Previous Article | Next Article ![]()
Journal of Virology, July 2000, p. 6096-6104, Vol. 74, No. 13
Department of Microbiology, Osaka University
Medical School, Osaka University, Suita, Osaka
565-0871,1 and Laboratory of Hepatitis
Viruses, Department of Virology II, National Institute of
Infectious Diseases, Toyama, Shinjuku-ku, Tokyo
162-8640,2 Japan
Received 31 March 1999/Accepted 3 April 2000
We have characterized the human herpesvirus 6B (HHV-6B)
rep gene, which is a homologue of the adeno-associated
virus type 2 rep and is unique in the herpesvirus family.
Three transcripts, 9.0, 5.0, and 2.7 kb (the major transcript), were
detected by Northern blotting using an HHV-6B rep probe
under late conditions. We investigated the expression kinetics of the
rep gene using cycloheximide (CHX) and phosphonoformic acid
(PFA), which are inhibitors of protein synthesis and viral DNA
synthesis, respectively. The 5.2-kb transcript was mainly detected in
the absence of protein biosynthesis upon infection, and none of the
9.0-, 5.0-, and 2.7-kb transcripts detected under the late conditions
were detected in the presence of CHX and PFA. Sequences obtained from a
cDNA library showed that the 5.0- and 2.7-kb transcripts were spliced
from two and three exons, respectively, and the 2.7-kb transcript was more abundant. Immunohistochemistry using an antibody raised against the HHV-6 rep gene product (REP) revealed that REP was
mainly present in the nucleus of MT-4 cells within 24 h after
infection with HHV-6B. Using pull-down assays, coimmunoprecipitation,
and a mammalian two hybrid system, we showed that HHV-6 REP binds to a
transcription factor, human TATA-binding protein, through its
N-terminal region.
Human herpesvirus 6 (HHV-6) is a
recently isolated member of the herpesvirus family (44),
which causes exanthem subitum as a primary infection (54).
Thereafter, HHV-6 establishes a latent infection, but it can be
reactivated during immunosuppression and has been recovered from
immunodeficient individuals (10, 34, 44; H. Agut, D. Guetard, H. Collandre, C. Dauguet, L. Montagnier, J. M. Miclea, H. Baurmann, and A. Gessain, Letter, Lancet i:712, 1988;
R. G. Downing, N. Sewankambo, D. Serwadda, R. Honess, D. Crawford,
R. Jarrett, and B. E. Griffin, Letter, Lancet ii:390,
1987; R. S. Tedder, M. Briggs, C. H. Cameron, R. Honess, D. Robertson, and H. Whittle, Letter, Lancet ii:390-392, 1987).
HHV-6 is now classified into two variants: HHV-6A and HHV-6B
(1). Both variants (HHV-6A strain U1102
[15] and HHV-6B strain HST [26a])
contain a linear double-stranded DNA genome of approximately 161 kbp
with 112 potential open reading frames (ORFs). Nucleotide sequencing
has shown that HHV-6A strain U1102 contains an ORF, U94, encoding a
490-amino-acid protein homologous to Rep78/68, a nonstructural protein
from the human parvovirus adeno-associated virus type 2 (AAV-2)
(15, 49). The HHV-6 rep gene product (REP) is
closely related to AAV-2 REP, and the proteins share 24% identity over
the entire length of the 490-amino-acid sequence (49). We
also found a similar ORF in HHV-6B HST (54), situated
proximal to the right-hand terminal repeat of the viral genome
(26a). Interestingly, the AAV-2 rep gene
homologue is unique to HHV-6 and is not present in other herpesviruses;
thus, the role of HHV-6 REP in the life cycle of HHV-6 is of particular interest.
Although the function of HHV-6 REP is unknown, AAV-2 REP is known to
possess several biological activities, including DNA-binding, site- and
strand-specific endonuclease, helicase, and ATPase activities (25,
26). An attractive feature of AAV is that the viral DNA preferentially integrates within a defined region of the cellular genome (33), thus reducing the risk of insertional
mutagenesis that is associated with vectors that integrate randomly.
Targeted integration, therefore, involves AAV vectors containing an
intact rep gene and terminal repeats incorporating into the
integration locus (AAVS1) at high frequencies (14, 32).
HHV-6 was recently reported to also integrate into the human genome
(35, 36, 51; M. Daibata, T. Taguchi, M. Kamiska, I. Kubonishi, H. Taguichi, and I. Miyoshi, Letter, Leukemia
12:1002-1004). Conservation between HHV-6 rep
and AAV-2 rep may, therefore, mean that HHV-6 REP possesses
a similar range of functions advantageous to the survival of HHV-6
within the host.
Nonetheless, HHV-6 REP appears to affect gene expression differently
than does AAV REP. For instance, HHV-6A REP activates the human
immunodeficiency virus type 1 (HIV-1) long terminal repeat (LTR)
promoter in fibroblast cell lines but not in T cells, whereas AAV REP
actively inhibits the HIV-1 LTR promoter in both fibroblasts and T-cell
lines (50). On the other hand, it has also been reported
that HHV-6 REP suppresses transformation by H-ras and
inhibits transcription from HIV-1 LTR in a T-cell line (3).
Furthermore, HHV-6 REP may complement replication of a rep-deficient AAV-2 genome (50). Thus far,
however, there is no direct evidence for the expression of HHV-6
rep during the life cycle of HHV-6 within infected cells.
In the present study, we identify the HHV-6B rep locus and
localize HHV-6 REP in HHV-6-infected cells. We also identify a transcription factor, human TATA-binding protein (hTBP), as an interaction partner of HHV-6 REP. The interaction of the HHV-6 REP with
hTBP establishes a link between the effects of HHV-6 REP on
transcription and the genetic machinery of the host cell.
Cells and viruses.
Umbilical cord blood mononuclear cells
(CBMCs) were isolated by centrifugation over Ficoll-Conray gradients.
The cells were then stimulated for 2 or 3 days with phytohemagglutinin
(5 µg/ml) in RPMI 1640 medium containing 10% fetal calf serum (FCS).
