Nuclear extract preparation. Nuclear extracts from cell lines were prepared essentially as described by Dignam et al. (19) and modified by Liu et al. (41). Mammary glands from each of three different developmental stages were obtained from the pooled tissues of six virgin, five first-pregnancy, and two lactating mice. Tissues were ground to a fine powder under liquid nitrogen and then resuspended in 10 ml of hypotonic buffer A (10 mM HEPES [pH 7.9], 10 mM KCl, 1.5 mM MgCl2, 1 mM EDTA, 10% glycerol, 2 M sucrose, 1 mM dithiothreitol (DTT), 1.25 mM phenylmethylsulfonyl fluoride, pepstatin A at 0.5 µg/ml, and a 1× protease inhibitor cocktail [Sigma; P9599]). Inhibitors were added to the buffer just prior to use. The samples were incubated on ice for 20 min and then homogenized using 20 to 30 strokes with a glass Dounce homogenizer pestle A. The supernatant was removed by centrifugation at 21,000 rpm in a Sorvall SS-34 rotor at 4°C for 30 min. The nuclear pellets were resuspended in 2 ml of high-salt buffer (400 mM KCl, 25 mM HEPES [pH 7.9], 25% glycerol, 1 mM DTT, and the same protease inhibitors as in buffer A) and homogenized for 20 strokes with a Dounce homogenizer pestle B. The nuclear suspension was then incubated on ice for 1.5 h with stirring and subjected to centrifugation at 21,000 rpm in a Sorvall SS-34 rotor for 30 min at 4°C. The supernatant was adjusted to 60% ammonium sulfate using a saturated solution in water and incubated on ice for 2.5 h. The precipitated proteins were sedimented at 40,000 rpm for 30 min at 4°C using a Beckman SW55Ti rotor. The pellet was resuspended in 1 ml of buffer D (20 mM HEPES [pH 7.9], 100 mM KCl, 20% glycerol, 2 mM EDTA, 1 mM DTT, 1 mM phenylmethylsulfonyl fluoride, pepstatin A at 0.5 µg/ml) and dialyzed thrice against 200 volumes of buffer D for 16 h at 4°C. The dialysate was subjected to centrifugation at 10,000 × g at 4°C for 15 min to remove precipitates, and the protein concentration was determined using the Bio-Rad protein assay system (Bio-Rad Laboratories, Hercules, Calif.). Protein extracts were stored in aliquots at -80°C.

EMSAs. Electrophoretic mobility shift assays (EMSAs) were performed as described by Liu et al. (41). The 22-bp sequence spanning the imperfect inverted repeat in the pNRE was multimerized, and four copies of this sequence were cloned in pUC9 (pNRE4) (41). The 120-bp sequence (+812 to +931) or the 110-bp sequence (+822 to +931) spanning the pNRE in the C3H MMTV LTR was obtained by PCR and cloned into pCRII (Invitrogen, San Diego, Calif.). Purified plasmid DNAs were digested with EcoRI and HindIII (pNRE4) or EcoRI (p120 or p110) to give 5' overhanging ends, and the inserts were isolated on polyacrylamide gels. Fragments were end labeled with Sequenase (version 2.0; Amersham Pharmacia Biotech, Piscataway, N.J.) for EMSA. Oligonucleotide probes were also end labeled with Sequenase after annealing of complementary strands to create 5' overhanging ends. One microliter (1:10 dilution) of rabbit anti-CDP serum was used for antibody ablation experiments as described by Liu et al. (41). Competition and SP1-binding experiments were performed as described previously (41).

DNase I footprinting assays. The binding conditions used for DNase I footprinting experiments were the same as those described for EMSAs, except that samples contained purified, bacterially expressed CDP representing the C-terminal two-thirds of the protein (CR2-Cterm) (39). Full-length CDP is not soluble. Approximately 0.5 ng (0.5 × 107 cpm/µg) of labeled probe and 15 to 30 µg of purified CDP were combined in a volume of 50 µl. Following incubation at 4°C, a solution containing 10 mM MgCl2 and 5 mM CaCl2 (50 µl) was added, followed by 2 µl of DNase I (0.02 U/ml freshly diluted from a stock solution) (GIBCO BRL). The reaction mixture was incubated at room temperature for 1 min, and then the reaction was terminated by the addition of 90 µl of 20 mM EDTA (pH 8.0), 1% sodium dodecyl sulfate (SDS), 0.2 M NaCl, and yeast tRNA at 150 µg/ml. Samples were then extracted with an equal volume of phenol-chloroform-isoamyl alcohol (25:24:1) prior to precipitation with ethanol. Precipitated DNA was resuspended in formamide loading buffer (80% formamide [Sigma Chemical Co.], 10 mM EDTA, 0.1% xylene cyanol [Sigma], 0.1% bromophenol blue [Bio-Rad]) and analyzed on 8% polyacrylamide gels containing 8 M urea. Gels were dried and subjected to autoradiography.

Antibodies and Western analysis. Polyclonal rabbit antibodies against glutathione S-transferase (GST)-SATB1 were kindly provided by Paul Gottlieb (University of Texas at Austin). Other polyclonal antibodies against GST-SATB1 or GST-CDP (CR2-Cterm) (39) were prepared by immunization of rabbits in accordance with the standard procedures of Cocalico Biologicals, Reamstown, Pa. Antibodies were shown to be specific for CDP or SATB1 as described previously (40). Western blots were prepared by lysis of cells in RIPA buffer (25 mM Tris-HCl [pH 7.8], 150 mM NaCl, 2 mM EDTA, 0.5% NP-40, 0.5% deoxycholate, 0.1% SDS) (23). All subsequent steps were performed at room temperature. Protein extract (15 to 20 µg for cell lines and 65 µg of mammary tissues) was subjected to electrophoresis on 8% polyacrylamide gels containing 0.1% SDS and blotted onto nitrocellulose. The membrane was incubated with 5% nonfat dry milk in TBST buffer (20 mM Tris-HCl [pH 7.6], 137 mM NaCl, 0.1% Tween 20) for 1 h and then washed three times for 5 min each with TBST buffer. Anti-CDP (1:500 dilution) or anti-actin (1:150 dilution) (Sigma; A-2066) serum was diluted in TBST buffer containing 1% nonfat dry milk. The antibody was added to the membrane for 1 h, and then blots were washed four times with 50 ml of TBST buffer (for 15 min each time). The membrane then was incubated with horseradish peroxidase-labeled anti-rabbit antibody (1:8,000 dilution) for 40 min and washed three times for 15 min each time with TBST buffer. Binding of the secondary antibody was detected using the ECL Western Blotting Detection System (Amersham).

Preparation of fusion proteins. Recombinant GST-CDP fusion protein was cleaved with thrombin (35) and purified by standard methods (58) as described by Liu et al. (40) before use in immunization or DNA-binding protocols.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

CDP DNA-binding activity in the developing mammary gland. Previous experiments have shown that high levels of MMTV transcription in the lactating mammary gland result from the action of positive factors, including those that bind to the HRE and the mammary gland-specific enhancer in the LTR (28, 37, 46, 47, 55, 69). However, little is known about negative regulation of MMTV expression in the mammary gland. We have shown previously that at least two homeodomain transcription factors, CDP and SATB1, bind strongly to NREs in the MMTV LTR (13, 41). These experiments have shown that there is no detectable SATB1 and CDP binding activity for the MMTV NRE in the lactating mammary gland, whereas CDP, but not SATB1, binding activity is detectable in all of the mammary gland cell lines tested (13, 41). Such data suggested that CDP is a suppressor of MMTV expression in relatively undifferentiated cells (e.g., cultured cells) derived from the mammary gland (41).

