Previous Article | Next Article 
Journal of Virology, July 2000, p. 6348-6357, Vol. 74, No. 14
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
CDP Is a Repressor of Mouse Mammary Tumor Virus
Expression in the Mammary Gland
Quan
Zhu,
Keqin
Gregg,
Mary
Lozano,
Jinqi
Liu, and
Jaquelin P.
Dudley*
Section of Molecular Genetics and
Microbiology and Institute for Cellular and Molecular Biology, The
University of Texas at Austin, Austin, Texas 78705
Received 7 January 2000/Accepted 19 April 2000
 |
ABSTRACT |
Mouse mammary tumor virus (MMTV) transcription is highest in the
lactating mammary gland but is detectable in a variety of other
tissues. Previous results have shown that MMTV expression is suppressed
in lymphoid and other tissues through the binding of the
homeodomain-containing repressor special AT-rich binding protein 1 to a
negative regulatory element (NRE) in the MMTV long terminal repeat
(LTR). Another homeoprotein repressor, CCAAT displacement protein
(CDP), also binds to the MMTV NRE, but a role for CDP in MMTV
transcriptional suppression has not yet been demonstrated. In this
paper, we show that the level of CDP decreases during development of
the mammary gland and that this decline in CDP level correlates with
the known increase in MMTV expression observed during mammary gland
differentiation. Moreover, CDP overexpression was able to suppress MMTV
LTR-reporter gene activity up to 20-fold in transient-transfection
assays of mouse mammary cells. To determine if this effect was due to
direct binding of CDP to the promoter-proximal NRE, we performed DNase
I protection assays to map two CDP-binding sites from +835 to +845 and
+920 to +931 relative to the first base of the LTR. Mutations
engineered into each of these sites decreased CDP binding to the
proximal NRE, whereas a combination of these mutations further reduced
binding. Subsequently, each of these mutations was introduced into the
full-length MMTV LTR upstream of the luciferase reporter gene. Analysis
of stable transfectants of LTR constructs showed that CDP binding site
mutations in the proximal NRE elevated reporter gene expression two- to
sixfold compared to wild-type LTR constructs. Thus, MMTV expression
increases during mammary gland development, in part due to decreased
CDP levels and CDP binding to the LTR. Together, these experiments provide the first evidence that CDP acts as a repressor of MMTV transcription in the mammary gland.
 |
INTRODUCTION |
Mouse mammary tumor virus (MMTV) is
a type B retrovirus that primarily induces mammary carcinomas and, at a
lower frequency, T-cell lymphomas in mice (20, 33). Current
data suggest that MMTV induces mammary tumors by the insertional
activation of nearby cellular oncogenes (18, 50, 62). The
disease specificity of MMTV appears to be linked directly to high viral
expression in specific tissues (68). Milk-borne MMTV is
expressed primarily in the lactating mammary gland (55). The
high level of viral transcription increases MMTV insertions, leading to
cell transformation in mammary tissue. A mutant form of MMTV (type B
leukemogenic virus) that induces T-cell lymphomas shows high-level
expression in T cells (4, 5, 17). Previous work showed that
the tissue-specific expression of the MMTV genome is governed by
regulatory elements located in the long terminal repeat (LTR). These
known elements include a hormone response element (HRE), several
negative regulatory elements (NREs), a mammary gland enhancer, and
NF-1, Oct-1, and TFIID binding sites (13, 14, 46-48, 52,
59).
Virtually all MMTV proviruses acquired in mouse T-cell lymphomas
contain LTR deletions or rearrangements encompassing a 491-bp region
(
655 to
165; +541 to +1031 relative to the first base of the C3H
LTR) (5, 33, 36, 45). These deletions and rearrangements
result in higher levels of MMTV expression in T cells compared to
endogenous wild-type MMTVs (13, 33). Transient and stable
transfection experiments showed that this region contains negative
regulatory elements (NREs) (13, 33). Removal of NREs relieved the suppression of MMTV transcription in normally
semipermissive or nonpermissive tissues. Transgenic mouse experiments
with p1BCAT, a naturally occurring LTR deletion (
655 to
165) mutant
linked to the gene for chloramphenicol acetyltransferase, revealed that this LTR deletion mutation allows high-level viral expression in
semipermissive tissues (e.g., thymus) and lower expression in tissues
that are normally nonpermissive (brain, heart, and skeletal muscle)
(55). Transient-transfection assays with sequential LTR
deletion mutants have defined two NREs, promoter distal and promoter
proximal (see Fig. 1) (13). Gel shift assays with these NREs
detected binding of two major protein complexes identified as CCAAT
displacement protein (CDP) and special AT-rich binding protein 1 (SATB1) (13, 41). A substitution mutation (924) in the
proximal NRE (pNRE) that decreased SATB1 binding increased basal
expression ca. 2.5-fold compared with the wild-type promoter in
transient-transfection assays with LTR-reporter genes. The 924 mutant
LTR showed a more dramatic elevation of reporter gene expression
compared to wild-type LTR expression in the lymphoid tissues of
transgenic mice (41). These data indicated that SATB1 functions as a suppressor of MMTV expression. However, the role of CDP
in MMTV transcriptional control is unknown.
CDP (also known as Clox or Cux) is a homologue of the
Drosophila protein Cut (2, 10, 61), which
functions as a cell fate-determining factor during development
(49). Elimination of Cut activity transforms external
sensory organs into internal chordotonal organs (12), and
ubiquitous Cut expression causes transformation of chordotonal organs
into external sensory organs (11). When overexpressed in
tissue culture cells, CDP was capable of repressing target gene
expression (43). Moreover, CDP-like binding activity was
strongly induced in committed, differentiating B cells, keratinocytes,
myeloid cells, chondroblasts, and myoblasts but was down-regulated in
the corresponding differentiated cell types (1, 2, 57, 64).
These results suggest that CDP acts as a general repressor of genes
that are expressed in differentiated cells (8).
CDP is a transcription factor that contains three DNA-binding domains,
termed Cut repeats (CR), in addition to the homeodomain (2, 10,
49). Female mice engineered with a specific knockout of the CDP
CR1 domain expressed a truncated CDP protein. These mice could produce
normal offspring but had a high level of pup loss, suggesting that
there was a specific defect in milk composition (60). Such
results imply that CDP participates in cellular gene expression in the
mammary gland. MMTV expression is suppressed in undeveloped mammary
tissue but is activated in the lactating mammary gland (34).
CDP also binds to the MMTV transcriptional control region (40,
41). Therefore, it is possible that CDP functions as a repressor
to suppress MMTV expression in undeveloped breast tissue, and viral
suppression is relieved when mammary cells are fully differentiated.
Here we examined the role of the CDP homeoprotein in the control of
MMTV expression. We have shown that the levels of full-length CDP
decline during mammary gland differentiation, a period when MMTV
transcription increases (25, 55). DNase I mapping
experiments using the MMTV pNRE revealed the presence of two CDP
binding sites. Mutations in either of these sites reduced CDP binding
to pNRE probes, and reporter gene constructs carrying these mutations elevated MMTV expression in transient- and stable-transfection assays.
Our data provide the first evidence that the homeoprotein CDP acts as a
transcriptional repressor in the mammary gland.
 |
MATERIALS AND METHODS |
Cell culture and transfections.
HC11 normal mouse mammary
cells (6) from BALB/c mice were obtained from Jeff Rosen
(Baylor College of Medicine, Houston, Tex.). Cells were grown in RPMI
medium (GIBCO BRL, Gaithersburg, Md.) containing 10% fetal bovine
serum (FBS; Hyclone, Logan, Utah), insulin (Sigma Chemical Co., St.
Louis, Mo.) at 10 µg/ml, epidermal growth factor (GIBCO BRL) at 0.5 µg/ml, and gentamicin (Elkins-Sinn, Inc., Cherry Hill, N.J.) at 40 µg/ml. NMuMG cells (51) were grown in Dulbecco's
high-glucose minimal essential medium (GIBCO BRL) containing 10% FBS,
10 mM HEPES (pH 7.4), insulin at 10 µg/ml, and antibiotics. On the
day prior to transfection, cells were treated with trypsin and replated
in growth medium at approximately 5 × 106/100-mm-diameter plate. Single cells were obtained with
trypsin, growth medium was added, and the cell count was determined.
For transient transfections, cells were pelleted and resuspended to 107/200 µl in medium (lacking FBS) containing 40 µg of
pLC-LUC DNA (13) and 40 µg of DNA with various ratios of a
CDP expression vector (pRc/CMV CDP) (39) or an expression
vector lacking the CDP insert (pcDNA3) (Invitrogen, Carlsbad, Calif.).
To normalize for DNA uptake in transient-transfection assays, 5 µg of
pRSV/lacZ or up to 0.7 µg of pRL-TK (Promega, Madison,
Wis.) was added to all samples in the same transfection. Cells were
transfected by electroporation using a BTX electroporator (BTX, San
Diego, Calif.) at 1,750 µF and 150 V. Each electroporation was plated
into a 100-mm-diameter tissue culture dish and incubated for 48 h
in growth medium prior to preparation of cytoplasmic and/or nuclear extracts. Transfections were normalized for DNA uptake by measurement of
-galactosidase activity (pRSVlacZ) (65) or
Renilla luciferase (pRL-TK) or by hybridization analysis of
nuclear DNA from transfected cells with a probe for firefly luciferase
and quantitation using a PhosphorImager. Assays for firefly and
Renilla luciferase were performed using the Luciferase
Reporter Assay System (Promega).
-Galactosidase activity was
measured using standard methods as described previously
(13). Transfections for each DNA sample were performed in
triplicate and pooled for assays. For stable transfections, 2 × 105 HC11 cells were plated in each well of six-well plates
and incubated overnight until the cells were ca. 50% confluent.
