Previous Article | Next Article 
Journal of Virology, July 2000, p. 6039-6044, Vol. 74, No. 13
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Binding of Tat to TAR and Recruitment of Positive Transcription
Elongation Factor b Occur Independently in Bovine
Immunodeficiency Virus
Matjaz
Barboric,
Ran
Taube,
Nada
Nekrep,
Koh
Fujinaga, and
B. Matija
Peterlin*
Howard Hughes Medical Institute, Departments
of Medicine and Microbiology and Immunology, University of
California, San Francisco, California 94143-0703
Received 21 January 2000/Accepted 4 April 2000
 |
ABSTRACT |
Transcriptional transactivators (Tat) from many lentiviruses
interact with their cognate transactivation response RNA structures (TAR) to increase rates of elongation rather than initiation of transcription. For several of them, the complex of Tat and a
species-specific cyclin T1 must be formed before the binding to TAR can
occur with high affinity and specificity. In sharp contrast, Tat from
the bovine immunodeficiency virus (BIV) binds to its TAR without the help of the cyclin T1. This binding depends on the upper stem and 5'
bulge, but not the central loop in TAR. Moreover, cyclins T1 from
different species can mediate effects of this Tat in cells. Unlike the
situation with other lentiviruses, Tat transactivation can be rescued
simply by linking a heterologous promoter to TAR in permissive cells.
Thus, lentiviruses have evolved different strategies to recruit Tat and
the positive transcription elongation factor b to their promoters, and
interactions between Tat and TAR are independent from those between Tat
and the cyclin T1 in BIV.
 |
INTRODUCTION |
The bovine immunodeficiency virus
(BIV) causes lymphocytosis, lymphadenopathy, progressive weakness, and
central nervous system disorders in infected cattle (11,
19). It is a member of the genus Lentivirinae, which
contains evolutionarily distinct retroviruses with a complex
genomic organization. In this respect, BIV is very similar to
primate lentiviruses, the human immunodeficiency virus types 1 and 2 (HIV-1 and HIV-2, respectively), as well as the simian immunodeficiency
virus (SIV). Besides genes encoding obligate retrovirus Gag, Pol, and
Env polyproteins, BIV codes for six accessory proteins, which are
called Tat, Rev, Vif, Vpy, Vpw, and Tmx (18). These proteins
play a critical role in the viral replicative cycle and contribute
significantly to the pathogenesis of BIV (19).
The transcriptional transactivator Tat is essential for lentiviral
replication (22). It increases levels of gene expression from the viral 5' long terminal repeat (LTR). Based on their mechanism of action, Tat proteins can be categorized into two distinct groups. The first group contains visna virus (7, 8, 21), feline immunodeficiency virus (FIV) (9, 29), and caprine arthritis encephalitis virus (CAEV) (28). In these viruses, the
transactivation response RNA structure (TAR) is absent from the 5' end
of viral transcripts. Therefore, these Tat proteins increase
transcription in a TAR-independent manner. In sharp contrast, HIV-1,
HIV-2, SIV (22), BIV (12, 24, 25), the Jembrana
disease virus (JDV) (5), and equine infectious anemia virus
(EIAV) (10) depend completely on promoter proximal TAR
elements. That Tat proteins from this group affect gene expression via
RNA makes them unique among other eukaryotic transcriptional
activators, which act via DNA. Moreover, these Tat proteins increase
rates of elongation rather than initiation of transcription by RNA
polymerase II (22).
Recently, the cellular target for Tat from HIV-1 (hTat) was identified.
It is called the positive transcription elongation factor b (P-TEFb)
and consists of the cyclin-dependent kinase 9 (CDK9) and cyclin T1
(26, 32). The interaction of hTat with the human cyclin T1
(hCycT1) increases greatly the affinity and specificity of the binding
between hTat and hTAR (2, 15, 16, 23). In this manner, hTat
could position P-TEFb in closer proximity to the C-terminal domain
(CTD) of RNA polymerase II. As a consequence, the phosphorylation of
the CTD and possibly other targets leads to the efficient elongation of
viral transcription (31). Much support for the notion that
cyclins T1 are obligate binding partners of different Tat proteins came
from studies of the species specificity of Tat transactivation, which
had been observed with hTat and Tat from EIAV (eTat). For example,
although hTat functions poorly in murine cells, its effects are rescued by the exogenous expression of the hCycT1 (2, 15, 16, 23). Similarly, the transactivation of the EIAV LTR (eLTR) by eTat is
impaired and rescued by the exogenous expression of equine cyclin T1
(eCycT1) in human cells (1, 30). In summary, these findings
suggest that the formation of a tripartite complex consisting of Tat,
cyclin T1, and TAR, rather than the interaction between Tat and TAR
alone, determines the host range of hTat or eTat transactivation (31).