Because MMTV expression increases during mammary gland differentiation (34), it is possible that some of the increased viral expression corresponds to a decrease in suppression by CDP. Therefore, we examined CDP binding activity to the MMTV NRE in mammary gland extracts at different developmental stages by EMSA. Nuclear extracts from virgin, first-pregnancy, and lactating mouse mammary glands were incubated with the multimerized 22-bp pNRE probe (probe positions are shown in Fig. 1) prior to electrophoresis on nondenaturing polyacrylamide gels. As anticipated from our previous results (41), lactating mammary gland extracts had undetectable SATB1 and little or no CDP binding activity for the pNRE (Fig. 2A, lane 3). However, virgin and first-pregnancy mouse mammary glands both had detectable DNA-binding activities (lanes 1 and 2) that were abolished by preincubation of extracts with anti-CDP serum (lanes 7 and 8), but not with preimmune serum (lanes 4 and 5). SP1 binding activity was detectable in all mammary cell extracts (Fig. 2B). Intriguingly, regressing mammary glands from animals that had finished lactation showed the return of CDP activity (not shown). These results suggested that the level of CDP binding of the MMTV LTR was inversely correlated with the differentiation status of the mammary gland.


View larger version (13K):
[in this window]
[in a new window]
 
FIG. 1.   Diagram of the MMTV LTR. The LTR is divided into U3, R, and U5 regions, and transcription is initiated from the standard MMTV promoter at the first base of the R region. The promoter-proximal and promoter-distal NREs and the HRE are shown by boxes with different types of hatch marks within the U3 region of the LTR. Numbering is shown from the first base of the LTR (+1). The region encompassing the largest of the U3 deletions found in thymotropic MMTVs relative to mammotropic MMTV strains is shown by a box over the LTR. The positions of probes used in this study are given below the LTR. The number of bases in each probe also is indicated.


View larger version (32K):
[in this window]
[in a new window]
 
FIG. 2.   CDP levels and NRE-binding activity decrease during mammary gland development. (A) CDP binding activity declines during mammary gland differentiation. Nuclear extracts were obtained from pooled tissues of virgin (V-MG), first-pregnancy (P-MG), and lactating (L-MG) BALB/c mice as described in Materials and Methods. Extracts (5 µg) were incubated with no serum (lanes 1 to 3), preimmune rabbit serum (lanes 4 to 6), or rabbit anti-CDP serum (lanes 7 to 9) prior to incubation with a labeled tetramer of a 22-bp oligomer in the pNRE (ca. 2.5 fmol). This oligomer spans the 3' CDP binding site of the pNRE shown in Fig. 1 (pNRE4) (41). Monomers and dimers of the 22-bp oligomer do not show detectable CDP binding using nuclear extracts (41). A reaction mixture with the probe in the absence of the extract is shown in lane 10. Samples were analyzed on a 4% nondenaturing polyacrylamide gel. (B) SP1 binding activity in virgin, pregnant, and lactating mouse mammary gland extracts. Approximately 260 fmol of probe (plus strand; 5' GGTGACGGGCGGGCCCGCCCCCCTCC 3') was added to 20 µg of protein from each extract. Binding reaction mixtures were analyzed on gels as described for panel A. (C) Western blots of nuclear extracts from mammary glands at different developmental stages. The mammary gland extracts used were the same as those used for panels A and B. Approximately 65 µg of each extract was analyzed on an 8% polyacrylamide gel containing SDS prior to transfer to a nitrocellulose membrane. The Western blot shown at the top was incubated with anti-CDP serum, whereas the blot shown at the bottom was developed with anti-actin serum. Both blots were washed and developed as described in Materials and Methods. The positions of molecular size markers are shown to the left.

To determine if the reduction of CDP-specific DNA-binding activity was due to a decrease in CDP levels during differentiation, Western blotting was performed on extracts derived from virgin, first-pregnancy, and lactating mouse mammary glands (Fig. 2C). Surprisingly, CDP was detected at all stages in the mammary glands examined, although the level in virgin mouse mammary glands appeared to be sixfold higher than that in pregnant mouse glands as measured by densitometry (compare lanes 1 and 2). In addition, the molecular mass of the CDP detected in lactating mouse mammary glands was approximately 50 kDa less than that observed for CDP in virgin or pregnant mouse glands. Although we cannot exclude the possibility that this is an artifact of proteolytic degradation during preparation of extracts, the same extracts did not show degradation when anti-actin serum was used (Fig. 2C, lower panel). Thus, CDP binding activity for the pNRE decreases during development of the mammary gland and this result may be due, in part, to the appearance of a novel CDP form. Since the reduction of CDP binding to the pNRE correlates with the elevation of MMTV expression following the onset of lactation in the mammary gland, CDP may participate in the control of MMTV transcription.

Effect of CDP overexpression on transcription from the MMTV LTR. The tissue-specific activity of CDP during mammary gland development suggests a potential role in repression of MMTV transcription. To confirm this hypothesis, we studied the effect of CDP overexpression on MMTV LTR-reporter gene expression using transient-transfection assays of mouse mammary cells. Because all of the cultured cell lines that we have examined contain endogenous CDP that might interfere with the assay (our unpublished observations), the amount of pLC-LUC used in this experiment is critical for our ability to observe effects on CDP overexpression. To determine the optimal amount of pLC-LUC for these experiments, we transfected different amounts of pLC-LUC (20, 40, and 60 µg) into HC11 cells with 30 µg of the CDP expression vector and 5 µg of pRSVlacZ to normalize for the efficiency of DNA uptake. The total amount of DNA in each transfection was kept constant by the inclusion of appropriate amounts of vector lacking CDP sequences. The results showed that CDP overexpression suppresses reporter gene expression from the MMTV LTR, and the highest levels of suppression were observed when 40 µg of the reporter construct was used (data not shown).

To determine the dose dependence of CDP effects on MMTV transcription, we cotransfected increasing amounts of the CDP expression vector into HC11 cells by electroporation using 40 µg of pLC-LUC and 0.5 µg of pRL-TK vector as a transfection control. After 48 h of incubation, cells were harvested and a portion was used for Western blotting to determine CDP levels (Fig. 3A). As expected, densitometry showed that levels of CDP increased approximately 50-fold following transfection with the highest levels of the CDP vector (compare lanes 1 and 5) whereas the levels of actin in the same extracts were relatively constant (Fig. 3A, bottom). Four different transfections performed in the same manner were also analyzed for reporter gene activity (Fig. 3B). Transfection of 5 µg of the CDP vector gave a two- to threefold decrease in luciferase activity compared to endogenous levels of CDP found in HC11 cells transfected with the empty vector, whereas 30 µg of the CDP-containing vector showed over 20-fold suppression of MMTV LTR activity. These levels of CDP did not appear to be toxic to the cells, and the levels of actin (Fig. 3A, bottom) and luciferase expression from the Renilla control vector were relatively constant when different amounts of CDP vector were used for transfection. Similar results were observed after CDP overexpression in a second mouse mammary cell line, NMuMG (Fig. 3C). These experiments showed that transcription from the MMTV LTR is suppressed in a dose-dependent manner by CDP overexpression.


View larger version (20K):
[in this window]
[in a new window]
 
FIG. 3.   Overexpression of CDP suppresses MMTV LTR-reporter gene expression in mammary cells. (A) Western blots showing CDP overexpression in HC11 mammary cells. HC11 cells were transfected by electroporation with an MMTV LTR-luciferase reporter gene construct (pLC-LUC) (40 µg) and various ratios of a CDP expression vector or a vector control lacking CDP sequences. After 48 h, cytoplasmic extracts were prepared and divided into two parts. One part of the extract was used for Western blotting (15 µg for each lane) using antiserum specific for CDP (top) or actin (bottom). Blots were developed as described in the legend to Fig. 2. (B) CDP overexpression suppresses MMTV LTR promoter activity in HC11 cells. The second part of the extract obtained as described for panel A was used for luciferase assays, and the results are expressed relative to MMTV LTR activity in the absence of CDP overexpression. The data shown are averages of three independent experiments, and transfections were performed in triplicate for each experiment. Standard deviations from the mean are indicated by error bars. LUC, luciferase. (C) CDP overexpression suppresses MMTV LTR promoter activity in NMuMG cells. Other parameters are the same as those described for panel B.