Subsequently, 4 µg of the test plasmid and 1 µg of pcDNA3
containing the geneticin resistance gene in 0.5 ml of RPMI medium
without serum were added to 12 µl of DMRIE-C reagent (GIBCO BRL) in
an equal amount of medium, mixed, and incubated at room temperature for
45 min. The cells were washed with RPMI medium, and then the DNA
solution was incubated with the cells for 7 h at 37°C prior to
the addition of 1 ml of complete RPMI medium with 20% FBS. After
further incubation for 48 h, cells were selected in geneticin
(GIBCO BRL) at 1 mg/ml for 3 weeks. All of the six wells containing ca.
70 colonies each were pooled and assayed for luciferase activity. The
luciferase readings were normalized for DNA uptake in each pool using a
quantitative PCR assay with primers specific for the C3H MMTV LTR (5'
GGCATAGCTCTGCTTTGC 3' and 5' TACTTCTAGGCCTGTGGTCA 3') (66,
67).
Plasmid constructions.
Substitution mutations were
introduced into the MMTV C3H LTR in the pLC-LUC vector by PCR-based
mutagenesis as described by Hoguchi (32) and modified by
Bramblett et al. (13). The naming system used here
corresponds to numbering from the first base of the MMTV LTR as
reported by Majors and Varmus (44). In plasmids that contain
two mutations, e.g., 835/924, the plasmid previously described to
contain the 924 mutation (13) was used as the template to
introduce the second mutation.
Nuclear extract preparation.
Nuclear extracts from cell
lines were prepared essentially as described by Dignam et al.
(19) and modified by Liu et al. (41). Mammary
glands from each of three different developmental stages were obtained
from the pooled tissues of six virgin, five first-pregnancy, and two
lactating mice. Tissues were ground to a fine powder under liquid
nitrogen and then resuspended in 10 ml of hypotonic buffer A (10 mM
HEPES [pH 7.9], 10 mM KCl, 1.5 mM MgCl2, 1 mM EDTA, 10%
glycerol, 2 M sucrose, 1 mM dithiothreitol (DTT), 1.25 mM
phenylmethylsulfonyl fluoride, pepstatin A at 0.5 µg/ml, and a 1×
protease inhibitor cocktail [Sigma; P9599]). Inhibitors were added to
the buffer just prior to use. The samples were incubated on ice for 20 min and then homogenized using 20 to 30 strokes with a glass Dounce
homogenizer pestle A. The supernatant was removed by centrifugation at
21,000 rpm in a Sorvall SS-34 rotor at 4°C for 30 min. The nuclear
pellets were resuspended in 2 ml of high-salt buffer (400 mM KCl, 25 mM
HEPES [pH 7.9], 25% glycerol, 1 mM DTT, and the same protease
inhibitors as in buffer A) and homogenized for 20 strokes with a Dounce
homogenizer pestle B. The nuclear suspension was then incubated on ice
for 1.5 h with stirring and subjected to centrifugation at 21,000 rpm in a Sorvall SS-34 rotor for 30 min at 4°C. The supernatant was
adjusted to 60% ammonium sulfate using a saturated solution in water
and incubated on ice for 2.5 h. The precipitated proteins were
sedimented at 40,000 rpm for 30 min at 4°C using a Beckman SW55Ti
rotor. The pellet was resuspended in 1 ml of buffer D (20 mM HEPES [pH
7.9], 100 mM KCl, 20% glycerol, 2 mM EDTA, 1 mM DTT, 1 mM
phenylmethylsulfonyl fluoride, pepstatin A at 0.5 µg/ml) and dialyzed
thrice against 200 volumes of buffer D for 16 h at 4°C. The
dialysate was subjected to centrifugation at 10,000 × g at 4°C for 15 min to remove precipitates, and the protein
concentration was determined using the Bio-Rad protein assay system
(Bio-Rad Laboratories, Hercules, Calif.). Protein extracts were stored
in aliquots at
80°C.
EMSAs.
Electrophoretic mobility shift assays (EMSAs) were
performed as described by Liu et al. (41). The 22-bp
sequence spanning the imperfect inverted repeat in the pNRE was
multimerized, and four copies of this sequence were cloned in pUC9
(pNRE4) (41). The 120-bp sequence (+812 to +931) or the
110-bp sequence (+822 to +931) spanning the pNRE in the C3H MMTV LTR
was obtained by PCR and cloned into pCRII (Invitrogen, San Diego,
Calif.). Purified plasmid DNAs were digested with EcoRI and
HindIII (pNRE4) or EcoRI (p120 or p110) to
give 5' overhanging ends, and the inserts were isolated on
polyacrylamide gels. Fragments were end labeled with Sequenase (version
2.0; Amersham Pharmacia Biotech, Piscataway, N.J.) for EMSA.
Oligonucleotide probes were also end labeled with Sequenase after
annealing of complementary strands to create 5' overhanging ends. One
microliter (1:10 dilution) of rabbit anti-CDP serum was used for
antibody ablation experiments as described by Liu et al.
(41). Competition and SP1-binding experiments were performed
as described previously (41).
DNase I footprinting assays.
The binding conditions used for
DNase I footprinting experiments were the same as those described for
EMSAs, except that samples contained purified, bacterially expressed
CDP representing the C-terminal two-thirds of the protein (CR2-Cterm)
(39). Full-length CDP is not soluble. Approximately 0.5 ng
(0.5 × 107 cpm/µg) of labeled probe and 15 to 30 µg of purified CDP were combined in a volume of 50 µl. Following
incubation at 4°C, a solution containing 10 mM MgCl2 and
5 mM CaCl2 (50 µl) was added, followed by 2 µl of DNase
I (0.02 U/ml freshly diluted from a stock solution) (GIBCO BRL). The
reaction mixture was incubated at room temperature for 1 min, and then
the reaction was terminated by the addition of 90 µl of 20 mM EDTA
(pH 8.0), 1% sodium dodecyl sulfate (SDS), 0.2 M NaCl, and yeast tRNA
at 150 µg/ml. Samples were then extracted with an equal volume of
phenol-chloroform-isoamyl alcohol (25:24:1) prior to precipitation with
ethanol. Precipitated DNA was resuspended in formamide loading buffer
(80% formamide [Sigma Chemical Co.], 10 mM EDTA, 0.1% xylene cyanol
[Sigma], 0.1% bromophenol blue [Bio-Rad]) and analyzed on 8%
polyacrylamide gels containing 8 M urea. Gels were dried and subjected
to autoradiography.
Antibodies and Western analysis.
Polyclonal rabbit
antibodies against glutathione S-transferase (GST)-SATB1
were kindly provided by Paul Gottlieb (University of Texas at Austin).
Other polyclonal antibodies against GST-SATB1 or GST-CDP (CR2-Cterm)
(39) were prepared by immunization of rabbits in accordance
with the standard procedures of Cocalico Biologicals, Reamstown, Pa.
Antibodies were shown to be specific for CDP or SATB1 as described
previously (40). Western blots were prepared by lysis of
cells in RIPA buffer (25 mM Tris-HCl [pH 7.8], 150 mM NaCl, 2 mM
EDTA, 0.5% NP-40, 0.5% deoxycholate, 0.1% SDS) (23). All
subsequent steps were performed at room temperature. Protein extract
(15 to 20 µg for cell lines and 65 µg of mammary tissues) was
subjected to electrophoresis on 8% polyacrylamide gels containing
0.1% SDS and blotted onto nitrocellulose. The membrane was incubated
with 5% nonfat dry milk in TBST buffer (20 mM Tris-HCl [pH 7.6], 137 mM NaCl, 0.1% Tween 20) for 1 h and then washed three times for 5 min each with TBST buffer. Anti-CDP (1:500 dilution) or anti-actin
(1:150 dilution) (Sigma; A-2066) serum was diluted in TBST buffer
containing 1% nonfat dry milk. The antibody was added to the membrane
for 1 h, and then blots were washed four times with 50 ml of TBST
buffer (for 15 min each time). The membrane then was incubated with
horseradish peroxidase-labeled anti-rabbit antibody (1:8,000 dilution)
for 40 min and washed three times for 15 min each time with TBST
buffer. Binding of the secondary antibody was detected using the ECL
Western Blotting Detection System (Amersham).
Preparation of fusion proteins.
Recombinant GST-CDP fusion
protein was cleaved with thrombin (35) and purified by
standard methods (58) as described by Liu et al.
(40) before use in immunization or DNA-binding protocols.
 |
RESULTS |
CDP DNA-binding activity in the developing mammary gland.
Previous experiments have shown that high levels of MMTV transcription
in the lactating mammary gland result from the action of positive
factors, including those that bind to the HRE and the mammary
gland-specific enhancer in the LTR (28, 37, 46, 47, 55, 69).
However, little is known about negative regulation of MMTV expression
in the mammary gland. We have shown previously that at least two
homeodomain transcription factors, CDP and SATB1, bind strongly to NREs
in the MMTV LTR (13, 41). These experiments have shown that
there is no detectable SATB1 and CDP binding activity for the MMTV NRE
in the lactating mammary gland, whereas CDP, but not SATB1, binding
activity is detectable in all of the mammary gland cell lines tested
(13, 41). Such data suggested that CDP is a suppressor of
MMTV expression in relatively undifferentiated cells (e.g., cultured
cells) derived from the mammary gland (41).