In sharp contrast, Tat from BIV (bTat) can function in most cells. bTat
transactivates strongly the BIV LTR (bLTR) in virally permissive canine
(Cf2Th) cells and virally nonpermissive human (HeLa), monkey (CV1), and
murine (3T3) cells (5, 13). Surprisingly, bTat functions
poorly and independently of bTAR in virally permissive bovine (BLAC-20)
and lapine (EREp) cells (13). Nevertheless, bTat should
interact with P-TEFb. First, it shares similar sequence and domain
organization with hTat (12, 24). Second, its longer arginine-rich RNA-binding motif (ARM) binds with high affinity and
specificity to the upper stem and 5' bulge in bTAR in vitro (6,
25, 27). Of note and unlike hTat, the central loop in bTAR is not
essential for the function of bTat in vivo (3, 6). Thus, a
combinatorial surface between bTat and a cyclin T1 might not be
required for productive interactions between bTat and bTAR.
In this report, we asked several questions. Does bTat target the same
host factors as other lentivirus Tat proteins for its role in viral
transcription? Why can bTat transactivate the bLTR in cells from all
species tested and yet not function in other cells? To these ends, we
first demonstrated that bTat binds to cyclins T1 from different
species. Using serum-starved canine cells, all of these cyclins T1
could cooperate with bTat. Next, the inability of bTat to function in
lapine cells reflected low levels of transcription. Finally, bTat bound
strongly to bTAR by itself, and hCycT1 did not increase this
interaction. This binding required the upper stem and 5' bulge, but not
the central loop in bTAR. In summary, bTAR serves as a docking site for
bTat, which recruits P-TEFb independently to elongate viral transcription.
 |
MATERIALS AND METHODS |
Cell culture.
HeLa and COS cells, lapine EREp, and canine
Cf2Th cells were grown in Dulbecco's modified Eagle's medium (DMEM).
Media were supplemented with 10% fetal bovine serum (FBS), 100 mM
L-glutamine, and 50 µg each of penicillin and
streptomycin per ml. For serum starvation, Cf2Th cells were maintained
in DMEM without FBS.
Plasmid construction.
The plasmid targets pHIVSCAT and
pBLTRCAT have been described previously (13, 14). To
construct pHIVSCATbTAR, pHIVSCAT was cleaved at unique BglII
and SacI sites, and bTAR sequence was inserted into pHIVSCAT
by using two complementary bTAR oligonucleotides with BglII
and SacI sites. The following oligonucleotide sequences were
designed: 5'-GATCTGGCTCGTGTAGCTCATTAGCTCCGAGCCGAGCT-3' and 5'-CGGCTCGGAGCTAATGAGCTACACGAGCCA-3'. For mammalian
expression, bTat (amino acids [aa] 1 to 103) was amplified by PCR
from BIV127 provirus. Subsequently, the fragment was subcloned into
NcoI-EcoRI-cleaved modified pEFBOS in
frame with an N-terminal Myc-epitope tag (pbTat). The resulting
construct was named pbTat. Myc-tagged hCycT1 and eCycT1 (aa 1 to 300)
were expressed from phCycT1-300 and peCycT1-300, respectively.
N-terminally Myc-epitope-tagged mouse cyclin T1 (mCycT1) was expressed
from pmCycT1-300. pGST-bTat for bacterial expression was made by using
a PCR-amplified bTat gene (aa 1 to 103), which was ligated in-frame
with the coding region of the glutathione S-transferase
(GST) gene into SmaI-EcoRI-cleaved pGEX-2TK (Amersham Pharmacia Biotech, Piscataway, N.J.). Wild-type (nucleotides 1 to 28) or mutant TAR sequences derived from the sequence of BIV127
provirus were cloned into pGEM-3Z
(EcoRI-HindIII; Promega, Madison, Wis.) with
oligonucleotides containing EcoRI (5') and HindIII (3') linkers.