Mapping of CDP binding sites in the pNRE. CDP overexpression in transient-transfection experiments indicates that CDP represses expression from the MMTV LTR. This repression may be the result of CDP binding to NRE sequences upstream of the MMTV promoter or, alternatively, the repression may be an indirect effect of other CDP activities. If repression of MMTV LTR-reporter gene expression was due to direct CDP binding to the pNRE, mutation of CDP binding sites should alleviate the transcriptional suppression. Our previous experiments showed that both CDP and SATB1 bound to a 22-bp sequence at the 3' end of the pNRE (41). However, mutations of this sequence had little effect on CDP binding in EMSAs with the 120-bp pNRE fragment, suggesting that there is more than one CDP binding site in the pNRE.

To localize all of the CDP binding sites, we performed a series of DNase I footprinting assays with bacterially expressed purified CDP (40). Because full-length CDP is insoluble, an N-terminal deletion that removed the coiled-coil and CR1 domains of CDP (39) was used for footprinting with an end-labeled 120-bp fragment from the pNRE (Fig. 1). Using both upper- and lower-strand probes, we detected two CDP binding sites (Fig. 4). One site was localized to the 5' end of the pNRE (+830 to +845) using the upper-strand probe and from +832 to +843 using the lower-strand probe. A second site at the 3' end of the pNRE was localized using the upper-strand probe (+920 to +931). As predicted from our previous experiments, the latter site spanned the 3' half of the 7-bp inverted repeat and the 5-bp gap and overlapped a SATB1-binding site in the pNRE (41). In agreement with previous results, both of the identified CDP binding regions were AT rich (3, 27) and contained the ATTA sequence typical of DNA-binding sites for transcription factors with homeodomains (22, 26).


View larger version (61K):
[in this window]
[in a new window]
 
FIG. 4.   DNase I footprinting of the pNRE in the MMTV LTR. The 120-bp fragment from the pNRE was end labeled on the lower strand (lanes 2 to 6) or the upper strand (lanes 7 to 11), and footprinting was performed as described in Materials and Methods. Lane 1 shows a Maxam-Gilbert sequencing reaction of the 120-bp fragment. Bacterially produced CDP (CR2-Cterm) (39) was used in the reaction mixtures in lanes 2, 3, 7, and 8 (10 µg in lanes 3 and 8 and 15 µg in lanes 2 and 7 with DNase I at 0.8 U/ml). The amount of DNase I was titrated in lanes without CDP (lanes 4 and 9, 0.6 U/ml; lanes 5 and 10, 0.4 U/ml; lanes 6 and 11, 0.2 U/ml). Reaction mixtures were analyzed on an 8% denaturing polyacrylamide gel. The protected regions are shown to each side of the gel. The numbers in parentheses indicate the locations of the protected regions relative to the first base of the C3H MMTV LTR (44). The locations of mutations used in this study with respect to the DNase I-protected regions are shown below the wild-type (WT) LTR sequence. The cross-hatch marks indicate that the entire region between CDP footprints is not shown. The location of the imperfect inverted repeats at the 3' end of the pNRE is also shown by arrows. A 3' CDP binding site on the lower strand was not observed.

CDP binding to mutant sequences in the pNRE. To confirm the additional CDP binding site detected by DNase I footprinting, we synthesized 31-bp oligonucleotides containing the wild-type (822WT) CDP binding sites at the 5' end of the pNRE starting at position +822. A mutant oligomer also was synthesized from the same region so that the ATTATA sequence starting at +835 was changed to GGTACC, thus generating a KpnI recognition site (Fig. 4). Each oligonucleotide was labeled and used for EMSAs with nuclear extracts obtained from the mouse mammary gland cell line HC11 (Fig. 5A). As expected, CDP bound to the wild-type oligomer in the presence of preimmune rabbit serum (lane 2) and this binding was abolished in the presence of CDP-specific serum (lane 3). However, introduction of the 4-bp mutation into the wild-type oligomer (m835) eliminated detectable binding by CDP (lane 4). To compare the relative affinity of CDP for the 5' and 3' binding sites in the pNRE, binding of the labeled 5' oligonucleotide (822WT) was competed with increasing amounts of the unlabeled homologous oligomer or an oligomer containing the 3' CDP binding site (904WT) (Fig. 5B). PhosphorImager analysis showed that a 15-fold excess of homologous competitor was necessary to obtain a twofold reduction in CDP binding, whereas an approximately 110-fold excess of heterologous competitor was required to achieve the same amount of competition. This result indicates that the 5' CDP binding site in the pNRE has a higher affinity for CDP than does the 3' site.


View larger version (57K):
[in this window]
[in a new window]
 
FIG. 5.   CDP binding site mutations in oligomers containing the 5' or 3' binding sites from the pNRE. Nuclear extracts (7 µg of protein) from HC11 mammary cells were used in EMSAs prior to analysis on 4% nondenaturing polyacrylamide gels. (A) EMSA using oligomer probes with CDP binding site mutations at the 5' end of the pNRE. Oligomers spanning the wild-type (822WT) or mutant (822m835) 5' CDP binding site in the pNRE were labeled, and ca. 100 fmol of probe was incubated with nuclear extract and anti-CDP or preimmune serum, as indicated, prior to gel analysis. Reaction mixtures without added protein are shown for the 822WT and 822m835 probes in lanes 5 and 6, respectively. (B) Competition of unlabeled 5' or 3' oligomers for CDP binding to the labeled 5' oligomer probe. Approximately 105 cpm (ca. 100 fmol) of wild-type 822 double-stranded oligomer (822WT) (plus strand; 5' GGC AAC AGG TAC ATG ATT ATA TTT ATC TAG GGG 3') was used in an EMSA with a 10- to 500-fold excess of unlabeled homologous (lanes 3 to 7) or heterologous (904WT) (lanes 8 to 12) oligomer (spanning the 5' or 3' CDP-binding site, respectively, in the pNRE) (plus strand; 5' GGGGCTGGACTAATAGAACATTATTCTGCAA 3').

Because footprinting assays revealed two CDP binding sites in the pNRE, it was important to examine the effects of binding site mutations in the context of the entire pNRE. If there are two CDP binding sites in the pNRE, then mutation of either site alone will preserve CDP binding in the EMSA, and thus, CDP binding will be abolished only when both CDP binding sites have been disrupted. Using PCR-based mutagenesis, we introduced the 835 mutation (m835) into the 5' CDP binding site within the wild-type pNRE fragment of 120 bp (WTp120). We also mutated the CDP binding site at the 3' end of the pNRE (m916) prior to analysis of both fragments by EMSA (Fig. 6A). In agreement with the data in Fig. 5B, mutation of the 5' binding site (m835) had a much greater effect than mutation of the 3' binding site (m916) on the ability of CDP to bind to the pNRE (compare lanes 6 and 7 with lanes 10 and 11). The small amount of residual binding observed with the m835 probe was due to CDP, since binding was abolished in the presence of CDP-specific serum (lane 12). As expected, combination of mutations at the 5' end of the pNRE (835, 839a, and 839b) with a mutation at the 3' end (916) reduced or completely disrupted CDP binding under these conditions (lane 14 and data not shown). Thus, these results confirmed the presence of two CDP binding sites within the pNRE and suggested that mutations in the 5' site have a greater effect on CDP binding than mutations in the 3' site.