Because MMTV expression increases during mammary gland differentiation
(34), it is possible that some of the increased viral expression corresponds to a decrease in suppression by CDP. Therefore, we examined CDP binding activity to the MMTV NRE in mammary gland extracts at different developmental stages by EMSA. Nuclear extracts from virgin, first-pregnancy, and lactating mouse mammary glands were
incubated with the multimerized 22-bp pNRE probe (probe positions are
shown in Fig. 1) prior to electrophoresis
on nondenaturing polyacrylamide gels. As anticipated from our previous
results (41), lactating mammary gland extracts had
undetectable SATB1 and little or no CDP binding activity for the pNRE
(Fig. 2A, lane 3). However, virgin and
first-pregnancy mouse mammary glands both had detectable DNA-binding
activities (lanes 1 and 2) that were abolished by preincubation of
extracts with anti-CDP serum (lanes 7 and 8), but not with preimmune
serum (lanes 4 and 5). SP1 binding activity was detectable in all
mammary cell extracts (Fig. 2B). Intriguingly, regressing mammary
glands from animals that had finished lactation showed the return of
CDP activity (not shown). These results suggested that the level of CDP
binding of the MMTV LTR was inversely correlated with the
differentiation status of the mammary gland.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 1.
Diagram of the MMTV LTR. The LTR is divided into U3, R,
and U5 regions, and transcription is initiated from the standard MMTV
promoter at the first base of the R region. The promoter-proximal and
promoter-distal NREs and the HRE are shown by boxes with different
types of hatch marks within the U3 region of the LTR. Numbering is
shown from the first base of the LTR (+1). The region encompassing the
largest of the U3 deletions found in thymotropic MMTVs relative to
mammotropic MMTV strains is shown by a box over the LTR. The positions
of probes used in this study are given below the LTR. The number of
bases in each probe also is indicated.
|
|

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 2.
CDP levels and NRE-binding activity decrease during
mammary gland development. (A) CDP binding activity declines during
mammary gland differentiation. Nuclear extracts were obtained from
pooled tissues of virgin (V-MG), first-pregnancy (P-MG), and lactating
(L-MG) BALB/c mice as described in Materials and Methods. Extracts (5 µg) were incubated with no serum (lanes 1 to 3), preimmune rabbit
serum (lanes 4 to 6), or rabbit anti-CDP serum (lanes 7 to 9) prior to
incubation with a labeled tetramer of a 22-bp oligomer in the pNRE (ca.
2.5 fmol). This oligomer spans the 3' CDP binding site of the pNRE
shown in Fig. 1 (pNRE4) (41). Monomers and dimers of the
22-bp oligomer do not show detectable CDP binding using nuclear
extracts (41). A reaction mixture with the probe in the
absence of the extract is shown in lane 10. Samples were analyzed on a
4% nondenaturing polyacrylamide gel. (B) SP1 binding activity in
virgin, pregnant, and lactating mouse mammary gland extracts.
Approximately 260 fmol of probe (plus strand; 5'
GGTGACGGGCGGGCCCGCCCCCCTCC 3') was added to 20 µg of protein
from each extract. Binding reaction mixtures were analyzed on gels as
described for panel A. (C) Western blots of nuclear extracts from
mammary glands at different developmental stages. The mammary gland
extracts used were the same as those used for panels A and B. Approximately 65 µg of each extract was analyzed on an 8%
polyacrylamide gel containing SDS prior to transfer to a nitrocellulose
membrane. The Western blot shown at the top was incubated with anti-CDP
serum, whereas the blot shown at the bottom was developed with
anti-actin serum. Both blots were washed and developed as described in
Materials and Methods. The positions of molecular size markers are
shown to the left.
|
|
To determine if the reduction of CDP-specific DNA-binding activity was
due to a decrease in CDP levels during differentiation,
Western
blotting was performed on extracts derived from virgin,
first-pregnancy, and lactating mouse mammary glands (Fig.
2C).
Surprisingly, CDP was detected at all stages in the mammary glands
examined, although the level in virgin mouse mammary glands appeared
to
be sixfold higher than that in pregnant mouse glands as measured
by
densitometry (compare lanes 1 and 2). In addition, the molecular
mass
of the CDP detected in lactating mouse mammary glands was
approximately
50 kDa less than that observed for CDP in virgin
or pregnant mouse
glands. Although we cannot exclude the possibility
that this is an
artifact of proteolytic degradation during preparation
of extracts, the
same extracts did not show degradation when anti-actin
serum was used
(Fig.
2C, lower panel). Thus, CDP binding activity
for the pNRE
decreases during development of the mammary gland
and this result may
be due, in part, to the appearance of a novel
CDP form. Since the
reduction of CDP binding to the pNRE correlates
with the elevation of
MMTV expression following the onset of lactation
in the mammary gland,
CDP may participate in the control of MMTV
transcription.
Effect of CDP overexpression on transcription from the MMTV
LTR.
The tissue-specific activity of CDP during mammary gland
development suggests a potential role in repression of MMTV
transcription. To confirm this hypothesis, we studied the effect of CDP
overexpression on MMTV LTR-reporter gene expression using
transient-transfection assays of mouse mammary cells. Because all of
the cultured cell lines that we have examined contain endogenous CDP
that might interfere with the assay (our unpublished observations), the
amount of pLC-LUC used in this experiment is critical for our ability to observe effects on CDP overexpression. To determine the optimal amount of pLC-LUC for these experiments, we transfected different amounts of pLC-LUC (20, 40, and 60 µg) into HC11 cells with 30 µg
of the CDP expression vector and 5 µg of pRSVlacZ to
normalize for the efficiency of DNA uptake. The total amount of DNA in
each transfection was kept constant by the inclusion of appropriate amounts of vector lacking CDP sequences. The results showed that CDP
overexpression suppresses reporter gene expression from the MMTV LTR,
and the highest levels of suppression were observed when 40 µg of the
reporter construct was used (data not shown).
To determine the dose dependence of CDP effects on MMTV transcription,
we cotransfected increasing amounts of the CDP expression
vector into
HC11 cells by electroporation using 40 µg of pLC-LUC
and 0.5 µg of
pRL-TK vector as a transfection control. After 48
h of incubation,
cells were harvested and a portion was used for
Western blotting to
determine CDP levels (Fig.
3A). As
expected,
densitometry showed that levels of CDP increased
approximately
50-fold following transfection with the highest levels of
the
CDP vector (compare lanes 1 and 5) whereas the levels of actin
in
the same extracts were relatively constant (Fig.
3A, bottom).
Four
different transfections performed in the same manner were
also analyzed
for reporter gene activity (Fig.
3B). Transfection
of 5 µg of the CDP
vector gave a two- to threefold decrease in
luciferase activity
compared to endogenous levels of CDP found
in HC11 cells transfected
with the empty vector, whereas 30 µg
of the CDP-containing vector
showed over 20-fold suppression of
MMTV LTR activity. These levels of
CDP did not appear to be toxic
to the cells, and the levels of actin
(Fig.
3A, bottom) and luciferase
expression from the
Renilla
control vector were relatively constant
when different amounts of CDP
vector were used for transfection.
Similar results were observed after
CDP overexpression in a second
mouse mammary cell line, NMuMG (Fig.
3C). These experiments showed
that transcription from the MMTV LTR is
suppressed in a dose-dependent
manner by CDP overexpression.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 3.
Overexpression of CDP suppresses MMTV LTR-reporter gene
expression in mammary cells. (A) Western blots showing CDP
overexpression in HC11 mammary cells. HC11 cells were transfected by
electroporation with an MMTV LTR-luciferase reporter gene construct
(pLC-LUC) (40 µg) and various ratios of a CDP expression vector or a
vector control lacking CDP sequences. After 48 h, cytoplasmic
extracts were prepared and divided into two parts. One part of the
extract was used for Western blotting (15 µg for each lane) using
antiserum specific for CDP (top) or actin (bottom). Blots were
developed as described in the legend to Fig. 2. (B) CDP overexpression
suppresses MMTV LTR promoter activity in HC11 cells. The second part of
the extract obtained as described for panel A was used for luciferase
assays, and the results are expressed relative to MMTV LTR activity in
the absence of CDP overexpression. The data shown are averages of three
independent experiments, and transfections were performed in triplicate
for each experiment. Standard deviations from the mean are indicated by
error bars. LUC, luciferase. (C) CDP overexpression suppresses MMTV LTR
promoter activity in NMuMG cells. Other parameters are the same as
those described for panel B.
|
|
Mapping of CDP binding sites in the pNRE.
CDP overexpression
in transient-transfection experiments indicates that CDP represses
expression from the MMTV LTR. This repression may be the result of CDP
binding to NRE sequences upstream of the MMTV promoter or,
alternatively, the repression may be an indirect effect of other CDP
activities. If repression of MMTV LTR-reporter gene expression was due
to direct CDP binding to the pNRE, mutation of CDP binding sites should
alleviate the transcriptional suppression. Our previous experiments
showed that both CDP and SATB1 bound to a 22-bp sequence at the 3' end
of the pNRE (41). However, mutations of this sequence had
little effect on CDP binding in EMSAs with the 120-bp pNRE fragment,
suggesting that there is more than one CDP binding site in the pNRE.
To localize all of the CDP binding sites, we performed a series of
DNase I footprinting assays with bacterially expressed
purified CDP
(
40). Because full-length CDP is insoluble, an
N-terminal
deletion that removed the coiled-coil and CR1 domains
of CDP
(
39) was used for footprinting with an end-labeled 120-bp
fragment from the pNRE (Fig.
1). Using both upper- and lower-strand
probes, we detected two CDP binding sites (Fig.
4). One site was
localized to the 5' end
of the pNRE (+830 to +845) using the upper-strand
probe and from +832
to +843 using the lower-strand probe. A second
site at the 3' end of
the pNRE was localized using the upper-strand
probe (+920 to +931). As
predicted from our previous experiments,
the latter site spanned the 3'
half of the 7-bp inverted repeat
and the 5-bp gap and overlapped a
SATB1-binding site in the pNRE
(
41). In agreement with
previous results, both of the identified
CDP binding regions were AT
rich (
3,
27) and contained the
ATTA sequence typical of
DNA-binding sites for transcription factors
with homeodomains (
22,
26).