To prepare virus stocks, HHV-6B HST (54) and HHV-6A U1102
(Downing et al., Letter) were propagated in stimulated CBMCs as
previously described (48). When more than 80% of the cells
exhibited a cytopathic effect, the infected cells were lysed by
freezing, thawed twice, and spun at 1,500 × g for 10 min.
The supernatant was stored at Isolation of RNA.
MT-4 cells were infected with strain HST
or mock infected for 72 h; Poly(A)+ RNA was then
extracted using the FastTrack TM 2.0 Kit (Invitrogen) according to the
manufacturer's protocol. Phosphonoformic acid (PFA), which inhibits
viral DNA synthesis, was used to determine whether the rep
gene is an immediate-early (IE), early (E), or late (L) gene. For IE or
E transcripts, MT-4 cells were infected with HHV-6, cultured with
medium supplemented with PFA (300 µg/ml), and harvested at 48 h
after infection. For IE transcriptional studies, MT-4 cells were
maintained for 1 h in the culture medium supplemented with
cycloheximide (CHX) (100 µg/ml; Sigma) prior to infection, and
infected MT-4 cells were maintained with CHX for 10 h until harvest.
cDNA library construction.
Poly(A)+ RNA (5 µg)
was used as the template to construct a cDNA library. cDNA synthesis
was primed using 1 µg of oligo (dT)12-18 and carried out
with Superscript II reverse transcriptase and the Superscript Choice
System for cDNA Synthesis (GIBCO, Grand Island, N.Y.). The cDNA was
then inserted into a plasmid vector pGAD424 (Clontech Laboratories,
Inc., Palo Alto, Calif.), introduced into Escherichia coli
DH5
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Expression of Human Herpesvirus 6B rep
within Infected Cells and Binding of Its Gene Product to the
TATA-Binding Protein In Vitro and In Vivo
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
80°C as a cell-free virus stock
(41). A human T-cell line, MT-4, was also used for experiments.
bacteria by electroporation, and cultivated. The cDNA clones
were screened using 32P-labeled PCR products as F1 probes
(Fig. 1).

View larger version (17K):
[in a new window]
FIG. 1.
Schematic interpretation of the cDNA clones isolated
from the cDNA library. The PCR-amplified products of the full-length
ORF U94 (F1) served as hybridization probes. cDNA clone numbers are
indicated in boldface type on the left; the sizes of cDNA molecules are
noted on the right. The locations of the 5' ends of cDNAs hybridized by
the F1 probe are indicated in front of each cDNA (positions of the
first nucleotides are shown in Fig. 2). Each "A+" at the 3' end of
the cDNA indicates a poly(A)+ site.
Preparation of REP in insect cells using a recombinant baculovirus. A DNA fragment comprising the full-length rep gene ORF was amplified by PCR and cloned, in frame, into the BamHI site of the baculovirus transfer vector, pAcG2T (PharMingen, San Diego, Calif.). The nucleotide sequences of the primers used for the PCR were as follows: sense, 5'-ggatccAATCTTGGAAGGCACAAACG-3', and antisense, 5'-ggatccTCAATTCAGATCCTCTTCTGAGATGAGTTTTTGTTCTAAAATTTTTGGAACCGTGT-3'. The lowercase and underlined letters indicate additional restriction sites and c-myc epitope codons, respectively. The baculovirus, Autographa californica nuclear polyhedrosis virus, and a recombinant baculovirus were grown and assayed in Spodoptera frugiperda cells (Sf9 cells) in TC100 medium (GIBCO) supplemented with 0.26% Bacto Tryptose broth (Difco, Detroit, Mich.), kanamycin (100 µg/ml), and 10% FCS. A recombinant baculovirus, AcGST-REP, was generated by homologous recombination as described previously (38), and expression of the fusion protein was identified immunohistochemically using an anti-REP antibody (Ab) or anti-c-myc monoclonal Ab (MAb). Sf9 cells infected with AcGST-REP were harvested after 3 days of incubation, and the glutathione S-transferase (GST)-REP fusion protein was affinity purified.
Northern blot hybridization. For Northern blot hybridization, 10 µg of the poly(A)+ RNA was subjected to electrophoresis on 1% agarose-formaldehyde gels, blotted onto a Hybond-N+ nylon membrane (Amersham Pharmacia, Little Chalfont Bucks, United Kingdom) and hybridized to oligonucleotide probes at 42°C in a 20 mM sodium phosphate buffer containing 5× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 1× Denhardt's solution, 0.1% sodium dodecyl sulfate (SDS), 0.005 M EDTA, poly(A)n (10 µg/ml), sheared salmon sperm DNA (20 µg/ml), and yeast extract tRNA (20 µg/ml; 3 PRIME, Inc.). After hybridization, the membranes were washed in solutions of decreasing ionic strength (2× SSC-0.1% SDS, and 1× SSC-0.1% SDS) for 30 min each at 42°C. This was followed by exposure to Kodak XAR films with intensifying screens. A 0.24- to 9.5-kb RNA ladder marker was used in this study (GIBCO).
Radiolabeling of DNA probes.
The DNA probe used for
hybridization was labeled with [
-32P]dCTP using a
Multiprime DNA Labeling Systems kit (Amersham Pharmacia). Oligonucleotides were 5' labeled with T4 polynucleotide kinase and
[
-32P]ATP using a Mega label kit (Takara, Kyoto,
Japan). The sequence of the AR oligonucleotide was
AGTTGATACTTATGTCTTTCCACCAC. The sequences of the
oligonucleotides used for radiolabeling were as follows: ER,
AAATGGGTGCTTCTGCATAATTACC; GR,
ACCCGGATGGATGATT-GTCCTTGG; QR,
CACTTGGATTTATTATGGAAAACATAC; HHV-6B IE1-1,
CTGAGGCTGTACATACACAGTTAGGGCTTG; and HHV-6B IE1-2, ACAGTCATCTGACTCGCTGCTCGATTCAG.