The oligonucleotide sequences were as follows: 1WT,
5'AATTCGGGTCTC TCTGGGGCTCGTGTAGCTCATTAGCTCCGAGCCCTAGGGAACCCA
3'; 2WT, 5'AGCTTGGGTTCCCTAGGGCTCGGAGCTAATGAGCTACACGAGCCCCAGAGAGACCCG 3'; 1
S,
5'AATTCGGGTCTCTCTGGGGCTCGTGTACCTCATTAGGTCCGAGCCCTAGGGAACCCA 3';
2
S,
5'AGCTT GGGTTCCCTAGGGCTCGGACCTAATGAGGTACACGAGCCCCAGAG AGACCCG
3'; 1
L,
5'AATTCGGGTCTCTCTGGGGCTCGTGTAGCTTGCCAGCTCCGAGCCCTAGGGAACCCA 3';
2
L,
5'AGCTTGGGTTCCCTAGGGCTCGGAGCTGGCAAGCTACACGAGCCCCAGAGAGACCCG3'.
pGEM3WT codes for the wild-type TAR RNA. pGEM3

S encodes TAR RNA with
a nucleotide pair mutation G14:C23 to C14:G23 in the
stem region of TAR
RNA (
6). pGEM3

L mutant TAR RNA has replaced
the CAUU
nucleotide sequence of the loop with UGCC sequence (
6).
All
constructs used in this study were confirmed by DNA
sequencing.
Transient transfection, CAT assays, and Western blotting.
All cell lines used in this study were transfected with Lipofectamine
according to the manufacturer's instructions (Gibco-BRL, Rockville,
Md.). For chloramphenicol acetyltransferase (CAT) enzymatic assays,
Cf2Th, HeLa, and EREp cells were seeded into 50-mm-diameter petri
dishes 12 h prior to transfections. Serum starvation of Cf2Th
cells was performed 10 h before the transfection and continued until CAT assays. Cells were harvested 48 h posttransfection, and
CAT activity was determined as described previously (14). Western blotting was done with a rabbit polyclonal anti-Myc antibody (c-Myc [A-14]; Santa Cruz Biotechnology, Santa Cruz, Calif.) followed by horseradish peroxidase-conjugated donkey anti-rabbit immunoglobulin secondary antibody (1:2,000; Amersham Life Science, Inc., Arlington Heights, Ill.). Blots were developed by chemiluminescence assay (NEN
Life Science Products, Boston, Mass.).
In vitro transcription and translation.
The plasmids
containing hCycT1-300, eCycT1-300, and mCycT1-300 were transcribed and
translated in vitro with the TnT T7 coupled reticulocyte lysate system
(Promega, Madison, Wis.) in the presence of 35S-labeled
cysteine (NEN Life Science Products, Boston, Mass.).
Protein purification.
Hybrid GST-CycT and GST-bTat proteins
were expressed in the BL21(DE3)pLysS strain of Escherichia
coli (Novagen, Madison, Wis.) after a 4-h induction with 1 mM
isopropyl-
-D-thiogalactopyranoside (IPTG) and purified
from total cell lysates by using glutathione-Sepharose beads
(Amersham-Pharmacia Biotech, Piscataway, N.J.). For the electrophoretic
mobility shift assay (EMSA), purified GST-CycT proteins were eluted
from glutathione-Sepharose beads by using 10 mM reduced glutathione in
50 mM Tris-HCl (pH 8.0) and subjected to dialysis against a buffer
containing 30 mM Tris-HCl (pH 8.0), 70 mM KCl, and 1 mM dithiothreitol
(DTT). The hybrid GST-bTat protein bound to glutathione-Sepharose beads
was eluted with 50 mM reduced glutathione in 200 mM Tris-HCl (pH 8.0)
and 500 mM NaCl. Dialysis and concentration were performed by using
Centricon concentrators (cutoff, 10 kDa; Amicon, Inc., Beverly, Mass.). The purity of eluted proteins was determined by Coomassie blue staining
of sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and the concentration was determined by a protein assay kit
(Bio-Rad, Hercules, Calif.).
In vitro binding assays.