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 4.
DNase I footprinting of the pNRE in the MMTV LTR. The
120-bp fragment from the pNRE was end labeled on the lower strand
(lanes 2 to 6) or the upper strand (lanes 7 to 11), and footprinting
was performed as described in Materials and Methods. Lane 1 shows a
Maxam-Gilbert sequencing reaction of the 120-bp fragment. Bacterially
produced CDP (CR2-Cterm) (39) was used in the reaction
mixtures in lanes 2, 3, 7, and 8 (10 µg in lanes 3 and 8 and 15 µg
in lanes 2 and 7 with DNase I at 0.8 U/ml). The amount of DNase I was
titrated in lanes without CDP (lanes 4 and 9, 0.6 U/ml; lanes 5 and 10, 0.4 U/ml; lanes 6 and 11, 0.2 U/ml). Reaction mixtures were analyzed on
an 8% denaturing polyacrylamide gel. The protected regions are shown
to each side of the gel. The numbers in parentheses indicate the
locations of the protected regions relative to the first base of the
C3H MMTV LTR (44). The locations of mutations used in this
study with respect to the DNase I-protected regions are shown below the
wild-type (WT) LTR sequence. The cross-hatch marks indicate that the
entire region between CDP footprints is not shown. The location of the
imperfect inverted repeats at the 3' end of the pNRE is also shown by
arrows. A 3' CDP binding site on the lower strand was not observed.
|
|
CDP binding to mutant sequences in the pNRE.
To confirm the
additional CDP binding site detected by DNase I footprinting, we
synthesized 31-bp oligonucleotides containing the wild-type (822WT) CDP
binding sites at the 5' end of the pNRE starting at position +822. A
mutant oligomer also was synthesized from the same region so that the
ATTATA sequence starting at +835 was changed to GGTACC, thus generating
a KpnI recognition site (Fig. 4). Each oligonucleotide was
labeled and used for EMSAs with nuclear extracts obtained from the
mouse mammary gland cell line HC11 (Fig.
5A). As expected, CDP bound to the
wild-type oligomer in the presence of preimmune rabbit serum (lane 2)
and this binding was abolished in the presence of CDP-specific serum
(lane 3). However, introduction of the 4-bp mutation into the wild-type oligomer (m835) eliminated detectable binding by CDP (lane 4). To
compare the relative affinity of CDP for the 5' and 3' binding sites in
the pNRE, binding of the labeled 5' oligonucleotide (822WT) was
competed with increasing amounts of the unlabeled homologous oligomer
or an oligomer containing the 3' CDP binding site (904WT) (Fig. 5B).
PhosphorImager analysis showed that a 15-fold excess of homologous
competitor was necessary to obtain a twofold reduction in CDP binding,
whereas an approximately 110-fold excess of heterologous competitor was
required to achieve the same amount of competition. This result
indicates that the 5' CDP binding site in the pNRE has a higher
affinity for CDP than does the 3' site.

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 5.
CDP binding site mutations in oligomers containing the
5' or 3' binding sites from the pNRE. Nuclear extracts (7 µg of
protein) from HC11 mammary cells were used in EMSAs prior to analysis
on 4% nondenaturing polyacrylamide gels. (A) EMSA using oligomer
probes with CDP binding site mutations at the 5' end of the pNRE.
Oligomers spanning the wild-type (822WT) or mutant (822m835) 5' CDP
binding site in the pNRE were labeled, and ca. 100 fmol of probe was
incubated with nuclear extract and anti-CDP or preimmune serum, as
indicated, prior to gel analysis. Reaction mixtures without added
protein are shown for the 822WT and 822m835 probes in lanes 5 and 6, respectively. (B) Competition of unlabeled 5' or 3' oligomers for CDP
binding to the labeled 5' oligomer probe. Approximately 105
cpm (ca. 100 fmol) of wild-type 822 double-stranded oligomer (822WT)
(plus strand; 5' GGC AAC AGG TAC ATG ATT ATA TTT ATC TAG GGG 3')
was used in an EMSA with a 10- to 500-fold excess of unlabeled
homologous (lanes 3 to 7) or heterologous (904WT) (lanes 8 to 12)
oligomer (spanning the 5' or 3' CDP-binding site, respectively, in the
pNRE) (plus strand; 5' GGGGCTGGACTAATAGAACATTATTCTGCAA
3').
|
|
Because footprinting assays revealed two CDP binding sites in the pNRE,
it was important to examine the effects of binding
site mutations in
the context of the entire pNRE. If there are
two CDP binding sites in
the pNRE, then mutation of either site
alone will preserve CDP binding
in the EMSA, and thus, CDP binding
will be abolished only when both CDP
binding sites have been disrupted.
Using PCR-based mutagenesis, we
introduced the 835 mutation (m835)
into the 5' CDP binding site within
the wild-type pNRE fragment
of 120 bp (WTp120). We also mutated the CDP
binding site at the
3' end of the pNRE (m916) prior to analysis of both
fragments
by EMSA (Fig.
6A). In agreement
with the data in Fig.
5B, mutation
of the 5' binding site (m835) had a
much greater effect than mutation
of the 3' binding site (m916) on the
ability of CDP to bind to
the pNRE (compare lanes 6 and 7 with lanes 10 and 11). The small
amount of residual binding observed with the m835
probe was due
to CDP, since binding was abolished in the presence of
CDP-specific
serum (lane 12). As expected, combination of mutations at
the
5' end of the pNRE (835, 839a, and 839b) with a mutation at the
3'
end (916) reduced or completely disrupted CDP binding under
these
conditions (lane 14 and data not shown). Thus, these results
confirmed
the presence of two CDP binding sites within the pNRE
and suggested
that mutations in the 5' site have a greater effect
on CDP binding than
mutations in the 3' site.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 6.
Binding of CDP from mammary cells to mutant NREs.
Nuclear extracts from HC11 mammary cells (400 ng) were incubated with
wild-type or mutant pNRE probes (2 × 104 cpm) prior
to analysis on nondenaturing polyacrylamide gels. (A) The wild-type
120-bp fragment or mutant fragments (ca. 2.5 fmol) from the same region
were end labeled and analyzed on gels without nuclear extract (lanes 1, 5, 9, and 13) or with nuclear extracts (all other lanes). In some
cases, reaction mixtures contained preimmune (lanes 3, 7, and 11) or
anti-CDP (lanes 4, 8, and 12) serum. (B) Competition of the labeled
110-bp pNRE (ca. 2.5 fmol) with the wild-type (WT) homologous or
heterologous (m835) fragments from the same region. Competitor DNA was
present in 10- to 200-fold molar excess of labeled DNA. (C) Competition
of the labeled 110-bp pNRE with the unlabeled m924 and m916 fragments
from the same region. (D) Competition of the labeled 110-bp pNRE with
the unlabeled wild-type or double mutant (m835/916) fragments from the
same region. (E) Competition of the labeled 110-bp pNRE with the
unlabeled mutant (m839a) fragment from the same region. (F) Competition
of the labeled 110-bp pNRE with the unlabeled mutant (m839b) or
wild-type fragment from the same region.
|
|
To determine the relative affinities of CDP for mutant pNRE binding
sites, we performed EMSAs with the labeled wild-type pNRE
fragment in
the presence of increasing amounts of unlabeled mutant
fragments from
the same region (locations are shown in Fig.
4).
Based on quantitation
by PhosphorImager analysis, mutations in
the 3' binding site (m924 and
m916) had relatively minor effects
on CDP binding to the pNRE, whereas
mutations in the 5' binding
site (m835 and m839a) had a more dramatic
effect, as expected
(Fig.
6B to F). However, a fragment containing both
5' and 3'
binding site mutations (m835/916) was the poorest competitor
for
CDP binding to the pNRE (Fig.
6D). Because the double mutant showed
some competition for CDP binding to the wild-type NRE, this mutant
may
retain residual CDP binding activity for the NRE that is not
detectable
in direct binding
assays.
Effects of CDP binding site mutations on MMTV promoter activity in
transfection assays.
If CDP suppression of MMTV expression is due
to CDP binding to the MMTV promoter, then CDP binding site mutations
should elevate viral gene expression. To test this hypothesis, we
inserted the CDP binding site mutations described above into the pNRE
of the MMTV C3H LTR-luciferase construct (LC-LUC). The resulting
constructs were tested for reporter gene activity in
transient-transfection assays with HC11 cells (Fig.
7).

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 7.
Transient-transfection analysis of MMTV LTR-reporter
gene constructs with pNRE mutations. HC11 cells were transfected by
electroporation with the C3H MMTV LTR-luciferase (LUC) plasmid
(pLC-LUC) or mutant plasmids (40 µg), the pcDNA3 vector with or
without CDP sequences (20 µg), and 0.7 µg of pRL-TK. Transfections
were performed in triplicate with HC11 cells. Because of the large
number of samples tested, mutants were tested in separate experiments
(shown as panels A and B). After normalization for DNA uptake, results
are reported relative to the average of three transfections of pLC-LUC
with the pcDNA3 control vector (assigned a value of 100). The error
bars show standard deviations from the mean. Results were analyzed by
the one-tailed Student t test. Analysis showed that values
from m835, 835/916, and 839a were significantly different than those
from wild-type pLC-LUC (P = <0.05), whereas m916
values were marginally different (P = 0.06). As
expected, m924 results were not significantly different than those from
the wild-type plasmid (P = 0.18).
|
|
Each construct was coelectroporated with a CDP overexpression plasmid,
and reporter gene expression was compared to that of
the same construct
electroporated with a control vector (Fig.