5' RACE. Rapid amplification of cDNA 5' ends (5' RACE) was performed using the 5' RACE System kit (version 2.0; GIBCO) according to the manufacturer's protocol. Primers used for 5' RACE were as follows (Fig. 1): R1, GTACTAATCATTCAAGTTTACC; R2, TCTAGG-CAGGTCGGAGTCGAGGAAGA; and R3, TTAAGAACGACATAGTGATCACAGC.
Expression of the rep gene in E. coli and
production of anti-REP antisera.
A DNA fragment spanning positions
1 to 705 of the ORF U94 (rep) and encoding the N-terminal
portion of HHV-6 REP was amplified by PCR and cloned, in frame, into
the pMALTM-c2 bacterial expression vector (New England Biolabs, Inc.,
Beverly, Mass.) at the BamHI and SalI sites. This
vector also contained the maltose binding protein (MBP), and the
resultant fusion protein (MBP-REPN1) was then expressed in E. coli DH5
. In addition, a DNA fragment comprising the entire
amino acid coding region of the ORF U94 was amplified by PCR and
cloned, in frame, into the pGEX-4T-1 bacterial expression vector
(Amersham Pharmacia) at the BamHI and SalI sites.
This vector contained GST, and the resultant GST-REP fusion protein was
also expressed in E. coli DH5
. The expressed MBP-REPN1
(30) and GST-REP fusion proteins were affinity purified and
used to raise Abs in rabbits. The rabbits were first immunized three
times with GST-REP and then three times with MBP-REPN1. They were then bled, and the samples were used for subsequent immunological analysis. Polyclonal rabbit antiserum against HHV-6 REP, preimmune serum, anti-MBP rabbit serum (New England Biolabs, Inc.), and anti-GST rabbit
serum were all used at a dilution of 1:700.
Immunohistochemical analysis of HST-infected MT-4 cells. To examine REP expression patterns, immunohistochemical analysis was carried out using anti-REP rabbit serum as described previously (54). MT-4 cells were grown and maintained in RPMI 1640 supplemented with 10% FCS. After washing, cells were suspended in virus solution at a multiplicity of infection of 0.1 and incubated for 60 min at 37°C to adsorb virus, collected by centrifugation at 1,500 × g, and replated on cover glasses. The cells were fixed in cold acetone 3, 9, 12, 24, 36, 48, or 72 h after infection and then incubated for 30 min at room temperature with the respective primary antibodies (anti-REP serum and OHV-2, a MAb against HHV-6 nuclear antigen, which is expressed in the early stage). The cover glasses were then washed, rhodamine-conjugated goat anti-rabbit immunoglobulin secondary Ab (Chemicon) and Cy5-conjugated rabbit anti-mouse immunoglobulin secondary Ab (Chemicon) were added, and incubation was continued for an additional 15 min. Finally, the cells were incubated for 5 min with DAPI (4',6-diamidino-2-phenylindole dihydrochloride; Calbiochem, Nottingham, United Kingdom) to stain the DNA.
The distribution of the fluorescent label was visualized using the Delta Vision system (Applied Precision, Issaquah, Wash.), which is based on an inverted microscope (Carl Zeiss Co., Ltd., Jena, Germany) equipped with a Photometrics PXL-cooled charge-coupled device (CCD) camera. Sets of images of selected cells were collected while varying the plane of focus along the z axis. The resultant three-dimensional data sets were deconvolved and projected onto single planes. The images were then adjusted for contrast before exporting them as TIFF files to Adobe Photoshop.Pull-down assay and immunoblotting. Binding reactions were carried out by incubating 1-10 µg of either GST-REP or MBP-REPN1 fusion protein with human hTBP (Promega) in 100 µl of binding buffer (50 mM Tris-HCl [pH 7.5], 100 mM NaCl, 5 mM MgCl2, 2 mM dithiothreitol, 10% glycerol, 0.1% Tween 20, 1% bovine serum albumin [BSA]) for 1 h at 4°C on a rotating wheel. Proteins associated with GST or GST-REP were pulled down with glutathione-Sepharose beads, while those associated with MBP or MBP-REPN1 were pulled down with maltose-Sepharose beads. The beads were washed seven times with 0.5 ml of binding buffer without BSA. Bound proteins were then eluted by boiling in protein lysis buffer (10% glycerol, 50 mM Tris [pH 7.4], 1% 2-mercaptoethanol), separated by sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis (SDS-12% PAGE), transferred to nylon membranes (Amersham Pharmacia), and reacted with the appropriate primary Abs (e.g., anti-hTBP MAb; Promega). Reactive bands were visualized using horseradish peroxidase-linked secondary conjugate and enhanced chemiluminescence detection reagents (Amersham Pharmacia).
Production of 35S-HHV-6 REP and coimmunoprecipitation with hTBP. To generate 35S-labeled HHV-6 REP, the rep ORF was inserted into pcDNA3.1 (Invitrogen) downstream from the T7 promoter. The 35S-labeled HHV-6 REP was then produced by in vitro transcription-translation in rabbit reticulocyte lysates (TnT system; Promega), as directed by the kit's instructions. Equal aliquots (2,000 cpm) of 35S-labeled HHV-6 REP and 35S-labeled luciferase protein (control) were used for the immunoprecipitation assays. Initially, anti-hTBP Abs were incubated with protein A-Sepharose (Amersham Pharmacia) in 500 µl of binding buffer (25 mM Tris [pH 7.8], 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 1 mM EDTA, 150 mM NaCl, 5 mM MgCl2, 5 mM KCl, 1% BSA, and 0.1% Tween 20). The immune complex was then washed seven times in binding buffer without BSA and incubated with hTBP, followed by incubation with 35S-labeled HHV-6 REP or luciferase protein. Each incubation was carried out for 4 h at 4°C, and after each incubation the complexes were washed seven times with 1 ml of binding buffer. Finally, the products were boiled in sample buffer, subjected to SDS-10% PAGE, stained, and autoradiographed.