View larger version (33K):
[in this window]
[in a new window]
 
FIG. 6.   Binding of CDP from mammary cells to mutant NREs. Nuclear extracts from HC11 mammary cells (400 ng) were incubated with wild-type or mutant pNRE probes (2 × 104 cpm) prior to analysis on nondenaturing polyacrylamide gels. (A) The wild-type 120-bp fragment or mutant fragments (ca. 2.5 fmol) from the same region were end labeled and analyzed on gels without nuclear extract (lanes 1, 5, 9, and 13) or with nuclear extracts (all other lanes). In some cases, reaction mixtures contained preimmune (lanes 3, 7, and 11) or anti-CDP (lanes 4, 8, and 12) serum. (B) Competition of the labeled 110-bp pNRE (ca. 2.5 fmol) with the wild-type (WT) homologous or heterologous (m835) fragments from the same region. Competitor DNA was present in 10- to 200-fold molar excess of labeled DNA. (C) Competition of the labeled 110-bp pNRE with the unlabeled m924 and m916 fragments from the same region. (D) Competition of the labeled 110-bp pNRE with the unlabeled wild-type or double mutant (m835/916) fragments from the same region. (E) Competition of the labeled 110-bp pNRE with the unlabeled mutant (m839a) fragment from the same region. (F) Competition of the labeled 110-bp pNRE with the unlabeled mutant (m839b) or wild-type fragment from the same region.

To determine the relative affinities of CDP for mutant pNRE binding sites, we performed EMSAs with the labeled wild-type pNRE fragment in the presence of increasing amounts of unlabeled mutant fragments from the same region (locations are shown in Fig. 4). Based on quantitation by PhosphorImager analysis, mutations in the 3' binding site (m924 and m916) had relatively minor effects on CDP binding to the pNRE, whereas mutations in the 5' binding site (m835 and m839a) had a more dramatic effect, as expected (Fig. 6B to F). However, a fragment containing both 5' and 3' binding site mutations (m835/916) was the poorest competitor for CDP binding to the pNRE (Fig. 6D). Because the double mutant showed some competition for CDP binding to the wild-type NRE, this mutant may retain residual CDP binding activity for the NRE that is not detectable in direct binding assays.

Effects of CDP binding site mutations on MMTV promoter activity in transfection assays. If CDP suppression of MMTV expression is due to CDP binding to the MMTV promoter, then CDP binding site mutations should elevate viral gene expression. To test this hypothesis, we inserted the CDP binding site mutations described above into the pNRE of the MMTV C3H LTR-luciferase construct (LC-LUC). The resulting constructs were tested for reporter gene activity in transient-transfection assays with HC11 cells (Fig. 7).


View larger version (17K):
[in this window]
[in a new window]
 
FIG. 7.   Transient-transfection analysis of MMTV LTR-reporter gene constructs with pNRE mutations. HC11 cells were transfected by electroporation with the C3H MMTV LTR-luciferase (LUC) plasmid (pLC-LUC) or mutant plasmids (40 µg), the pcDNA3 vector with or without CDP sequences (20 µg), and 0.7 µg of pRL-TK. Transfections were performed in triplicate with HC11 cells. Because of the large number of samples tested, mutants were tested in separate experiments (shown as panels A and B). After normalization for DNA uptake, results are reported relative to the average of three transfections of pLC-LUC with the pcDNA3 control vector (assigned a value of 100). The error bars show standard deviations from the mean. Results were analyzed by the one-tailed Student t test. Analysis showed that values from m835, 835/916, and 839a were significantly different than those from wild-type pLC-LUC (P = <0.05), whereas m916 values were marginally different (P = 0.06). As expected, m924 results were not significantly different than those from the wild-type plasmid (P = 0.18).

Each construct was coelectroporated with a CDP overexpression plasmid, and reporter gene expression was compared to that of the same construct electroporated with a control vector (Fig. 7A and B). After normalization for DNA uptake, these experiments showed that mutations in the 5' or 3' CDP binding site of the pNRE elevated luciferase expression two- to fourfold without CDP overexpression, compared to the wild-type construct. Thus, mutations that affected CDP binding to the pNRE also relieved CDP-mediated LTR suppression, although differences between the activity of the 916 mutant and that of the wild-type LTR were marginally significant (P = 0.06). A combination of 5' and 3' binding site mutations (m835/916) showed approximately the same effect on MMTV LTR repression as the single-site mutations alone. However, in most cases, the effect of CDP binding site mutations was diminished by CDP overexpression (see Discussion).

Because CDP is a matrix-associated region-binding protein (7, 15, 41, 64), complete chromatin structure may be important for maximum effects on repressor function. Therefore, analysis of CDP binding site mutants in stable-transfection assays allowed us to analyze integrated templates and to ensure that the majority of cells contained the reporter construct. Each of the constructs was cotransfected with a selectable marker plasmid into six independent cultures of HC11 cells using a lipid-mediated method (DMRIE-C). The six cultures containing the same plasmid were harvested, pooled, and assayed for luciferase activity; the luciferase activity then was normalized for DNA content using a quantitative PCR method. The results showed that mutation of the 5' CDP binding site in the pNRE (m835) gave approximately sixfold (600%) elevation of luciferase activity from the MMTV LTR compared to transfectants containing wild-type LTR-luciferase constructs (Fig. 8). Two or four base pair changes at position +839 also increased luciferase activity four- or sixfold, respectively, compared to the wild-type construct, whereas a mutation at +924 that changed 3 bp of the 3' binding site in the pNRE (and had little effect on CDP DNA binding) had little effect on luciferase expression. Mutation of both the 5' and 3' CDP binding sites (m835/916) in LTR-reporter gene constructs gave a similar (5-fold) elevation of luciferase activity, compared to wild-type constructs, as constructs with mutations in the 5' site alone. Therefore, results from transient- and stable-transfection assays suggested that a single mutation in the pNRE is sufficient to alter transcriptional suppression by CDP.


View larger version (17K):
[in this window]
[in a new window]
 
FIG. 8.   Stable transfections of MMTV LTR-reporter gene constructs with pNRE mutations. Transfections were performed as described in Materials and Methods using DMRIE-C reagent. Pooled colonies obtained for each plasmid construct were assayed for luciferase (LUC) activity, and the results were normalized for the amount of transfected DNA. Results for mutants are reported relative to those obtained with wild-type C3H MMTV LTR constructs in the same assay (assigned a value of 100).


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

A specific role for CDP in the developing mammary gland. Studies of CDP levels in the differentiating mammary gland showed that CDP levels declined during development of the mammary gland and that there was an apparent decrease in the molecular mass of CDP that accompanied lactation. The changes in CDP expression following mammary gland differentiation were accompanied by loss of CDP binding activity for the pNRE in the MMTV LTR (Fig. 2). Because it is known that MMTV expression is highest in the lactating mammary gland (34), there is an inverse correlation between the presence of CDP binding activity for the NRE and the level of MMTV expression. Stable transfections showed that CDP binding site mutations relieved transcriptional suppression two- to sixfold. Together, these results provide the first evidence that CDP is a negative regulator of MMTV expression in the mammary gland and suggest that CDP is an important regulator of mammary gland-specific transcription.

Although CDP binding site mutations were able to relieve suppression of the MMTV LTR-reporter gene up to sixfold in stable-transfection assays (Fig. 8), these same binding site mutations had a more modest effect in transient-transfection assays either with or without CDP overexpression (Fig. 7). There are several possible explanations for this. (i) We have mapped at least six CDP binding sites within the MMTV NRE, and there is at least one other potential site in the 5' portion of the LTR (TFSEARCH, version 1.3, Y. Akiyama, Kyoto University). Therefore, we believe that mutation of one or two sites is unlikely to completely relieve suppression by CDP. (ii) We have shown that most of the mutations do not completely eliminate CDP binding to the target site. Even in mutants that had two binding site alterations, residual competition was observed for CDP binding to wild-type sites. In addition, overexpression of CDP will maximize CDP binding to low-affinity mutant sites, thus minimizing the effect of the mutation in reporter assays. (iii) CDP has been reported to repress transcription of genes by blocking the binding of activator proteins (43). Thus, our CDP binding site mutations also may have affected the binding of transcriptional activator proteins, so that the overall reporter gene expression in the absence of CDP binding will not achieve levels observed without CDP overexpression. Any or all of these factors may contribute to the modest effect of two CDP binding site mutations in the transient transfections.