7A and B). After
normalization for DNA uptake, these experiments
showed that mutations
in the 5' or 3' CDP binding site of the
pNRE elevated luciferase
expression two- to fourfold without CDP
overexpression, compared to the
wild-type construct. Thus, mutations
that affected CDP binding to the
pNRE also relieved CDP-mediated
LTR suppression, although differences
between the activity of
the 916 mutant and that of the wild-type LTR
were marginally significant
(
P = 0.06). A combination
of 5' and 3' binding site mutations
(m835/916) showed approximately the
same effect on MMTV LTR repression
as the single-site mutations alone.
However, in most cases, the
effect of CDP binding site mutations was
diminished by CDP overexpression
(see
Discussion).
Because CDP is a matrix-associated region-binding protein (
7,
15,
41,
64), complete chromatin structure may be important
for
maximum effects on repressor function. Therefore, analysis
of CDP
binding site mutants in stable-transfection assays allowed
us to
analyze integrated templates and to ensure that the majority
of cells
contained the reporter construct. Each of the constructs
was
cotransfected with a selectable marker plasmid into six independent
cultures of HC11 cells using a lipid-mediated method (DMRIE-C).
The six
cultures containing the same plasmid were harvested, pooled,
and
assayed for luciferase activity; the luciferase activity then
was
normalized for DNA content using a quantitative PCR method.
The results
showed that mutation of the 5' CDP binding site in
the pNRE (m835) gave
approximately sixfold (600%) elevation of
luciferase activity from the
MMTV LTR compared to transfectants
containing wild-type LTR-luciferase
constructs (Fig.
8). Two or
four base
pair changes at position +839 also increased luciferase
activity four-
or sixfold, respectively, compared to the wild-type
construct, whereas
a mutation at +924 that changed 3 bp of the
3' binding site in the pNRE
(and had little effect on CDP DNA
binding) had little effect on
luciferase expression. Mutation
of both the 5' and 3' CDP binding sites
(m835/916) in LTR-reporter
gene constructs gave a similar (5-fold)
elevation of luciferase
activity, compared to wild-type constructs, as
constructs with
mutations in the 5' site alone. Therefore, results from
transient-
and stable-transfection assays suggested that a single
mutation
in the pNRE is sufficient to alter transcriptional suppression
by CDP.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 8.
Stable transfections of MMTV LTR-reporter gene
constructs with pNRE mutations. Transfections were performed as
described in Materials and Methods using DMRIE-C reagent. Pooled
colonies obtained for each plasmid construct were assayed for
luciferase (LUC) activity, and the results were normalized for the
amount of transfected DNA. Results for mutants are reported relative to
those obtained with wild-type C3H MMTV LTR constructs in the same assay
(assigned a value of 100).
|
|
 |
DISCUSSION |
A specific role for CDP in the developing mammary gland.
Studies of CDP levels in the differentiating mammary gland showed that
CDP levels declined during development of the mammary gland and that
there was an apparent decrease in the molecular mass of CDP that
accompanied lactation. The changes in CDP expression following mammary
gland differentiation were accompanied by loss of CDP binding activity
for the pNRE in the MMTV LTR (Fig. 2). Because it is known that MMTV
expression is highest in the lactating mammary gland (34),
there is an inverse correlation between the presence of CDP binding
activity for the NRE and the level of MMTV expression. Stable
transfections showed that CDP binding site mutations relieved
transcriptional suppression two- to sixfold. Together, these results
provide the first evidence that CDP is a negative regulator of MMTV
expression in the mammary gland and suggest that CDP is an important
regulator of mammary gland-specific transcription.
Although CDP binding site mutations were able to relieve suppression of
the MMTV LTR-reporter gene up to sixfold in stable-transfection
assays
(Fig.
8), these same binding site mutations had a more
modest effect in
transient-transfection assays either with or
without CDP overexpression
(Fig.
7). There are several possible
explanations for this. (i) We have
mapped at least six CDP binding
sites within the MMTV NRE, and there is
at least one other potential
site in the 5' portion of the LTR
(TFSEARCH, version 1.3, Y. Akiyama,
Kyoto University). Therefore, we
believe that mutation of one
or two sites is unlikely to completely
relieve suppression by
CDP. (ii) We have shown that most of the
mutations do not completely
eliminate CDP binding to the target site.
Even in mutants that
had two binding site alterations, residual
competition was observed
for CDP binding to wild-type sites. In
addition, overexpression
of CDP will maximize CDP binding to
low-affinity mutant sites,
thus minimizing the effect of the mutation
in reporter assays.
(iii) CDP has been reported to repress
transcription of genes
by blocking the binding of activator proteins
(
43). Thus, our
CDP binding site mutations also may have
affected the binding
of transcriptional activator proteins, so that the
overall reporter
gene expression in the absence of CDP binding will not
achieve
levels observed without CDP overexpression. Any or all of these
factors may contribute to the modest effect of two CDP binding
site
mutations in the transient
transfections.
MMTV is known to replicate in B- and T-lymphoid cells during the
transmission of virus from mother's milk in the newborn murine
gut to
target epithelial cells in the mammary gland (
9,
24,
29). We
have shown previously that MMTV expression is repressed
by the
homeodomain protein SATB1, and we have proposed that SATB1
restricts
MMTV expression in many tissues other than the mammary
gland,
particularly T cells (
40,
41). Our studies also have
shown
that SATB1 binding activity for the MMTV NREs is absent
in mammary
gland tissue, as well as in cultured mammary cell lines
(
13,
41). Thus, it appears that negative regulation of MMTV
expression
is different in differentiated mammary gland tissue
than in T cells.
Our experiments suggest that a decrease in CDP
molecular mass may cause
loss of CDP DNA-binding activity in the
lactating mammary gland. This
may represent a novel posttranscriptional
mechanism, such as
alternative splicing or protein processing,
for control of CDP-mediated
repression. Recent experiments with
other viruses, such as human
papillomavirus (HPV), suggest that
loss of CDP binding to HPV early
promoters correlates with cellular
differentiation and high virus
expression (
1). Thus, loss of
negative regulatory proteins
during mammary gland differentiation
combined with the action of
positive factors, such as hormone-activated
steroid receptors and Stat
factors (
53,
54), leads to high
MMTV expression in the
lactating mammary
gland.
Mice lacking expression of the full-length CDP have been reported
(
60). These mice express a truncated form of CDP that
lacks
the CR1 domain (

CR1).

CR1 mice are phenotypically normal
in many
respects but show curly vibrissae, wavy hair, and a high
degree of pup
loss from mothers carrying the mutation (
60).
Although the
specific defect is unknown, the authors propose that

CR1 mice have a
defect in some component of milk. These results
suggest that CDP is
important for expression of certain cellular
genes in the mammary
gland.
CDP binds to multiple sites in the proximal MMTV NRE.
Previous
experiments showed that a high-molecular-weight complex, UBP, bound to
the promoter-proximal and promoter-distal NREs in the MMTV LTR
(13), and more recent results demonstrated that the UBP
complex contained the transcriptional suppressor CDP (41).
One of the CDP-binding sites was localized to a 22-bp oligonucleotide
in the pNRE that overlapped an imperfect inverted repeat containing a
binding site for homeodomain protein SATB1 (41). Using DNase
I protection assays, we confirmed that there was a CDP binding site
localized between +920 and +931, and we identified a second site at
+830 to +845 (Fig. 4). As expected, mutations in either of these sites
reduced CDP binding to the 120-bp pNRE in gel shift assays (Fig. 5).
Mutations in both binding sites abolished or further reduced binding,
as measured in gel shift assays, suggesting that CDP interactions with
the MMTV NRE are additive.
Previous experiments using the gene for the cytochrome
b
heavy-chain component (gp91) of the phagocyte NADPH-oxidase
(
phox)
have shown that CDP has at least four different
binding sites
upstream of the gp91-
phox promoter
(
42). Moreover, there appear
to be multiple CDP binding
sites in the HPV long control region
(
1), as well as in the
matrix-associated region of the immunoglobulin
heavy-chain intronic
enhancer (
64,
70). Results obtained with
the
gp91-
phox promoter suggested that the promoter-proximal CDP
binding site has the highest affinity for CDP and that the affinity
for
CDP decreases with the distance from the promoter (
42).
However, this may not be generally true for CDP-mediated repression
since the most promoter-proximal CDP binding site in the MMTV
pNRE
appeared to have a lower affinity for CDP than the 5' site
(Fig.
5).
EMSAs using oligonucleotides spanning the 5' or 3' CDP
binding sites in
the pNRE and extracts from mammary cells showed
CDP binding to the 5'
site but no detectable binding to the 3'
site (data not shown).
Nevertheless, purified CDP fragments containing
CR2-Cterm showed very
similar binding to both the 5' and 3' sites
in the pNRE, suggesting
that the full-length CDP found in nuclear
extracts can discriminate
between the two
sites.
CDP has four different DNA-binding domains, and each of these domains
has a different specificity for DNA, although the CR2
and CR3 domains
appear to have the most similar DNA-binding properties
(
3,
27). Thus, the presence of CR1 in the full-length protein
may
decrease its affinity for the 3' site or increase its affinity
for the
5' site in the pNRE. Alternatively, differences in the
abilities of the
native and bacterial proteins to bind to the
3' site in the pNRE may
result from the ability of native CDP
to dimerize with certain proteins
due to the coiled-coil domain
within the N-terminal region; the
coiled-coil is missing in the
bacterially expressed proteins. CDP has
been shown to interact
with a number of proteins in vivo, including
SATB1, histone deacetylase
1 (HDAC1), and Rb (
38,
40,
63),
and SATB1 has been shown
to interact with three of the four CDP
DNA-binding domains (CR1,
CR2, and the homeodomain) (
40).