GAL4 mammalian two-hybrid analysis.
rep and hTBP
expression vectors were constructed using standard techniques. The
HHV6-B rep gene fragment was initially inserted into the
SalI site of pBluescript II (Stratagene) followed by PCR
amplification with a primer containing a SalI site at the end. The SalI fragment of the rep gene then was
inserted into the SalI site of a pVP vector (Clontech) to
make pVPrep. The rep gene was fused in frame with the herpes
simplex virus VP16 transactivation domain ORF (pVP), to make pVP16rep.
In the same way, the hTBP gene (23) was cloned into a yeast
GAL 4 DNA binding domain (pM) vector, to make pMhTBP. To elucidate
which region of the rep gene interacts with hTBP, the
deletion mutant was constructed. For N-terminal deletion, the first 111 amino acids were deleted by excising EcoRI fragment from the
pVP16Rep construct, referred to as pVP16Rep
Eco. The end portion of
EcoRI digestion was filled in with Klenow fragment and
deoxynucleoside triphosphates to adjust the coding frame. For
C-terminal deletion, the MluI fragment was excised,
resulting in the deletion from the 244th to the last amino acid,
referred to as pVP16 Rep
Mlu. These plasmids were transfected into
293L cells (6, 13) in several combinations. Generally,
5.0 × 105 cells/well in six-well plates were seeded
24 h before transfection. A reporter plasmid, pG5 E1b Luc, which
was generated by replacing the chloramphenicol acetyltransferase gene
in pG5 E1b CAT (Clontech) with the firefly luciferase gene was
transfected at 30 ng/well with either 0.3 µg of the pM-based or the
pVP-based expression vector per well. These cells were harvested
24 h after transfection and lysed in lysis buffer (Picagene
PGC50). The soluble fraction was collected, and the activity was
normalized to the protein concentration using the Bradford method
(8) with BSA as the standard and beta-galactosidase activity
by cotransfecting pCMV
(Clontech). Analyses were performed in
triplicate, and relative luciferase activity was measured. The
experiment was performed several times, and we obtained almost the same
data each time.
| |
RESULTS |
|---|
|
|
|---|
Analysis of rep transcription.
We initially
attempted Northern blot analysis to determine the patterns of HHV-6B
HST transcription. An antisense oligonucleotide (AR) from U94 served as
the probe (Fig. 2). Analysis of
poly(A)+ RNA from infected cells revealed three transcripts
of approximately 9.0, 5.0, and 2.7 kb; of these, the 2.7-kb mRNA was
the most abundant (Fig. 3a, lane HST).
|
|
Expression of REP in MT-4 cells and CBMCs infected with strain
HST.
To verify HHV-6 rep expression in HST-infected
cells and identify some of the properties of the transcripts, REP was
localized within the infected cells. Immunofluorescence showing the
distribution of anti-REP antibodies within MT-4 cells infected with HST
for 48 h is shown in Fig. 4. It
should be noted that there was significant overlap of the signals when
infected cells were triple labeled (Fig. 4D) with anti-REP serum (Fig.
4C), DAPI (Fig. 4A), and OHV-2 (Fig. 4B), which indicates the presence
of REP in the nucleus (Fig. 4C). REP was first detected in the nucleus
24 h after infection, appearing as localized spots. After 72 h, additional nuclear accumulation of REP was evident, as was the
presence of REP in the cytoplasm (data not shown).
|
Interaction between a GST-HHV-6B REP fusion protein and hTBP in
vitro.
Hermonat et al. (22) showed that AAV-REP binds
to hTBP, and we hypothesized that HHV-6 REP might do so as well. Direct
interaction between HHV-6 REP and hTBP was assessed in vitro using
pull-down assays. HHV-6B rep from baculovirus was expressed
as a fusion protein with GST (GST-REP) and purified on
glutathione-Sepharose beads. When the purified fusion proteins and GST
were subjected to SDS-PAGE and stained with Coomassie blue, the
quantity of protein in each sample was found to be about the same (Fig.
5A, panel a). When the purified samples
were reacted with hTBP and then subjected to SDS-PAGE and analyzed by
Western blotting using anti-hTBP Abs, GST itself did not associate with
hTBP, but there was a strong interaction between anti-hTBP Abs and the
GST-REP fusion protein, as indicated by the appearance of a band at
37.7 kDa (Fig. 5A, panel b, lane 2). When the GST-REP fusion protein
was present on the blot in the absence of hTBP, the anti-hTBP Abs did
not react (data not shown).
|
HHV-6B REP binds hTBP in vivo as determined using the GAL4
mammalian two-hybrid system.
To extend the investigation of the
REP-hTBP interaction in vivo, the GAL4 two-hybrid system was used (Fig.
6). hTBP ORF was fused in frame with the
GAL4 DNA-binding domain (pM) ORF, and the Rep ORF was fused
in frame with the HSV VP16 transactivation domain (pVP) ORF. These
constructs were transfected with a reporter plasmid, pG5 E1b Luc, both
alone and together. In this assay system, the level of luciferase
activity from a GAL4-dependent reporter construct usually correlates
with the strength of the in vivo interaction between the two proteins
being examined (e.g., large T with p53 [Fig. 6]). These data are
shown in Fig. 6. The positive control, pM53 + pVP16-T, was
significantly elevated over all of the negative controls (pM + pVP16rep, pMhTBP + pVP16, or pM + pVP16). Importantly, the
expression level of PMhTBP + pVP16rep was significantly greater
than that of any of the negative controls. Furthermore, we constructed
other plasmids, pVP16 Rep
Eco and pVP16 Rep
Mlu, to analyze which
region of Rep was responsible for this interaction. pVP 16 Rep
Eco
showed higher luciferase activity than pVP16 Rep when cotransfected
with pMhTBP. The data, however, vigorously fluctuated, which suggested
that pVP16 Rep
Eco could have the boundary region for the
interaction. On the other hand, pVP16 Rep
Mlu showed much higher
activity than either pVP16 Rep or pVP16 Rep
Eco. This suggested that
the N-terminal part up to 244 amino acid should contain the element
responsible for their interaction, which was coincident with the in
vitro data. Thus, these data demonstrate a measurable in vivo
interaction between REP and hTBP and support the validity of the in
vitro studies.
|
| |
DISCUSSION |
|---|
|
|
|---|
HHV-6 ORF U94 encodes a protein that is homologous to the AAV-2 rep gene product and is unique among human herpesviruses (49). However, although the function of the AAV-2 rep gene is well documented (2, 4, 17-22, 26, 28-30) the function of the HHV-6 rep remains unknown. Interestingly, HHV-6 rep is able to complement replication of a rep-deficient AAV-2 genome (50), suggesting these genes may have similar biological functions.