MMTV is known to replicate in B- and T-lymphoid cells during the transmission of virus from mother's milk in the newborn murine gut to target epithelial cells in the mammary gland (9, 24, 29). We have shown previously that MMTV expression is repressed by the homeodomain protein SATB1, and we have proposed that SATB1 restricts MMTV expression in many tissues other than the mammary gland, particularly T cells (40, 41). Our studies also have shown that SATB1 binding activity for the MMTV NREs is absent in mammary gland tissue, as well as in cultured mammary cell lines (13, 41). Thus, it appears that negative regulation of MMTV expression is different in differentiated mammary gland tissue than in T cells. Our experiments suggest that a decrease in CDP molecular mass may cause loss of CDP DNA-binding activity in the lactating mammary gland. This may represent a novel posttranscriptional mechanism, such as alternative splicing or protein processing, for control of CDP-mediated repression. Recent experiments with other viruses, such as human papillomavirus (HPV), suggest that loss of CDP binding to HPV early promoters correlates with cellular differentiation and high virus expression (1). Thus, loss of negative regulatory proteins during mammary gland differentiation combined with the action of positive factors, such as hormone-activated steroid receptors and Stat factors (53, 54), leads to high MMTV expression in the lactating mammary gland.

Mice lacking expression of the full-length CDP have been reported (60). These mice express a truncated form of CDP that lacks the CR1 domain (Delta CR1). Delta CR1 mice are phenotypically normal in many respects but show curly vibrissae, wavy hair, and a high degree of pup loss from mothers carrying the mutation (60). Although the specific defect is unknown, the authors propose that Delta CR1 mice have a defect in some component of milk. These results suggest that CDP is important for expression of certain cellular genes in the mammary gland.

CDP binds to multiple sites in the proximal MMTV NRE. Previous experiments showed that a high-molecular-weight complex, UBP, bound to the promoter-proximal and promoter-distal NREs in the MMTV LTR (13), and more recent results demonstrated that the UBP complex contained the transcriptional suppressor CDP (41). One of the CDP-binding sites was localized to a 22-bp oligonucleotide in the pNRE that overlapped an imperfect inverted repeat containing a binding site for homeodomain protein SATB1 (41). Using DNase I protection assays, we confirmed that there was a CDP binding site localized between +920 and +931, and we identified a second site at +830 to +845 (Fig. 4). As expected, mutations in either of these sites reduced CDP binding to the 120-bp pNRE in gel shift assays (Fig. 5). Mutations in both binding sites abolished or further reduced binding, as measured in gel shift assays, suggesting that CDP interactions with the MMTV NRE are additive.

Previous experiments using the gene for the cytochrome b heavy-chain component (gp91) of the phagocyte NADPH-oxidase (phox) have shown that CDP has at least four different binding sites upstream of the gp91-phox promoter (42). Moreover, there appear to be multiple CDP binding sites in the HPV long control region (1), as well as in the matrix-associated region of the immunoglobulin heavy-chain intronic enhancer (64, 70). Results obtained with the gp91-phox promoter suggested that the promoter-proximal CDP binding site has the highest affinity for CDP and that the affinity for CDP decreases with the distance from the promoter (42). However, this may not be generally true for CDP-mediated repression since the most promoter-proximal CDP binding site in the MMTV pNRE appeared to have a lower affinity for CDP than the 5' site (Fig. 5). EMSAs using oligonucleotides spanning the 5' or 3' CDP binding sites in the pNRE and extracts from mammary cells showed CDP binding to the 5' site but no detectable binding to the 3' site (data not shown). Nevertheless, purified CDP fragments containing CR2-Cterm showed very similar binding to both the 5' and 3' sites in the pNRE, suggesting that the full-length CDP found in nuclear extracts can discriminate between the two sites.

CDP has four different DNA-binding domains, and each of these domains has a different specificity for DNA, although the CR2 and CR3 domains appear to have the most similar DNA-binding properties (3, 27). Thus, the presence of CR1 in the full-length protein may decrease its affinity for the 3' site or increase its affinity for the 5' site in the pNRE. Alternatively, differences in the abilities of the native and bacterial proteins to bind to the 3' site in the pNRE may result from the ability of native CDP to dimerize with certain proteins due to the coiled-coil domain within the N-terminal region; the coiled-coil is missing in the bacterially expressed proteins. CDP has been shown to interact with a number of proteins in vivo, including SATB1, histone deacetylase 1 (HDAC1), and Rb (38, 40, 63), and SATB1 has been shown to interact with three of the four CDP DNA-binding domains (CR1, CR2, and the homeodomain) (40). Together, these observations argue that cooperative interactions between different CDP DNA-binding domains and between different CDP molecules bound to adjacent DNA-binding sites may be important for promoter recognition in vivo. The ability of CDP to bind to the promoters and enhancers of a large number of genes, including those for c-mos, gamma -globin, Ncam, histones, gp91-phox, HPV E1, E6, and E7, c-myc, the immunoglobulin heavy and light chains, TCRbeta , and CD8alpha , MMTV, and the cystic fibrosis transmembrane conductance regulatory gene (1, 7, 8, 15, 16, 21, 31, 38, 41, 57, 61, 64), may depend upon the presence of multiple DNA-binding domains with different DNA-binding and protein interaction specificities.

Mechanism of CDP transcriptional suppression. Experiments by Mailly et al. (43) have indicated that CDP represses transcription by competition for DNA binding by positive regulators, as well as by active repression, perhaps mediated by chromatin reorganization (38). It is likely that transient-transfection assays measure competition for transcription factor binding to DNA but not chromatin reorganization. Both transient- and stable-transfection assays for MMTV promoter function were affected by CDP binding site mutations, probably because CDP binding to DNA is a requirement for both types of repression.

CDP is known to have multiple binding sites in the promoters or enhancers of other genes, such as the immunoglobulin heavy-chain intronic enhancer or the gp91-phox promoter (42, 70), where CDP binding sites are thought to overlap binding sites for transcriptional activator proteins (57, 64). Because CDP has a stronger affinity for these sites than the activator protein, binding of CDP prevents binding of the activator, thus leading to repression of gene expression. Although most of these activators are not known, recent results suggest that immunoglobulin heavy-chain transcription may be, in part, restricted to B cells through the binding of B-cell-specific activators, such as Bright (30), that accompany the decreasing levels of CDP repressor present during B-cell differentiation (56). The identities of activators that bind to MMTV LTR sites occupied by CDP during mammary gland differentiation are unknown. However, it is an attractive possibility that CDP binding sites could be used to isolate proteins that activate transcription following the loss of CDP binding activity that accompanies differentiation of the mammary gland. Because the loss of CDP occurs in a number of differentiating cell types (1, 56, 57), this strategy also may be applicable to the isolation of transcriptional activators in other tissues.


    ACKNOWLEDGMENTS

We acknowledge Susan Ross, Paul Gottlieb, and members of the Dudley laboratory for careful review of the manuscript.

This work was supported by grant R01CA34780 from the National Institutes of Health.