Together, these observations
argue that cooperative interactions
between different CDP DNA-binding
domains and between different CDP
molecules bound to adjacent
DNA-binding sites may be important for
promoter recognition in
vivo. The ability of CDP to bind to the
promoters and enhancers
of a large number of genes, including those for
c-
mos,

-globin,
Ncam, histones, gp91-
phox, HPV
E1, E6, and E7, c-
myc, the immunoglobulin
heavy and light
chains, TCR

, and CD8

, MMTV, and the cystic fibrosis
transmembrane
conductance regulatory gene (
1,
7,
8,
15,
16,
21,
31,
38,
41,
57,
61,
64), may depend upon
the presence of multiple DNA-binding
domains with different DNA-binding
and protein interaction
specificities.
Mechanism of CDP transcriptional suppression.
Experiments by
Mailly et al. (43) have indicated that CDP represses
transcription by competition for DNA binding by positive regulators, as
well as by active repression, perhaps mediated by chromatin
reorganization (38). It is likely that
transient-transfection assays measure competition for transcription
factor binding to DNA but not chromatin reorganization. Both transient-
and stable-transfection assays for MMTV promoter function were affected
by CDP binding site mutations, probably because CDP binding to DNA is a
requirement for both types of repression.
CDP is known to have multiple binding sites in the promoters or
enhancers of other genes, such as the immunoglobulin heavy-chain
intronic enhancer or the gp91-
phox promoter (
42,
70), where
CDP binding sites are thought to overlap binding sites
for transcriptional
activator proteins (
57,
64). Because CDP
has a stronger affinity
for these sites than the activator protein,
binding of CDP prevents
binding of the activator, thus leading to
repression of gene expression.
Although most of these activators are
not known, recent results
suggest that immunoglobulin heavy-chain
transcription may be,
in part, restricted to B cells through the
binding of B-cell-specific
activators, such as Bright (
30),
that accompany the decreasing
levels of CDP repressor present during
B-cell differentiation
(
56). The identities of activators
that bind to MMTV LTR sites
occupied by CDP during mammary gland
differentiation are unknown.
However, it is an attractive possibility
that CDP binding sites
could be used to isolate proteins that activate
transcription
following the loss of CDP binding activity that
accompanies differentiation
of the mammary gland. Because the loss of
CDP occurs in a number
of differentiating cell types (
1,
56,
57), this strategy
also may be applicable to the isolation of
transcriptional activators
in other
tissues.
 |
ACKNOWLEDGMENTS |
We acknowledge Susan Ross, Paul Gottlieb, and members of the
Dudley laboratory for careful review of the manuscript.
This work was supported by grant R01CA34780 from the National
Institutes of Health.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Section of
Molecular Genetics and Microbiology, 100 W. 24th St., The University of Texas at Austin, Austin, TX 78705. Phone: (512) 471-8415. Fax: (512)
471-7088. E-mail: jdudley{at}uts.cc.utexas.edu.
 |
REFERENCES |
| 1.
|
Ai, W.,
E. Toussaint, and A. Roman.
1999.
CCAAT displacement protein binds to and negatively regulates human papillomavirus type 6 E6, E7, and E1 promoters.
J. Virol.
73:4220-4229[Abstract/Free Full Text].
|
| 2.
|
Andres, V.,
B. Nadal-Ginard, and V. Mahdavi.
1992.
Clox, a mammalian homeobox gene related to Drosophila cut, encodes DNA-binding regulatory proteins differentially expressed during development.
Development
116:321-334[Medline].
|
| 3.
|
Aufiero, B.,
E. J. Neufeld, and S. H. Orkin.
1994.
Sequence-specific DNA binding of individual cut repeats of the human CCAAT displacement/cut homeodomain protein.
Proc. Natl. Acad. Sci. USA
91:7757-7761[Abstract/Free Full Text].
|
| 4.
|
Ball, J. K.,
L. O. Arthur, and G. A. Dekaban.
1985.
The involvement of a type-B retrovirus in the induction of thymic lymphomas.
Virology
140:159-172[CrossRef][Medline].
|
| 5.
|
Ball, J. K.,
H. Diggelmann,
G. A. Dekaban,
G. F. Grossi,
R. Semmler,
P. A. Waight, and R. F. Fletcher.
1988.
Alterations in the U3 region of the long terminal repeat of an infectious thymotropic type B retrovirus.
J. Virol.
62:2985-2993[Abstract/Free Full Text].
|
| 6.
|
Ball, R. K.,
R. R. Friis,
C. A. Schoenenberger,
W. Doppler, and B. Groner.
1988.
Prolactin regulation of -casein gene expression and of a cytosolic 120-kd protein in a cloned mouse mammary epithelial cell line.
EMBO J.
7:2089-2095[Medline].
|
| 7.
|
Banan, M.,
I. C. Rojas,
W. H. Lee,
H. L. King,
J. V. Harriss,
R. Kobayashi,
C. F. Webb, and P. D. Gottlieb.
1997.
Interaction of the nuclear matrix-associated region (MAR)-binding proteins, SATB1 and CDP/Cux, with a MAR element (L2a) in an upstream regulatory region of the mouse CD8 gene.
J. Biol. Chem.
272:18440-18452[Abstract/Free Full Text].
|
| 8.
|
Barberis, A.,
G. Superti-Furga, and M. Busslinger.
1987.
Mutually exclusive interaction of the CCAAT-binding factor and of a displacement protein with overlapping sequences of a histone gene promoter.
Cell
50:347-359[CrossRef][Medline].
|
| 9.
|
Beutner, U.,
E. Kraus,
D. Kitamura,
K. Rajewsky, and B. T. Huber.
1994.
B cells are essential for murine mammary tumor virus transmission, but not for presentation of endogenous superantigens.
J. Exp. Med.
179:1457-1466[Abstract/Free Full Text].
|
| 10.
|
Blochlinger, K.,
R. Bodmer,
J. Jack,
L. Y. Jan, and Y. N. Jan.
1988.
Primary structure and expression of a product from cut, a locus involved in specifying sensory organ identity in Drosophila.
Nature
333:629-635[CrossRef][Medline].
|
| 11.
|
Blochlinger, K.,
L. Y. Jan, and Y. N. Jan.
1991.
Transformation of sensory organ identity by ectopic expression of Cut in Drosophila.
Genes Dev.
5:1124-1135[Abstract/Free Full Text].
|
| 12.
|
Bodmer, R.,
S. Barbel,
S. Sheperd,
J. W. Jack,
L. Y. Jan, and Y. N. Jan.
1987.
Transformation of sensory organs by mutations of the cut locus of D. melanogaster.
Cell
51:293-307[CrossRef][Medline].
|
| 13.
|
Bramblett, D.,
C. L. Hsu,
M. Lozano,
K. Earnest,
C. Fabritius, and J. Dudley.
1995.
A redundant nuclear protein binding site contributes to negative regulation of the mouse mammary tumor virus long terminal repeat.
J. Virol.
69:7868-7876[Abstract].
|
| 14.
|
Bruggemeier, U.,
M. Kalff,
S. Franke,
C. Scheidereit, and Beato.
1991.
Ubiquitous transcription factor OTF-1 mediates induction of the MMTV promoter through synergistic interaction with hormone receptors.
Cell
64:565-572[CrossRef][Medline].
|
| 15.
|
Chattopadhyay, S.,
C. E. Whitehurst, and J. Chen.
1998.
A nuclear matrix attachment region upstream of the T cell receptor gene enhancer binds Cux/CDP and SATB1 and modulates enhancer-dependent reporter gene expression but not endogenous gene expression.
J. Biol. Chem.
273:29838-29846[Abstract/Free Full Text].
|
| 16.
|
Cunningham, J. M.,
M. E. Purucker,
S. M. Jane,
B. Safer,
E. F. Vanin,
P. A. Ney,
C. H. Lowrey, and A. W. Nienhuis.
1994.
The regulatory element 3' to the A -globin gene binds to the nuclear matrix and interacts with special A-T-rich binding protein 1 (SATB1), an SAR/MAR-associating region DNA binding protein.
Blood
84:1298-1308[Abstract/Free Full Text].
|
| 17.
|
Dekaban, G. A., and J. K. Ball.
1984.
Integration of type B retroviral DNA in virus-induced primary murine thymic lymphomas.
J. Virol.
52:784-792[Abstract/Free Full Text].
|
| 18.
|
Dickson, C.,
R. Smith,
S. Brookes, and G. Peters.
1990.
Proviral insertions within the int-2 gene can generate multiple anomalous transcripts but leave the protein-coding domain intact.
J. Virol.
64:784-793[Abstract/Free Full Text].
|
| 19.
|
Dignam, J. D.,
P. L. Martin,
B. S. Shastry, and R. G. Roeder.
1983.
Eukaryotic gene transcription with purified components.
Methods Enzymol.
101:582-598[Medline].
|
| 20.
|
Dudley, J. P.
1999.
Mouse mammary tumor virus, p. 965-972.
In
R. G. Webster, and A. Granoff (ed.), Encyclopedia of virology. Academic Press Ltd., London, United Kingdom.
|
| 21.
|
Dufort, D., and A. Nepveu.
1994.
The human cut homeodomain protein represses transcription from the c-myc promoter.
Mol. Cell. Biol.
14:4251-4257[Abstract/Free Full Text].
|
| 22.
|
Friedman-Einat, M.,
P. Einat,
M. Snyder, and F. Ruddle.
1996.
Target gene identification: target specific transcriptional activation by three murine homeodomain/VP16 hybrid proteins in Saccharomyces cerevisiae.
J. Exp. Zool.
274:145-156[CrossRef][Medline].
|
| 23.
|
Gilead, Z.,
Y. H. Jeng,
W. S. Wold,
K. Sugawara,
H. M. Rho,
M. L. Harter, and M. Green.
1976.
Immunological identification of two adenovirus 2-induced early proteins possibly involved in cell transformation.