In this study, we describe three transcripts of different size present in the poly(A)+ RNA of infected MT-4 cells (Fig. 3a). The 5.0- and 2.7-kb mRNAs were mapped within the rep gene region, while the 9.0-kb mRNA was not. In addition, the 5.0- and 2.7-kb (major) mRNAs, which were detected in L phase, appeared to use the same promoter and encode related polypeptides. In AAV-2, REP proteins are translated from four mRNA species whose expression is driven by two promoters, yielding four overlapping polypeptides with apparent molecular masses of 78 kDa (Rep78), 68 kDa (Rep68), 52 kDa (Rep52), and 40 kDa (Rep40) (5, 26, 39, 47). Of these, Rep68 and Rep78 have been shown to bind to AAV terminal hairpin DNA in a sequence-dependent manner, to bind to the origin of replication, and to exhibit ATP-dependent, site-specific endonuclease and DNA helicase activities (5, 26).
Herpesvirus genes have been classified as IE, E, and L (24). Expression of IE and E genes is independent of viral DNA replication; indeed, some IE and E genes are themselves involved in regulating gene expression and DNA replication. The L genes, in contrast, are dependent on viral DNA replication and mainly encode structural proteins (24). There has been one report that, based on reverse transcription-PCR analysis, HHV-6 rep is an IE gene (40). The Northern blot experiments described above indicated that the 2.7-kb transcript appeared abundantly at a later phase of the infectious cycle, although the 5.0-kb transcript (minor) was also detected (Fig. 3a). A 5.2-kb transcript was detected under IE conditions (Fig. 3a [CHX]) and detected faintly under E conditions (Fig. 3a [PFA]). This transcript was more abundant than that of HHV-6 IE1 under IE conditions (Fig. 3a [HHV-6B IE1]). The repression of HHV-6 IE1 by CHX is unusual for a herpesvirus IE gene but has been observed by another group (45). HHV-6 IE1 was expressed faintly with IE kinetics, but its expression increased and it accumulated with virus replication, indicating that the promoter might be activated by virus replication (Fig. 3a). The 5.2-kb transcript was not detected by Northern blotting using either the ER or GR probe (Fig. 3b) or by screening a cDNA library that was prepared from late-stage infected cells (72 h postinfection), indicating that the transcript may not be expressed in the late phase. Moreover, the QR probe (Fig. 2), an antisense oligonucleotide derived from the start site of the rep ORF, detected both the 5.0- and 2.7-kb transcripts in mRNA from cells infected for 60 h but detected no 5.2-kb transcript under the IE or E conditions (Fig. 3b). Therefore, it is not clear if the 5.2-kb transcript detected under the IE and E conditions codes for the REP protein.
In the present study, the HHV-6B REP protein was initially detected in the nucleus 24 h after infection and accumulated to high levels in the nucleus and was apparent in the cytoplasm within 72 h, but the REP protein was not detectable at any time in cells grown in the presence of PFA, CHX, and actinomycin D (data not shown). The reason for this discrepancy, in which the 5.2-kb transcript was detected under the IE condition but the REP protein was not, is not yet clear, but one possibility is that HHV-6 rep is transcribed at the IE stage and translated at the L stage. Alternatively, a low level of HHV-6 rep expression may make it difficult to detect at the IE stage. In addition, we have observed that transcription levels of the U95 gene homologue (Fig. 2), which is antisense with respect to rep, is very high (unpublished data). It is conceivable, therefore, that U95 transcription interferes with the rep transcript. We also tried to detect REP from cells infected with HST and grown in the presence of PFA or CHX for 72 h, by Western blotting and immunoprecipitation, but were not successful. It is possible that the expression level of the REP protein is too low to be detectable. The other possibility is that the 5.2-kb transcript detected under the IE condition may not code for the REP protein. We are currently investigating the nature of the 5.2-kb transcript. Finally, these results suggest that the 2.7-kb transcript codes for REP protein and is expressed at the L stage.
The level of HHV-6 rep transcription within infected cells was apparently small: only 11 cDNA clones were detected from among approximately 106 colonies making up the cDNA library. The reason for this tight control is not clear, but some evidence suggests that overexpression of this gene may be deleterious to the biological activity of HHV-6 (9).
Rotola et al. (43) used reverse transcription-PCR to detect expression of HHV-6 rep in PBMCs from healthy individuals who had latent HHV-6 infections, but the transcription of other genes, including IE genes, was not detectable. These investigators also reported being able to derive lymphoid cells in which HHV-6 REP was stably expressed but in which viral replication was restricted. They postulated that REP regulated viral gene expression in a manner that enabled the establishment or maintenance of latent infection in lymphoid cells.
In the present study, the 5.2-kb transcript was detected under the IE and E conditions by Northern blotting, but not under the L condition. Interestingly, the expression of the 5.2-kb transcript decreased with virus replication, indicating that this transcript might play a important role in the IE phase or in latency.
AAV2 Rep78 appears to bind to a variety of as yet uncharacterized cellular proteins (21) and to suppress heterologous promoters, at least in some cases, via Sp1 sites (20). We suspect that HHV-6 REP acts, at least in part, by interacting with cellular transcription factors. hTBP, which is critical for initiating transcription, seemed an obvious candidate. hTBP exists primarily as a subunit of several larger complexes: the Pol II-specific complex (TFIID) consists of hTBP and 10 to 12 hTBP-associated factors (TAFs), most of which have been highly conserved from Saccharomyces cerevisiae to humans (9, 16, 31, 42, 52) TAFs interact with other transcription factors, which in turn initiate transcription by binding to enhancer elements and to RNA polymerase II and its accessory proteins (19, 45).