    FOOTNOTES

* Corresponding author. Mailing address: Section of Molecular Genetics and Microbiology, 100 W. 24th St., The University of Texas at Austin, Austin, TX 78705. Phone: (512) 471-8415. Fax: (512) 471-7088. E-mail: jdudley{at}uts.cc.utexas.edu.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Ai, W., E. Toussaint, and A. Roman. 1999. CCAAT displacement protein binds to and negatively regulates human papillomavirus type 6 E6, E7, and E1 promoters. J. Virol. 73:4220-4229[Abstract/Free Full Text].
2. Andres, V., B. Nadal-Ginard, and V. Mahdavi. 1992. Clox, a mammalian homeobox gene related to Drosophila cut, encodes DNA-binding regulatory proteins differentially expressed during development. Development 116:321-334[Medline].
3. Aufiero, B., E. J. Neufeld, and S. H. Orkin. 1994. Sequence-specific DNA binding of individual cut repeats of the human CCAAT displacement/cut homeodomain protein. Proc. Natl. Acad. Sci. USA 91:7757-7761[Abstract/Free Full Text].
4. Ball, J. K., L. O. Arthur, and G. A. Dekaban. 1985. The involvement of a type-B retrovirus in the induction of thymic lymphomas. Virology 140:159-172[CrossRef][Medline].
5. Ball, J. K., H. Diggelmann, G. A. Dekaban, G. F. Grossi, R. Semmler, P. A. Waight, and R. F. Fletcher. 1988. Alterations in the U3 region of the long terminal repeat of an infectious thymotropic type B retrovirus. J. Virol. 62:2985-2993[Abstract/Free Full Text].
6. Ball, R. K., R. R. Friis, C. A. Schoenenberger, W. Doppler, and B. Groner. 1988. Prolactin regulation of beta -casein gene expression and of a cytosolic 120-kd protein in a cloned mouse mammary epithelial cell line. EMBO J. 7:2089-2095[Medline].
7. Banan, M., I. C. Rojas, W. H. Lee, H. L. King, J. V. Harriss, R. Kobayashi, C. F. Webb, and P. D. Gottlieb. 1997. Interaction of the nuclear matrix-associated region (MAR)-binding proteins, SATB1 and CDP/Cux, with a MAR element (L2a) in an upstream regulatory region of the mouse CD8alpha gene. J. Biol. Chem. 272:18440-18452[Abstract/Free Full Text].
8. Barberis, A., G. Superti-Furga, and M. Busslinger. 1987. Mutually exclusive interaction of the CCAAT-binding factor and of a displacement protein with overlapping sequences of a histone gene promoter. Cell 50:347-359[CrossRef][Medline].
9. Beutner, U., E. Kraus, D. Kitamura, K. Rajewsky, and B. T. Huber. 1994. B cells are essential for murine mammary tumor virus transmission, but not for presentation of endogenous superantigens. J. Exp. Med. 179:1457-1466[Abstract/Free Full Text].
10. Blochlinger, K., R. Bodmer, J. Jack, L. Y. Jan, and Y. N. Jan. 1988. Primary structure and expression of a product from cut, a locus involved in specifying sensory organ identity in Drosophila. Nature 333:629-635[CrossRef][Medline].
11. Blochlinger, K., L. Y. Jan, and Y. N. Jan. 1991. Transformation of sensory organ identity by ectopic expression of Cut in Drosophila. Genes Dev. 5:1124-1135[Abstract/Free Full Text].
12. Bodmer, R., S. Barbel, S. Sheperd, J. W. Jack, L. Y. Jan, and Y. N. Jan. 1987. Transformation of sensory organs by mutations of the cut locus of D. melanogaster. Cell 51:293-307[CrossRef][Medline].
13. Bramblett, D., C. L. Hsu, M. Lozano, K. Earnest, C. Fabritius, and J. Dudley. 1995. A redundant nuclear protein binding site contributes to negative regulation of the mouse mammary tumor virus long terminal repeat. J. Virol. 69:7868-7876[Abstract].
14. Bruggemeier, U., M. Kalff, S. Franke, C. Scheidereit, and Beato. 1991. Ubiquitous transcription factor OTF-1 mediates induction of the MMTV promoter through synergistic interaction with hormone receptors. Cell 64:565-572[CrossRef][Medline].
15. Chattopadhyay, S., C. E. Whitehurst, and J. Chen. 1998. A nuclear matrix attachment region upstream of the T cell receptor beta  gene enhancer binds Cux/CDP and SATB1 and modulates enhancer-dependent reporter gene expression but not endogenous gene expression. J. Biol. Chem. 273:29838-29846[Abstract/Free Full Text].
16. Cunningham, J. M., M. E. Purucker, S. M. Jane, B. Safer, E. F. Vanin, P. A. Ney, C. H. Lowrey, and A. W. Nienhuis. 1994. The regulatory element 3' to the Agamma -globin gene binds to the nuclear matrix and interacts with special A-T-rich binding protein 1 (SATB1), an SAR/MAR-associating region DNA binding protein. Blood 84:1298-1308[Abstract/Free Full Text].
17. Dekaban, G. A., and J. K. Ball. 1984. Integration of type B retroviral DNA in virus-induced primary murine thymic lymphomas. J. Virol. 52:784-792[Abstract/Free Full Text].
18. Dickson, C., R. Smith, S. Brookes, and G. Peters. 1990. Proviral insertions within the int-2 gene can generate multiple anomalous transcripts but leave the protein-coding domain intact. J. Virol. 64:784-793[Abstract/Free Full Text].
19. Dignam, J. D., P. L. Martin, B. S. Shastry, and R. G. Roeder. 1983. Eukaryotic gene transcription with purified components. Methods Enzymol. 101:582-598[Medline].
20. Dudley, J. P. 1999. Mouse mammary tumor virus, p. 965-972. In R. G. Webster, and A. Granoff (ed.), Encyclopedia of virology. Academic Press Ltd., London, United Kingdom.
21. Dufort, D., and A. Nepveu. 1994. The human cut homeodomain protein represses transcription from the c-myc promoter. Mol. Cell. Biol. 14:4251-4257[Abstract/Free Full Text].
22. Friedman-Einat, M., P. Einat, M. Snyder, and F. Ruddle. 1996. Target gene identification: target specific transcriptional activation by three murine homeodomain/VP16 hybrid proteins in Saccharomyces cerevisiae. J. Exp. Zool. 274:145-156[CrossRef][Medline].
23. Gilead, Z., Y. H. Jeng, W. S. Wold, K. Sugawara, H. M. Rho, M. L. Harter, and M. Green. 1976. Immunological identification of two adenovirus 2-induced early proteins possibly involved in cell transformation. Nature 264:263-266[CrossRef][Medline].
24. Golovkina, T. V., A. Chervonsky, J. P. Dudley, and S. R. Ross. 1992. Transgenic mouse mammary tumor virus superantigen expression prevents viral infection. Cell 69:637-645[CrossRef][Medline].
25. Golovkina, T. V., A. B. Jaffe, and S. R. Ross. 1994. Coexpression of exogenous and endogenous mouse mammary tumor virus RNA in vivo results in viral recombination and broadens the virus host range. J. Virol. 68:5019-5026[Abstract/Free Full Text].
26. Guazzi, S., M. L. Pintonello, A. Vigano, and E. Boncinelli. 1998. Regulatory interactions between the human HOXB1, HOXB2, and HOXB3 proteins and the upstream sequence of the Otx2 gene in embryonal carcinoma cells. J. Biol. Chem. 273:11092-11099[Abstract/Free Full Text].
27. Harada, R., G. Berube, O. J. Tamplin, C. Denis-Larose, and A. Nepveu. 1995. DNA-binding specificity of the cut repeats from the human cut-like protein. Mol. Cell. Biol. 15:129-140[Abstract].
28. Haraguchi, S., R. A. Good, R. W. Engelman, S. Greene, and N. K. Day. 1997. Prolactin, epidermal growth factor or transforming growth factor-alpha activate a mammary cell-specific enhancer in mouse mammary tumor virus-long terminal repeat. Mol. Cell. Endocrinol. 129:145-155[CrossRef][Medline].
29. Held, W., G. A. Waanders, A. N. Shakhov, L. Scarpellino, H. Acha-Orbea, and H. R. MacDonald. 1993. Superantigen-induced immune stimulation amplifies mouse mammary tumor virus infection and allows virus transmission. Cell 74:529-540[CrossRef][Medline].
30. Herrscher, R. F., M. H. Kaplan, D. L. Lelsz, C. Das, R. Scheuermann, and P. W. Tucker. 1995. The immunoglobulin heavy-chain matrix-associating regions are bound by Bright: a B cell-specific trans-activator that describes a new DNA-binding protein family. Genes Dev. 9:3067-3082[Abstract/Free Full Text].
31. Higgy, N. A., H. A. Tarnasky, I. Valarche, A. Nepveu, and F. A. van der Hoorn. 1997. Cux/CDP homeodomain protein binds to an enhancer in the rat c-mos locus and represses its activity. Biochim. Biophys. Acta 1351:313-324[Medline].
32. Hoguchi, R. 1990. Recombinant PCR, p. 177-183. In M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White (ed.), PCR protocols, a guide to methods and applications. Academic Press, Inc., San Diego, Calif.
33. Hsu, C. L., C. Fabritius, and J. Dudley. 1988. Mouse mammary tumor virus proviruses in T-cell lymphomas lack a negative regulatory element in the long terminal repeat. J. Virol. 62:4644-4652[Abstract/Free Full Text].
34. Knepper, J. E., D. Medina, and J. S. Butel. 1986. Differential expression of endogenous mouse mammary tumor virus genes during development of the BALB/c mammary gland. J. Virol. 59:518-521[Abstract/Free Full Text].