Nature
264:263-266[CrossRef][Medline].
|
| 24.
|
Golovkina, T. V.,
A. Chervonsky,
J. P. Dudley, and S. R. Ross.
1992.
Transgenic mouse mammary tumor virus superantigen expression prevents viral infection.
Cell
69:637-645[CrossRef][Medline].
|
| 25.
|
Golovkina, T. V.,
A. B. Jaffe, and S. R. Ross.
1994.
Coexpression of exogenous and endogenous mouse mammary tumor virus RNA in vivo results in viral recombination and broadens the virus host range.
J. Virol.
68:5019-5026[Abstract/Free Full Text].
|
| 26.
|
Guazzi, S.,
M. L. Pintonello,
A. Vigano, and E. Boncinelli.
1998.
Regulatory interactions between the human HOXB1, HOXB2, and HOXB3 proteins and the upstream sequence of the Otx2 gene in embryonal carcinoma cells.
J. Biol. Chem.
273:11092-11099[Abstract/Free Full Text].
|
| 27.
|
Harada, R.,
G. Berube,
O. J. Tamplin,
C. Denis-Larose, and A. Nepveu.
1995.
DNA-binding specificity of the cut repeats from the human cut-like protein.
Mol. Cell. Biol.
15:129-140[Abstract].
|
| 28.
|
Haraguchi, S.,
R. A. Good,
R. W. Engelman,
S. Greene, and N. K. Day.
1997.
Prolactin, epidermal growth factor or transforming growth factor- activate a mammary cell-specific enhancer in mouse mammary tumor virus-long terminal repeat.
Mol. Cell. Endocrinol.
129:145-155[CrossRef][Medline].
|
| 29.
|
Held, W.,
G. A. Waanders,
A. N. Shakhov,
L. Scarpellino,
H. Acha-Orbea, and H. R. MacDonald.
1993.
Superantigen-induced immune stimulation amplifies mouse mammary tumor virus infection and allows virus transmission.
Cell
74:529-540[CrossRef][Medline].
|
| 30.
|
Herrscher, R. F.,
M. H. Kaplan,
D. L. Lelsz,
C. Das,
R. Scheuermann, and P. W. Tucker.
1995.
The immunoglobulin heavy-chain matrix-associating regions are bound by Bright: a B cell-specific trans-activator that describes a new DNA-binding protein family.
Genes Dev.
9:3067-3082[Abstract/Free Full Text].
|
| 31.
|
Higgy, N. A.,
H. A. Tarnasky,
I. Valarche,
A. Nepveu, and F. A. van der Hoorn.
1997.
Cux/CDP homeodomain protein binds to an enhancer in the rat c-mos locus and represses its activity.
Biochim. Biophys. Acta
1351:313-324[Medline].
|
| 32.
|
Hoguchi, R.
1990.
Recombinant PCR, p. 177-183.
In
M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White (ed.), PCR protocols, a guide to methods and applications. Academic Press, Inc., San Diego, Calif.
|
| 33.
|
Hsu, C. L.,
C. Fabritius, and J. Dudley.
1988.
Mouse mammary tumor virus proviruses in T-cell lymphomas lack a negative regulatory element in the long terminal repeat.
J. Virol.
62:4644-4652[Abstract/Free Full Text].
|
| 34.
|
Knepper, J. E.,
D. Medina, and J. S. Butel.
1986.
Differential expression of endogenous mouse mammary tumor virus genes during development of the BALB/c mammary gland.
J. Virol.
59:518-521[Abstract/Free Full Text].
|
| 35.
|
Lavallie, E. R.,
J. M. McCoy,
D. B. Smith, and P. Riggs.
1994.
Enzymatic and chemical cleavage of fusion proteins, p. 16.4.5-16.4.17.
In
F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology. John Wiley & Sons, Inc., New York, N.Y.
|
| 36.
|
Lee, W. T.,
O. Prakash,
D. Klein, and N. H. Sarkar.
1987.
Structural alterations in the long terminal repeat of an acquired mouse mammary tumor virus provirus in a T-cell leukemia of DBA/2 mice.
Virology
159:39-48[CrossRef][Medline].
|
| 37.
|
Lefebvre, P.,
D. S. Berard,
M. G. Cordingley, and G. L. Hager.
1991.
Two regions of the mouse mammary tumor virus long terminal repeat regulate the activity of its promoter in mammary cell lines.
Mol. Cell. Biol.
11:2529-2537[Abstract/Free Full Text].
|
| 38.
|
Li, S.,
L. Moy,
N. Pittman,
G. Shue,
B. Aufiero,
E. J. Neufeld,
N. S. LeLeiko, and M. J. Walsh.
1999.
Transcriptional repression of the cystic fibrosis transmembrane conductance regulator gene, mediated by CCAAT displacement protein/cut homolog, is associated with histone deacetylation.
J. Biol. Chem.
274:7803-7815[Abstract/Free Full Text].
|
| 39.
|
Lievens, P. M.,
J. J. Donady,
C. Tufarelli, and E. J. Neufeld.
1995.
Repressor activity of CCAAT displacement protein in HL-60 myeloid leukemia cells.
J. Biol. Chem.
270:12745-12750[Abstract/Free Full Text].
|
| 40.
|
Liu, J.,
A. Barnett,
E. J. Neufeld, and J. P. Dudley.
1999.
Homeoproteins CDP and SATB1 interact: potential for tissue-specific regulation.
Mol. Cell. Biol.
19:4918-4926[Abstract/Free Full Text].
|
| 41.
|
Liu, J.,
D. Bramblett,
Q. Zhu,
M. Lozano,
R. Kobayashi,
S. R. Ross, and J. P. Dudley.
1997.
The matrix attachment region-binding protein SATB1 participates in negative regulation of tissue-specific gene expression.
Mol. Cell. Biol.
17:5275-5287[Abstract].
|
| 42.
|
Luo, W., and D. G. Skalnik.
1996.
CCAAT displacement protein competes with multiple transcriptional activators for binding to four sites in the proximal gp91phox promoter.
J. Biol. Chem.
271:18203-18210[Abstract/Free Full Text].
|
| 43.
|
Mailly, F.,
G. Berube,
R. Harada,
P. L. Mao,
S. Phillips, and A. Nepveu.
1996.
The human cut homeodomain protein can repress gene expression by two distinct mechanisms: active repression and competition for binding site occupancy.
Mol. Cell. Biol.
16:5346-5357[Abstract].
|
| 44.
|
Majors, J. E., and H. E. Varmus.
1983.
Nucleotide sequencing of an apparent proviral copy of env mRNA defines determinants of expression of the mouse mammary tumor virus env gene.
J. Virol.
47:495-504[Abstract/Free Full Text].
|
| 45.
|
Michalides, R., and E. Wagenaar.
1986.
Site-specific rearrangements in the long terminal repeat of extra mouse mammary tumor proviruses in murine T-cell leukemias.
Virology
154:76-84[CrossRef][Medline].
|
| 46.
|
Mink, S.,
E. Hartig,
P. Jennewein,
W. Doppler, and A. C. Cato.
1992.
A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.
Mol. Cell. Biol.
12:4906-4918[Abstract/Free Full Text].
|
| 47.
|
Mok, E.,
T. V. Golovkina, and S. R. Ross.
1992.
A mouse mammary tumor virus mammary gland enhancer confers tissue-specific but not lactation-dependent expression in transgenic mice.
J. Virol.
66:7529-7532[Abstract/Free Full Text].
|
| 48.
|
Morley, K. L.,
M. G. Toohey, and D. O. Peterson.
1987.
Transcriptional repression of a hormone-responsive promoter.
Nucleic Acids Res.
15:6973-6989[Abstract/Free Full Text].
|
| 49.
|
Neufeld, E. J.,
D. G. Skalnik,
P. M. Lievens, and S. H. Orkin.
1992.
Human CCAAT displacement protein is homologous to the Drosophila homeoprotein, cut.
Nat. Genet.
1:50-55[CrossRef][Medline].
|
| 50.
|
Nusse, R.
1990.
The int genes in mouse mammary tumorigenesis and in normal development.
Ciba Found. Symp.
150:212-222[Medline].
|
| 51.
|
Owens, R. B.,
H. S. Smith, and A. J. Hackett.
1974.
Epithelial cell cultures from normal glandular tissue of mice.
J. Natl. Cancer Inst.
53:261-269.
|
| 52.
|
Payvar, F.,
G. L. Firestone,
S. R. Ross,
V. L. Chandler,
O. Wrange,
D. Carlstedt,
J. A. Gustafsson, and K. R. Yamamoto.
1982.
Multiple specific binding sites for purified glucocorticoid receptors on mammary tumor virus DNA.
J. Cell. Biochem.
19:241-247[CrossRef][Medline].
|
| 53.
|
Pfitzner, E.,
R. Jahne,
M. Wissler,
E. Stoecklin, and B. Groner.
1998.
p300/CREB-binding protein enhances the prolactin-mediated transcriptional induction through direct interaction with the transactivation domain of Stat5, but does not participate in the Stat5-mediated suppression of the glucocorticoid response.
Mol. Endocrinol.
12:1582-1593[Abstract/Free Full Text].
|
| 54.
|
Qin, W.,
T. V. Golovkina,
T. Peng,
I. Nepomnaschy,
V. Buggiano,
I. Piazzon, and S. R. Ross.
1999.
Mammary gland expression of mouse mammary tumor virus is regulated by a novel element in the long terminal repeat.
J. Virol.
73:368-376[Abstract/Free Full Text].
|
| 55.
|
Ross, S. R.,
C. L. Hsu,
Y. Choi,
E. Mok, and J. P. Dudley.
1990.
Negative regulation in correct tissue-specific expression of mouse mammary tumor virus in transgenic mice.
Mol. Cell. Biol.