In this study, HHV-6 REP binding to hTBP was demonstrated in vitro using pull-down assays (Fig. 5A) and coimmunoprecipitation (Fig. 5C) and in vivo using a mammalian two-hybrid assay (Fig. 6). Furthermore, we showed that the N-terminal portion of HHV-6 REP was sufficient for the interaction with hTBP in vitro and in vivo (Fig. 5B and 6). Two hybrid results suggested that the N-terminal part up to amino acid 244 should contain the element responsible for their interaction, which was coincident with the in vitro data. Taken together, the data still suggested that the N-terminal part should contain the interacting domain and that the coding region around amino acid 114 could be the boundary, although more precise analyses should be done. On the other hand, we could detect two bands in the coimmunoprecipitation assay (Fig. 5C). Although it is not clear that the small band (40.5 kDa) is specific, it may indicate the existence of N-terminal products of REP.
It appears, therefore, that by binding to hTBP, HHV-6 REP reduces the efficiency with which transcription is initiated. The mechanism of this inhibitory effect is as yet unknown. Perhaps HHV-6 REP contains a domain that, when bound to hTBP, actively interferes with some aspect of initiation; or, HHV-6 REP could block the binding of another, positively acting factor. For instance, HHV-6 REP binding to hTBP might significantly affect hTBP-TAF interactions and prevent certain TAFs from entering the TFIID complex. A similar mechanism has been suggested for p53-mediated inhibition of transcription (46). Another possibility is that HHV-6 REP itself may serve as a TAF, functioning as a connector or modulator in a manner analogous to SV40 large T (11, 37).
It has been reported that Rep78 binds to hTBP both in vitro and in vivo (22). It was also recently shown that Rep78 binds to CREB, thereby blocking activation of CREB-dependent transcription by protein kinase A (12) and that both Rep78 and Rep68 bind to transcription coactivator PC4 (53). Accordingly, we suggest that the function of the HHV-6 REP-hTBP interaction may be to modulate HHV-6 replication. This scenario supports a model wherein suppression by HHV-6 REP is involved in an autoregulatory loop controlling HHV-6 rep gene expression.
| |
ACKNOWLEDGMENTS |
|---|
This study was supported in a part by a grant-in-aid for scientific research from the Ministry of Education, Science, and Culture of Japan.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology, Osaka University Medical School, 2-2 Yamada-oka, Suita, Osaka 565-0871, Japan. Phone: 81-6-6879-3321. Fax: 81-6-6879-3329. E-mail: yamanisi{at}micro.med.osaka-u.ac.jp.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Ablashi, D., H. Agut, Z. Berneman, G. Campadelli-Fiume, D. Carrigan, L. Ceccerini-Nelli, B. Chandran, S. Chou, H. Collandre, R. Cone, T. Dambaugh, S. Dewhurst, D. DiLuca, L. Foa-Tomasi, B. Fleckenstein, N. Frenkel, R. Gallo, U. Gompels, C. Hall, M. Jones, G. Lawrence, M. Martin, L. Montagnier, F. Neipel, J. Nicholas, P. Pellet, A. Razzaque, G. Torrelli, B. Thomson, S. Salahuddin, L. Wyatt, and K. Yamanishi. 1993. Human herpesvirus-6 strain groups: a nomenclature. Arch. Virol. 129:363-366[CrossRef][Medline]. |
| 2. |
Antoni, B. A.,
A. B. Rabson,
I. L. Miller,
J. P. Trempe,
N. Chejanovsky, and B. J. Carter.
1991.
Adeno-associated virus Rep protein inhibits human immunodeficiency virus type 1 production in human cells.
J. Virol.
65:396-404 |
| 3. | Araujo, J. C., J. Doniger, F. Kashanchi, P. L. Hermonat, J. Thompson, and L. J. Rosenthal. 1995. Human herpesvirus 6A ts suppresses both transformation by H-ras and transcription by the H-ras and human immunodeficiency virus type 1 promoters. J. Virol. 69:4933-4940[Abstract]. |
| 4. |
Beaton, A.,
P. Palumbo, and K. I. Berns.
1989.
Expression from the adeno-associated virus p5 and p19 promoters is negatively regulated in trans by the rep protein.
J. Virol.
63:4450-4454 |
| 5. |
Becerra, S. P.,
F. Koczot,
P. Fabisch, and J. A. Rose.
1988.
Synthesis of adeno-associated virus structural proteins requires both alternative mRNA splicing and alternative initiations from a single transcript.
J. Virol.
62:2745-2754 |
| 6. |
Blauvelt, A.,
B. G. Herndier, and J. M. Orenstein.
1997.
Propagation of a human herpesvirus from AIDS-associated Kaposi's sarcoma.
N. Engl. J. Med.
336:1837-1839 |
| 7. | Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254[CrossRef][Medline]. |
| 8. | Braun, D. K., G. Dominguez, and P. E. Pellett. 1997. Human herpesvirus 6. Clin. Microbiol. Rev. 10:521-567[Abstract]. |
| 9. | Burley, S. K., and R. G. Roeder. 1996. Biochemistry and structural biology of transcription factor IID (TFIID). Annu. Rev. Biochem. 65:769-799[CrossRef][Medline]. |
| 10. | Carrigan, D. R., K. K. Knox, and M. A. Tapper. 1990. Suppression of human immunodeficiency virus type 1 replication by human herpesvirus-6. J. Infect. Dis. 162:844-851[Medline]. |
| 11. |
Damania, B., and J. C. Alwine.
1996.
TAF-like function of SV40 large T antigen.
Genes Dev.
10:1369-1381 |
| 12. |
Di Pasquale, G., and S. N. Stacey.