Binding assays between different
cyclins T1, synthesized in the coupled transcription and translation
system, and chimeric GST-bTat were performed as follows. Ten
microliters of each cyclin T1 was incubated with 10 µg of the GST or
GST-bTat protein, bound to glutathione-Sepharose beads, in 300 µl of
binding buffer (20 mM HEPES [pH 7.8], 0.5% NP-40, 1% Triton X-100,
2 mM DTT, 0.1% bovine serum albumin, 0.05% SDS, 20 µM
ZnCl2, 100 mM KCl) at 4°C for 4 h. After the
incubation, GST-coupled beads were washed four times with the binding
buffer. Bound proteins were eluted from beads by boiling in equal
volumes of 2× SDS loading buffer, resolved by SDS-PAGE (10%
polyacrylamide), and analyzed by autoradiography.
Preparation of TAR RNA and EMSA.
-32P-labeled
TAR and unlabeled TAR transcripts were prepared with in
vitro-transcribing linearized plasmid templates
(HindIII) with T7 RNA polymerase in the presence or
absence of [
-32P]UTP by using the MEGAshortscript T7
kit (Ambion, Austin, Tex.). Reaction mixtures were incubated at 37°C
for 1 h, and the DNA template was treated with 2 U of DNase I. TAR
RNAs were purified with a phenol-chloroform-isoamyl alcohol mixture
(Boehringer, Mannheim, Germany) and precipitated with ethanol. Prior to
use, the RNA pellet was dissolved in 0.1 M NaCl and applied to a G-25 spin column (Boehringer). EMSA (16-µl final reaction volume) was carried out in the binding buffer (30 mM Tris-HCl [pH 8.0], 70 mM
KCl, 0.01% NP-40, 5.5 mM MgCl2, 1 mM DTT, 12% glycerol)
and contained 20,000 to 50,000 cpm of
-32P-labeled TAR
RNA as well as 850 ng of poly(dI-dC) and 500 ng of poly(I-C) in the
presence or absence of excessive amounts of unlabeled TAR transcripts.
One microgram of purified GST, GST-hCycT, and/or 400 ng of GST-bTat (aa
1 to 103) was added to the reaction mixtures. The reaction mixtures
were incubated for 10 min at 30°C, and RNA-protein complexes were
separated on a prerun nondenaturing 6% Tris-glycine polyacrylamide gel
in 1× Tris-glycine buffer (4 W, 3.5 h at 4°C). Gels were dried
and then analyzed by autoradiography.
 |
RESULTS |
bTat binds equivalently to cyclins T1 from different species in
vitro.
P-TEFb is the critical cellular target for hTat and eTat
transactivation. Therefore, bTat might also use the same cellular machinery to perform its function. Moreover, the broad host range of
bTat transactivation could reflect the binding of bTat to cyclins T1
from different species. To date, hCycT1, functionally indistinguishable canine T1 (cCycT1) and eCycT1, and mCycT1 have been isolated and characterized (31). To test our hypothesis, we performed GST pull down assays with the hybrid GST-bTat protein, which was expressed in E. coli, and hCycT1, eCycT1, and mCycT1, which were
transcribed and translated in vitro with the rabbit reticulocyte lysate
(Fig. 1). Since the N-terminal 300 residues in hCycT1 and eCycT1 support hTat and eTat transactivation,
respectively (1, 2, 15, 16, 23, 30), proteins of this size
were used in our binding experiments. Under stringent conditions, the
hybrid GST-bTat protein bound to all of these cyclins T1 (Fig. 1, lanes
3, 6, and 9). This binding was specific, since no interaction between
bacterially expressed GST and cyclins T1 was observed (Fig. 1, lanes 2, 5, and 8). The inputs of all cyclins T1 (Fig. 1, lanes 1, 4, and 7) and
the hybrid GST-bTat protein and GST alone (Fig. 1, lower panel, lanes 1 and 2) were comparable. Thus, bTat binds to regulatory subunits of
P-TEFb from different species in vitro.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 1.