35. Lavallie, E. R., J. M. McCoy, D. B. Smith, and P. Riggs. 1994. Enzymatic and chemical cleavage of fusion proteins, p. 16.4.5-16.4.17. In F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology. John Wiley & Sons, Inc., New York, N.Y.
36. Lee, W. T., O. Prakash, D. Klein, and N. H. Sarkar. 1987. Structural alterations in the long terminal repeat of an acquired mouse mammary tumor virus provirus in a T-cell leukemia of DBA/2 mice. Virology 159:39-48[CrossRef][Medline].
37. Lefebvre, P., D. S. Berard, M. G. Cordingley, and G. L. Hager. 1991. Two regions of the mouse mammary tumor virus long terminal repeat regulate the activity of its promoter in mammary cell lines. Mol. Cell. Biol. 11:2529-2537[Abstract/Free Full Text].
38. Li, S., L. Moy, N. Pittman, G. Shue, B. Aufiero, E. J. Neufeld, N. S. LeLeiko, and M. J. Walsh. 1999. Transcriptional repression of the cystic fibrosis transmembrane conductance regulator gene, mediated by CCAAT displacement protein/cut homolog, is associated with histone deacetylation. J. Biol. Chem. 274:7803-7815[Abstract/Free Full Text].
39. Lievens, P. M., J. J. Donady, C. Tufarelli, and E. J. Neufeld. 1995. Repressor activity of CCAAT displacement protein in HL-60 myeloid leukemia cells. J. Biol. Chem. 270:12745-12750[Abstract/Free Full Text].
40. Liu, J., A. Barnett, E. J. Neufeld, and J. P. Dudley. 1999. Homeoproteins CDP and SATB1 interact: potential for tissue-specific regulation. Mol. Cell. Biol. 19:4918-4926[Abstract/Free Full Text].
41. Liu, J., D. Bramblett, Q. Zhu, M. Lozano, R. Kobayashi, S. R. Ross, and J. P. Dudley. 1997. The matrix attachment region-binding protein SATB1 participates in negative regulation of tissue-specific gene expression. Mol. Cell. Biol. 17:5275-5287[Abstract].
42. Luo, W., and D. G. Skalnik. 1996. CCAAT displacement protein competes with multiple transcriptional activators for binding to four sites in the proximal gp91phox promoter. J. Biol. Chem. 271:18203-18210[Abstract/Free Full Text].
43. Mailly, F., G. Berube, R. Harada, P. L. Mao, S. Phillips, and A. Nepveu. 1996. The human cut homeodomain protein can repress gene expression by two distinct mechanisms: active repression and competition for binding site occupancy. Mol. Cell. Biol. 16:5346-5357[Abstract].
44. Majors, J. E., and H. E. Varmus. 1983. Nucleotide sequencing of an apparent proviral copy of env mRNA defines determinants of expression of the mouse mammary tumor virus env gene. J. Virol. 47:495-504[Abstract/Free Full Text].
45. Michalides, R., and E. Wagenaar. 1986. Site-specific rearrangements in the long terminal repeat of extra mouse mammary tumor proviruses in murine T-cell leukemias. Virology 154:76-84[CrossRef][Medline].
46. Mink, S., E. Hartig, P. Jennewein, W. Doppler, and A. C. Cato. 1992. A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor. Mol. Cell. Biol. 12:4906-4918[Abstract/Free Full Text].
47. Mok, E., T. V. Golovkina, and S. R. Ross. 1992. A mouse mammary tumor virus mammary gland enhancer confers tissue-specific but not lactation-dependent expression in transgenic mice. J. Virol. 66:7529-7532[Abstract/Free Full Text].
48. Morley, K. L., M. G. Toohey, and D. O. Peterson. 1987. Transcriptional repression of a hormone-responsive promoter. Nucleic Acids Res. 15:6973-6989[Abstract/Free Full Text].
49. Neufeld, E. J., D. G. Skalnik, P. M. Lievens, and S. H. Orkin. 1992. Human CCAAT displacement protein is homologous to the Drosophila homeoprotein, cut. Nat. Genet. 1:50-55[CrossRef][Medline].
50. Nusse, R. 1990. The int genes in mouse mammary tumorigenesis and in normal development. Ciba Found. Symp. 150:212-222[Medline].
51. Owens, R. B., H. S. Smith, and A. J. Hackett. 1974. Epithelial cell cultures from normal glandular tissue of mice. J. Natl. Cancer Inst. 53:261-269.
52. Payvar, F., G. L. Firestone, S. R. Ross, V. L. Chandler, O. Wrange, D. Carlstedt, J. A. Gustafsson, and K. R. Yamamoto. 1982. Multiple specific binding sites for purified glucocorticoid receptors on mammary tumor virus DNA. J. Cell. Biochem. 19:241-247[CrossRef][Medline].
53. Pfitzner, E., R. Jahne, M. Wissler, E. Stoecklin, and B. Groner. 1998. p300/CREB-binding protein enhances the prolactin-mediated transcriptional induction through direct interaction with the transactivation domain of Stat5, but does not participate in the Stat5-mediated suppression of the glucocorticoid response. Mol. Endocrinol. 12:1582-1593[Abstract/Free Full Text].
54. Qin, W., T. V. Golovkina, T. Peng, I. Nepomnaschy, V. Buggiano, I. Piazzon, and S. R. Ross. 1999. Mammary gland expression of mouse mammary tumor virus is regulated by a novel element in the long terminal repeat. J. Virol. 73:368-376[Abstract/Free Full Text].
55. Ross, S. R., C. L. Hsu, Y. Choi, E. Mok, and J. P. Dudley. 1990. Negative regulation in correct tissue-specific expression of mouse mammary tumor virus in transgenic mice. Mol. Cell. Biol. 10:5822-5829[Abstract/Free Full Text].
56. Scheuermann, R. H., and U. Chen. 1989. A developmental-specific factor binds to suppressor sites flanking the immunoglobulin heavy-chain enhancer. Genes Dev. 3:1255-1266[Abstract/Free Full Text].
57. Skalnik, D. G., E. C. Strauss, and S. H. Orkin. 1991. CCAAT displacement protein as a repressor of the myelomonocytic-specific gp91-phox gene promoter. J. Biol. Chem. 266:16736-16744[Abstract/Free Full Text].
58. Smith, D. B. 1993. Purification of glutathione-S-transferase fusion proteins. Methods Mol. Cell. Biol. 4:220-229.
59. Toohey, M. G., J. W. Lee, M. Huang, and D. O. Peterson. 1990. Functional elements of the steroid hormone-responsive promoter of mouse mammary tumor virus. J. Virol. 64:4477-4488[Abstract/Free Full Text].
60. Tufarelli, C., Y. Fujiwara, D. C. Zappulla, and E. J. Neufeld. 1998. Hair defects and pup loss in mice with targeted deletion of the first cut repeat domain of the Cux/CDP homeoprotein gene. Dev. Biol. 200:69-81[CrossRef][Medline].
61. Valarche, I., J. P. Tissier-Seta, M. R. Hirsch, S. Martinez, C. Goridis, and J. F. Brunet. 1993. The mouse homeodomain protein Phox2 regulates Ncam promoter activity in concert with Cux/CDP and is a putative determinant of neurotransmitter phenotype. Development 119:881-896[Abstract/Free Full Text].
62. van Leeuwen, F., and R. Nusse. 1995. Oncogene activation and oncogene cooperation in MMTV-induced mouse mammary cancer. Semin. Cancer Biol. 6:127-133[CrossRef][Medline].
63. van Wijnen, A. J., C. Cooper, P. Odgren, F. Aziz, A. De Luca, R. A. Shakoori, A. Giordano, P. J. Quesenberry, J. B. Lian, G. S. Stein, and J. L. Stein. 1997. Cell cycle-dependent modifications in activities of pRb-related tumor suppressors and proliferation-specific CDP/cut homeodomain factors in murine hematopoietic progenitor cells. J. Cell. Biochem. 66:512-523[CrossRef][Medline].
64. Wang, Z., A. Goldstein, R.-T. Zong, D. Lin, E. J. Neufeld, R. H. Scheuermann, and P. W. Tucker. 1999. Cux/CDP homeoprotein is a component of NF-µNR and represses the immunoglobulin heavy chain intronic enhancer by antagonizing the Bright transcription activator. Mol. Cell. Biol. 19:284-295[Abstract/Free Full Text].
65. Wolff, J. A., R. W. Malone, P. Williams, W. Chong, G. Acsadi, A. Jani, and P. L. Felgner. 1990. Direct gene transfer into mouse muscle in vivo. Science 247:1465-1468[Abstract/Free Full Text].
66. Xu, L., T. J. Wrona, and J. P. Dudley. 1996. Exogenous mouse mammary tumor virus (MMTV) infection induces endogenous MMTV sag expression. Virology 215:113-123[CrossRef][Medline].
67. Xu, L., T. J. Wrona, and J. P. Dudley. 1997. Strain-specific expression of spliced MMTV RNAs containing the superantigen gene. Virology 236:54-65[CrossRef][Medline].
68. Yanagawa, S.-I., K. Kakimi, H. Tanaka, A. Murakami, Y. Nakagawa, Y. Kubo, Y. Yamada, H. Hiai, K. Kuribayashi, T. Masuda, and A. Ishimoto. 1993. Mouse mammary tumor virus with rearranged long terminal repeats causes murine lymphomas. J. Virol. 67:112-118[Abstract/Free Full Text].
69. Yanagawa, S.-I., H. Tanaka, and A. Ishimoto. 1991. Identification of a novel mammary cell line-specific enhancer element in the long terminal repeat of mouse mammary tumor virus, which interacts with its hormone-responsive element. J. Virol. 65:526-531[Abstract/Free Full Text].
70. Zong, R. T., and R. H. Scheuermann. 1995. Mutually exclusive interaction of a novel matrix attachment region binding protein and the NF-µNR enhancer repressor. Implications for regulation of immunoglobulin heavy chain expression. J. Biol. Chem. 270:24010-24018[Abstract/Free Full Text].