1998.
Adeno-associated virus Rep78 protein interacts with protein kinase A and its homolog PRKX and inhibits CREB-dependent transcriptional activation.
J. Virol.
72:7916-7925 |
| 13. |
Foreman, K. E.,
J. Friborg, Jr.,
W. P. Kong,
C. Woffendin,
P. J. Polverini,
B. J. Nickoloff, and G. J. Nabel.
1997.
Propagation of a human herpesvirus from AIDS-associated Kaposi's sarcoma.
N. Engl. J. Med.
336:163-171 |
| 14. | Giraud, C., E. Winocour, and K. I. Berns. 1995. Recombinant junctions formed by site-specific integration of adeno-associated virus into an episome. J. Virol. 69:6917-6924[Abstract]. |
| 15. | Gompels, U. A., J. Nicholas, G. Lawrence, M. Jones, B. J. Thomson, M. E. Martin, S. Efstathiou, M. Craxton, and H. A. Macaulay. 1995. The DNA sequence of human herpesvirus-6: structure, coding content, and genome evolution. Virology 209:29-51[CrossRef][Medline]. |
| 16. | Hahn, S. 1998. The role of TAFs in RNA polymerase II transcription. Cell 95:579-582[CrossRef][Medline]. |
| 17. |
Heilbronn, R.,
A. Burkle,
S. Stephan, and H. zur Hausen.
1990.
The adeno-associated virus rep gene suppresses herpes simplex virus-induced DNA amplification.
J. Virol.
64:3012-3018 |
| 18. | Hermonat, P. L. 1994. Down-regulation of the human c-fos and c-myc proto-oncogene promoters by adeno-associated virus Rep78. Cancer Lett. 81:129-136[CrossRef][Medline]. |
| 19. |
Hermonat, P. L.
1994.
Adeno-associated virus inhibits human papillomavirus type 16: a viral interaction implicated in cervical cancer.
Cancer Res.
54:2278-2281 |
| 20. |
Hermonat, P. L.,
A. D. Santin, and R. B. Batchu.
1996.
The adeno-associated virus Rep78 major regulatory/transformation suppressor protein binds cellular Sp1 in vitro and evidence of a biological effect.
Cancer Res.
56:5299-5304 |
| 21. | Hermonat, P. L., A. D. Santin, C. A. Carter, G. P. Parham, and J. G. Quirk. 1997. Multiple cellular proteins are recognized by the adeno-associated virus Rep78 major regulatory protein and the amino-half of Rep78 is required for many of these interactions. Biochem. Mol. Biol. Int. 43:409-420[Medline]. |
| 22. | Hermonat, P. L., A. D. Santin, R. B. Batchu, and D. Zhan. 1998. The adeno-associated virus Rep78 major regulatory protein binds the cellular TATA-binding protein in vitro and in vivo. Virology 245:120-127[CrossRef][Medline]. |
| 23. |
Hoffmann, A., and R. G. Roeder.
1991.
Purification of his-tagged proteins in non-denaturing conditions suggests a convenient method for protein interaction studies.
Nucleic Acids Res.
19:6337-6338 |
| 24. |
Honess, R. W., and B. Roizman.
1974.
Regulation of herpesvirus macromolecular synthesis. I. Cascade regulation of the synthesis of three groups of viral proteins.
J. Virol.
14:8-19 |
| 25. | Im, D. S., and N. Muzyczka. 1990. The AAV origin binding protein Rep68 is an ATP-dependent site-specific endonuclease with DNA helicase activity. Cell 61:447-457[CrossRef][Medline]. |
| 26. |
Im, D. S., and N. Muzyczka.
1992.
Partial purification of adeno-associated virus Rep78, Rep52, and Rep40 and their biochemical characterization.
J. Virol.
66:1119-1128 |
| 26a. |
Isegawa, Y.,
T. Mukai,
K. Nakano,
M. Kagawa,
J. Chen,
Y. Mori,
T. Sunagawa,
K. Kawanishi,
J. Sashihara,
A. Hata,
P. Zou,
H. Kosuge, and K. Yamanishi.
1999.
Comparison of the complete DNA sequences of human herpesvirus 6 variants A and B.
J. Virol.
73:8053-8063 |
| 27. | Kellermann, O. K., and T. Ferenci. 1982. Maltose-binding protein from Escherichia coli. Methods Enzymol. 90:459-463. |
| 28. | Kyostio, S. R., R. S. Wonderling, and R. A. Owens. 1995. Negative regulation of the adeno-associated virus (AAV) P5 promoter involves both the P5 rep binding site and the consensus ATP-binding motif of the AAV Rep68 protein. J. Virol. 69:6787-6796[Abstract]. |
| 29. |
Labow, M. A.,
P. L. Hermonat, and K. I. Berns.
1986.
Positive and negative autoregulation of the adeno-associated virus type 2 genome.
J. Virol.
60:251-258 |
| 30. |
Labow, M. A.,
L. H. Graf, Jr., and K. I. Berns.
1987.
Adeno-associated virus gene expression inhibits cellular transformation by heterologous genes.
Mol. Cell. Biol.
7:1320-1325 |
| 31. |
Lee, T. I., and R. A. Young.
1998.
Regulation of gene expression by TBP-associated proteins.
Genes Dev.
12:1398-1408 |
| 32. |
Linden, R. M.,
E. Winocour, and K. I. Berns.
1996.
The recombination signals for adeno-associated virus site-specific integration.
Proc. Natl. Acad. Sci. USA
93:7966-7972 |
| 33. |
Linden, R. M.,
P. Ward,
C. Giraud,
E. Winocour, and K. I. Berns.
1996.
Site-specific integration by adeno-associated virus.