10:5822-5829[Abstract/Free Full Text].
|
| 56.
|
Scheuermann, R. H., and U. Chen.
1989.
A developmental-specific factor binds to suppressor sites flanking the immunoglobulin heavy-chain enhancer.
Genes Dev.
3:1255-1266[Abstract/Free Full Text].
|
| 57.
|
Skalnik, D. G.,
E. C. Strauss, and S. H. Orkin.
1991.
CCAAT displacement protein as a repressor of the myelomonocytic-specific gp91-phox gene promoter.
J. Biol. Chem.
266:16736-16744[Abstract/Free Full Text].
|
| 58.
|
Smith, D. B.
1993.
Purification of glutathione-S-transferase fusion proteins.
Methods Mol. Cell. Biol.
4:220-229.
|
| 59.
|
Toohey, M. G.,
J. W. Lee,
M. Huang, and D. O. Peterson.
1990.
Functional elements of the steroid hormone-responsive promoter of mouse mammary tumor virus.
J. Virol.
64:4477-4488[Abstract/Free Full Text].
|
| 60.
|
Tufarelli, C.,
Y. Fujiwara,
D. C. Zappulla, and E. J. Neufeld.
1998.
Hair defects and pup loss in mice with targeted deletion of the first cut repeat domain of the Cux/CDP homeoprotein gene.
Dev. Biol.
200:69-81[CrossRef][Medline].
|
| 61.
|
Valarche, I.,
J. P. Tissier-Seta,
M. R. Hirsch,
S. Martinez,
C. Goridis, and J. F. Brunet.
1993.
The mouse homeodomain protein Phox2 regulates Ncam promoter activity in concert with Cux/CDP and is a putative determinant of neurotransmitter phenotype.
Development
119:881-896[Abstract/Free Full Text].
|
| 62.
|
van Leeuwen, F., and R. Nusse.
1995.
Oncogene activation and oncogene cooperation in MMTV-induced mouse mammary cancer.
Semin. Cancer Biol.
6:127-133[CrossRef][Medline].
|
| 63.
|
van Wijnen, A. J.,
C. Cooper,
P. Odgren,
F. Aziz,
A. De Luca,
R. A. Shakoori,
A. Giordano,
P. J. Quesenberry,
J. B. Lian,
G. S. Stein, and J. L. Stein.
1997.
Cell cycle-dependent modifications in activities of pRb-related tumor suppressors and proliferation-specific CDP/cut homeodomain factors in murine hematopoietic progenitor cells.
J. Cell. Biochem.
66:512-523[CrossRef][Medline].
|
| 64.
|
Wang, Z.,
A. Goldstein,
R.-T. Zong,
D. Lin,
E. J. Neufeld,
R. H. Scheuermann, and P. W. Tucker.
1999.
Cux/CDP homeoprotein is a component of NF-µNR and represses the immunoglobulin heavy chain intronic enhancer by antagonizing the Bright transcription activator.
Mol. Cell. Biol.
19:284-295[Abstract/Free Full Text].
|
| 65.
|
Wolff, J. A.,
R. W. Malone,
P. Williams,
W. Chong,
G. Acsadi,
A. Jani, and P. L. Felgner.
1990.
Direct gene transfer into mouse muscle in vivo.
Science
247:1465-1468[Abstract/Free Full Text].
|
| 66.
|
Xu, L.,
T. J. Wrona, and J. P. Dudley.
1996.
Exogenous mouse mammary tumor virus (MMTV) infection induces endogenous MMTV sag expression.
Virology
215:113-123[CrossRef][Medline].
|
| 67.
|
Xu, L.,
T. J. Wrona, and J. P. Dudley.
1997.
Strain-specific expression of spliced MMTV RNAs containing the superantigen gene.
Virology
236:54-65[CrossRef][Medline].
|
| 68.
|
Yanagawa, S.-I.,
K. Kakimi,
H. Tanaka,
A. Murakami,
Y. Nakagawa,
Y. Kubo,
Y. Yamada,
H. Hiai,
K. Kuribayashi,
T. Masuda, and A. Ishimoto.
1993.
Mouse mammary tumor virus with rearranged long terminal repeats causes murine lymphomas.
J. Virol.
67:112-118[Abstract/Free Full Text].
|
| 69.
|
Yanagawa, S.-I.,
H. Tanaka, and A. Ishimoto.
1991.
Identification of a novel mammary cell line-specific enhancer element in the long terminal repeat of mouse mammary tumor virus, which interacts with its hormone-responsive element.
J. Virol.
65:526-531[Abstract/Free Full Text].
|
| 70.
|
Zong, R. T., and R. H. Scheuermann.
1995.
Mutually exclusive interaction of a novel matrix attachment region binding protein and the NF-µNR enhancer repressor. Implications for regulation of immunoglobulin heavy chain expression.
J. Biol. Chem.
270:24010-24018[Abstract/Free Full Text].
|
Journal of Virology, July 2000, p. 6348-6357, Vol. 74, No. 14
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Rouault, F., Nejad Asl, S. B., Rungaldier, S., Fuchs, E., Salmons, B., Gunzburg, W. H.
(2007). Promoter Complex in the Central Part of the Mouse Mammary Tumor Virus Long Terminal Repeat. J. Virol.
81: 12572-12581
[Abstract]
[Full Text]
-
Mertz, J. A., Kobayashi, R., Dudley, J. P.
(2007). ALY Is a Common Coactivator of RUNX1 and c-Myb on the Type B Leukemogenic Virus Enhancer. J. Virol.
81: 3503-3513
[Abstract]
[Full Text]
-
Maitra, U., Seo, J., Lozano, M. M., Dudley, J. P.
(2006). Differentiation-Induced Cleavage of Cutl1/CDP Generates a Novel Dominant-Negative Isoform That Regulates Mammary Gene Expression. Mol. Cell. Biol.
26: 7466-7478
[Abstract]
[Full Text]
-
Mertz, J. A., Simper, M. S., Lozano, M. M., Payne, S. M., Dudley, J. P.
(2005). Mouse Mammary Tumor Virus Encodes a Self-Regulatory RNA Export Protein and Is a Complex Retrovirus. J. Virol.
79: 14737-14747
[Abstract]
[Full Text]
-
Bhadra, S., Lozano, M. M., Dudley, J. P.
(2005). Conversion of Mouse Mammary Tumor Virus to a Lymphomagenic Virus. J. Virol.
79: 12592-12596
[Abstract]
[Full Text]
-
Seo, J., Lozano, M. M., Dudley, J. P.
(2005). Nuclear Matrix Binding Regulates SATB1-mediated Transcriptional Repression. J. Biol. Chem.
280: 24600-24609
[Abstract]
[Full Text]
-
Nie, H., Maika, S. D., Tucker, P. W., Gottlieb, P. D.
(2005). A Role for SATB1, a Nuclear Matrix Association Region-Binding Protein, in the Development of CD8SP Thymocytes and Peripheral T Lymphocytes. J. Immunol.
174: 4745-4752
[Abstract]
[Full Text]
-
Hronek, B. W., Meagher, A., Rovnak, J., Quackenbush, S. L.
(2004). Identification and Characterization of cis-Acting Elements Residing in the Walleye Dermal Sarcoma Virus Promoter. J. Virol.
78: 7590-7601
[Abstract]
[Full Text]
-
Zhu, Q., Maitra, U., Johnston, D., Lozano, M., Dudley, J. P.
(2004). The Homeodomain Protein CDP Regulates Mammary-Specific Gene Transcription and Tumorigenesis. Mol. Cell. Biol.
24: 4810-4823
[Abstract]
[Full Text]
-
Chao, S.-H., Harada, J. N., Hyndman, F., Gao, X., Nelson, C. G., Chanda, S. K., Caldwell, J. S.
(2004). PDX1, a Cellular Homeoprotein, Binds to and Regulates the Activity of Human Cytomegalovirus Immediate Early Promoter. J. Biol. Chem.
279: 16111-16120
[Abstract]
[Full Text]
-
Aurrekoetxea-Hernandez, K., Buetti, E.
(2004). Transforming Growth Factor {beta} Enhances the Glucocorticoid Response of the Mouse Mammary Tumor Virus Promoter through Smad and GA-Binding Proteins. J. Virol.
78: 2201-2211
[Abstract]
[Full Text]
-
Erturk, E., Ostapchuk, P., Wells, S. I., Yang, J., Gregg, K., Nepveu, A., Dudley, J. P., Hearing, P.
(2003). Binding of CCAAT Displacement Protein CDP to Adenovirus Packaging Sequences. J. Virol.
77: 6255-6264
[Abstract]
[Full Text]
-
Mustafa, F., Bhadra, S., Johnston, D., Lozano, M., Dudley, J. P.
(2003). The Type B Leukemogenic Virus Truncated Superantigen Is Dispensable for T-Cell Lymphomagenesis. J. Virol.
77: 3866-3870
[Abstract]
[Full Text]
-
Zhu, Q., Dudley, J. P.
(2002). CDP Binding to Multiple Sites in the Mouse Mammary Tumor Virus Long Terminal Repeat Suppresses Basal and Glucocorticoid-Induced Transcription. J. Virol.
76: 2168-2179
[Abstract]
[Full Text]
-
Mertz, J. A., Mustafa, F., Meyers, S., Dudley, J. P.
(2001). Type B Leukemogenic Virus Has a T-Cell-Specific Enhancer That Binds AML-1. J. Virol.
75: 2174-2184
[Abstract]
[Full Text]
-
Snyder, S. R., Wang, J., Waring, J. F., Ginder, G. D.
(2001). Identification of CCAAT Displacement Protein (CDP/cut) as a Locus-specific Repressor of Major Histocompatibility Complex Gene Expression in Human Tumor Cells. J. Biol. Chem.
276: 5323-5330
[Abstract]
[Full Text]