Journal of Virology, July 2000, p. 6348-6357, Vol. 74, No. 14
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Rouault, F., Nejad Asl, S. B., Rungaldier, S., Fuchs, E., Salmons, B., Gunzburg, W. H. (2007). Promoter Complex in the Central Part of the Mouse Mammary Tumor Virus Long Terminal Repeat. J. Virol. 81: 12572-12581 [Abstract] [Full Text]  
  • Mertz, J. A., Kobayashi, R., Dudley, J. P. (2007). ALY Is a Common Coactivator of RUNX1 and c-Myb on the Type B Leukemogenic Virus Enhancer. J. Virol. 81: 3503-3513 [Abstract] [Full Text]  
  • Maitra, U., Seo, J., Lozano, M. M., Dudley, J. P. (2006). Differentiation-Induced Cleavage of Cutl1/CDP Generates a Novel Dominant-Negative Isoform That Regulates Mammary Gene Expression. Mol. Cell. Biol. 26: 7466-7478 [Abstract] [Full Text]  
  • Mertz, J. A., Simper, M. S., Lozano, M. M., Payne, S. M., Dudley, J. P. (2005). Mouse Mammary Tumor Virus Encodes a Self-Regulatory RNA Export Protein and Is a Complex Retrovirus. J. Virol. 79: 14737-14747 [Abstract] [Full Text]  
  • Bhadra, S., Lozano, M. M., Dudley, J. P. (2005). Conversion of Mouse Mammary Tumor Virus to a Lymphomagenic Virus. J. Virol. 79: 12592-12596 [Abstract] [Full Text]  
  • Seo, J., Lozano, M. M., Dudley, J. P. (2005). Nuclear Matrix Binding Regulates SATB1-mediated Transcriptional Repression. J. Biol. Chem. 280: 24600-24609 [Abstract] [Full Text]  
  • Nie, H., Maika, S. D., Tucker, P. W., Gottlieb, P. D. (2005). A Role for SATB1, a Nuclear Matrix Association Region-Binding Protein, in the Development of CD8SP Thymocytes and Peripheral T Lymphocytes. J. Immunol. 174: 4745-4752 [Abstract] [Full Text]  
  • Hronek, B. W., Meagher, A., Rovnak, J., Quackenbush, S. L. (2004). Identification and Characterization of cis-Acting Elements Residing in the Walleye Dermal Sarcoma Virus Promoter. J. Virol. 78: 7590-7601 [Abstract] [Full Text]  
  • Zhu, Q., Maitra, U., Johnston, D., Lozano, M., Dudley, J. P. (2004). The Homeodomain Protein CDP Regulates Mammary-Specific Gene Transcription and Tumorigenesis. Mol. Cell. Biol. 24: 4810-4823 [Abstract] [Full Text]  
  • Chao, S.-H., Harada, J. N., Hyndman, F., Gao, X., Nelson, C. G., Chanda, S. K., Caldwell, J. S. (2004). PDX1, a Cellular Homeoprotein, Binds to and Regulates the Activity of Human Cytomegalovirus Immediate Early Promoter. J. Biol. Chem. 279: 16111-16120 [Abstract] [Full Text]  
  • Aurrekoetxea-Hernandez, K., Buetti, E. (2004). Transforming Growth Factor {beta} Enhances the Glucocorticoid Response of the Mouse Mammary Tumor Virus Promoter through Smad and GA-Binding Proteins. J. Virol. 78: 2201-2211 [Abstract] [Full Text]  
  • Erturk, E., Ostapchuk, P., Wells, S. I., Yang, J., Gregg, K., Nepveu, A., Dudley, J. P., Hearing, P. (2003). Binding of CCAAT Displacement Protein CDP to Adenovirus Packaging Sequences. J. Virol. 77: 6255-6264 [Abstract] [Full Text]  
  • Mustafa, F., Bhadra, S., Johnston, D., Lozano, M., Dudley, J. P. (2003). The Type B Leukemogenic Virus Truncated Superantigen Is Dispensable for T-Cell Lymphomagenesis. J. Virol. 77: 3866-3870 [Abstract] [Full Text]  
  • Zhu, Q., Dudley, J. P. (2002). CDP Binding to Multiple Sites in the Mouse Mammary Tumor Virus Long Terminal Repeat Suppresses Basal and Glucocorticoid-Induced Transcription. J. Virol. 76: 2168-2179 [Abstract] [Full Text]  
  • Mertz, J. A., Mustafa, F., Meyers, S., Dudley, J. P. (2001). Type B Leukemogenic Virus Has a T-Cell-Specific Enhancer That Binds AML-1. J. Virol. 75: 2174-2184 [Abstract] [Full Text]  
  • Snyder, S. R., Wang, J., Waring, J. F., Ginder, G. D. (2001). Identification of CCAAT Displacement Protein (CDP/cut) as a Locus-specific Repressor of Major Histocompatibility Complex Gene Expression in Human Tumor Cells. J. Biol. Chem. 276: 5323-5330 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhu, Q.
Right arrow Articles by Dudley, J. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhu, Q.
Right arrow Articles by Dudley, J. P.