Proc. Natl. Acad. Sci. USA
93:11288-11294 |
| 34. | Lopez, C., P. Pellett, J. Stewart, C. Goldsmith, K. Sanderlin, J. Black, D. Warfield, and P. Feorino. 1988. Characteristics of human herpesvirus-6. J. Infect. Dis. 157:1271-1273[Medline]. |
| 35. | Luppi, M., R. Marasca, P. Barozzi, S. Ferrari, L. Ceccherini-Nelli, G. Batoni, E. Merelli, and G. Torelli. 1993. Three cases of human herpesvirus-6 latent infection: integration of viral genome in peripheral blood mononuclear cell DNA. J. Med. Virol. 40:44-52[Medline]. |
| 36. | Luppi, M., P. Barozzi, R. Marasca, and G. Torelli. 1994. Integration of human herpesvirus-6 (HHV-6) genome in chromosome 17 in two lymphoma patients. Leukemia 8(Suppl. 1):S41-S45. |
| 37. | Martin, D. W., M. A. Subler, R. M. Munoz, D. R. Brown, S. P. Deb, and S. Deb. 1993. p53 and SV40 T antigen bind to the same region overlapping the conserved domain of the TATA-binding protein. Biochem. Biophys. Res. Commun. 195:428-434[CrossRef][Medline]. |
| 38. |
Matsuura, Y.,
R. D. Possee,
H. A. Overton, and D. H. L. Bishop.
1987.
Baculovirus expression vectors: the requirements for high level expression of proteins, including glycoproteins.
J. Gen. Virol.
68:1233-1250 |
| 39. |
Mendelson, E.,
J. P. Trempe, and B. J. Carter.
1986.
Identification of the trans-acting Rep proteins of adeno-associated virus by antibodies to a synthetic oligopeptide.
J. Virol.
60:823-832 |
| 40. |
Mirandola, P.,
P. Menegazzi,
S. Merighi,
T. Ravaioli,
E. Cassai, and D. Di Luca.
1998.
Temporal mapping of transcripts in herpesvirus 6 variants.
J. Virol.
72:3837-3844 |
| 41. | Mori, Y., H. Yagi, T. Shimamoto, Y. Isegawa, T. Sunagawa, R. Inagi, K. Kondo, Y. Tano, and K. Yamanishi. 1998. Analysis of human herpesvirus 6 U3 gene, which is a positional homolog of human cytomegalovirus UL 24 gene. Virology 249:129-139[CrossRef][Medline]. |
| 42. | Roeder, R. G. 1996. The role of general initiation factors in transcription by RNA polymerase II. Trends Biochem. Sci. 21:327-335[CrossRef][Medline]. |
| 43. |
Rotola, A.,
T. Ravaioli,
A. Gonelli,
S. Dewhurst,
E. Cassai, and D. Di Luca.
1998.
U94 of human herpesvirus 6 is expressed in latently infected peripheral blood mononuclear cells and blocks viral gene expression in transformed lymphocytes in culture.
Proc. Natl. Acad. Sci. USA
95:13911-13916 |
| 44. |
Salahuddin, S. Z.,
D. V. Ablashi,
P. D. Markham,
S. F. Josephs,
S. Sturzenegger,
M. Kaplan,
G. Halligan,
P. Biberfeld,
F. Wong-Staal,
B. Kramarsky, et al.
1986.
Isolation of a new virus, HBLV, in patients with lymphoproliferative disorders.
Science
234:596-601 |
| 45. |
Schiewe, U.,
F. Neipel,
D. Schreiner, and B. Fleckenstein.
1994.
Structure and transcription of an immediate-early region in the human herpesvirus 6 genome.
J. Virol.
68:2978-2985 |
| 46. |
Seto, E.,
A. Usheva,
G. P. Zambetti,
J. Momand,
N. Horikoshi,
R. Weinmann,
A. J. Levine, and T. Shenk.
1992.
Wild-type p53 binds to the TATA-binding protein and represses transcription.
Proc. Natl. Acad. Sci. USA
89:12028-12032 |
| 47. |
Srivastava, A.,
E. W. Lusby, and K. I. Berns.
1983.
Nucleotide sequence and organization of the adeno-associated virus 2 genome.
J. Virol.
45:555-564 |
| 48. | Takeda, K., M. Haque, T. Sunagawa, T. Okuno, Y. Isegawa, and K. Yamanishi. 1997. Identification of a variant B-specific neutralizing epitope on glycoprotein H of human herpesvirus-6. J. Gen. Virol. 78:2171-2178[Abstract]. |
| 49. | Thomson, B. J., S. Efstathiou, and R. W. Honess. 1991. Acquisition of the human adeno-associated virus type-2 rep gene by human herpesvirus type-6. Nature 351:78-80[CrossRef][Medline]. |
| 50. | Thomson, B. J., F. W. Weindler, D. Gray, V. Schwaab, and R. Heilbronn. 1994. Human herpesvirus 6 (HHV-6) is a helper virus for adeno-associated virus type 2 (AAV-2) and the AAV-2 rep gene homologue in HHV-6 can mediate AAV-2 DNA replication and regulate gene expression. Virology 204:304-311[CrossRef][Medline]. |
| 51. | Torelli, G., P. Barozzi, R. Marasca, P. Cocconcelli, E. Merelli, L. Ceccherini-Nelli, S. Ferrari, and M. Luppi. 1995. Targeted integration of human herpesvirus 6 in the p arm of chromosome 17 of human peripheral blood mononuclear cells in vivo. J. Med. Virol. 46:178-188[Medline]. |
| 52. | Verrijzer, C. P., and R. Tjian. 1996. TAFs mediate transcriptional activation and promoter selectivity. Trends Biochem. Sci. 21:338-342[CrossRef][Medline]. |
| 53. |
Weger, S.,
M. Wendland,
J. A. Kleinschmidt, and R. Heilbronn.
1999.
The adeno-associated virus type 2 regulatory proteins rep78 and rep68 interact with the transcriptional coactivator PC4.
J. Virol.
73:260-269 |
| 54. | Yamanishi, K., T. Okuno, K. Shiraki, M. Takahashi, T. Kondo, Y. Asano, and T. Kurata. 1988. Identification of human herpesvirus-6 as a causal agent for exanthem subitum. Lancet i:1065-1067. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»