The N-terminal 300 residues in hCycT1, eCycT1, and
mCycT1 bind to bTat in vitro. 35S-labeled hCycT1, eCycT1,
and mCycT1 were incubated with GST alone (lanes 2, 5, and 8) or with
the hybrid GST-bTat protein (lanes 3, 6, and 9) and selected on
glutathione-Sepharose beads. Bound cyclins T1 were separated on
SDS-PAGE and subjected to autoradiography. The input of each cyclin T1
was equal in all reactions and represented 25% of the amount used for
the binding assay (lanes 1, 4, and 7). The arrow to the left points to
cyclins T1. Twenty-five percent of the input GST alone (lane 1) and the
hybrid GST-bTat protein (lane 2) were comparable and are presented in
the Coomassie blue-stained SDS-PAGE panel at the bottom. Arrows to the
left indicate the presence of the hybrid proteins.
|
|
Given a stronger LTR, lapine cells support bTat
transactivation.
Having established that cyclins T1 from different
species bind to bTat in vitro and knowing that they are conserved from
Drosophila melanogaster to Homo sapiens, we were
intrigued by low levels of bTat transactivation in virally permissive
bovine BLAC-20 and lapine EREp cells (13). Although this
effect of bTat was described as being independent of bTAR, we wondered
if the absence of appropriate RNA tethering of bTat could play some
role in these cells. The other possibility was that insufficient bTAR
was synthesized so that bTat did not have enough target RNA for its
effects. To distinguish between these possibilities, we used two
different plasmid targets, which are presented schematically in Fig.
2A, and plasmid effectors that expressed
bTat. When bTat was coexpressed with the pBLTRCAT in EREp cells, only a
twofold increase in CAT enzymatic activity over basal levels was
observed (Fig. 2B, lanes 1 and 2). In sharp contrast, when the U3
region from bLTR was replaced with that from HIV-1 so that bTAR
remained (Fig. 2A, pHIVSCATbTAR), levels of transactivation increased
12-fold over basal values (Fig. 2B, lanes 3 and 4). When cyclins T1
from different species were coexpressed with pBLTRCAT and bTat, levels
of bTat transactivation were not affected (data not shown). We conclude
that the restriction to bTat transactivation does not map to the cyclin
T1, but to the strength of the promoter in EREp cells. These data
suggest that insufficient bTAR is synthesized as the substrate for bTat
in these cells.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 2.
bTat transactivation in lapine cells is inhibited by low
levels of basal transcription from bLTR. (A) Schematic
representation of plasmid targets. pBLTRCAT contains the CAT
reporter gene under the control of bLTR. pHIVSCATbTAR
contains the hLTR linked to bTAR instead of hTAR. pA represents
the polyadenylation signal. (B) bTat requires a strong promoter in
lapine EREp cells. Cells were transfected with 0.3 µg of
pBLTRCAT alone (lane 1, white bar) or together with 0.1 µg of
pbTat (lane 2, white bar). pHIVSCATbTAR (0.1 µg) was expressed
alone (lane 3, black bar) or together with 0.1 µg of pbTat (lane 4, black bar). Where no bTat was added, the amount of DNA was equilibrated
with 0.1 µg of pEFBOS (lanes 1 and 3, white and black
bars). The CAT enzymatic activity of pBLTRCAT or pHIVSCATbTAR alone was
set to 1. Standard errors of the mean from three independent
transfections are shown by error bars.
|
|
The exogenous expression of cyclins T1 from different species
restores bTat transactivation in serum-starved Cf2Th cells.
Next,
we performed a functional assay to prove that targeting different
cyclins T1 can support bTat transactivation in vivo. Since bTat can
function in cells from many different species (Fig. 2), classical
rescue experiments using different cyclins T1, like those for hTat or
eTat (1, 2, 15, 16, 23, 30), were not possible. For
example, the exogenous expression of hCycT1, eCycT1, and mCycT1 has
neither positive nor negative effects on bTat transactivation in canine
Cf2Th cells (data not shown). However, the state of activation and
proliferation of cells dictate levels of cyclin T1 (17, 20).
Consequently, blocking the progression of the cell cycle should reduce
levels of intracellular cyclin T1. Therefore, experiments in which
cyclins T1 were expressed exogenously were repeated with serum-starved
Cf2Th cells (Fig. 3A). In this system,
bTat transactivation dropped from 49-fold to 15-fold (Fig. 3A, compare
lanes 2 and 3). Importantly, the exogenous expression of hCycT1,
eCycT1, and mCycT1 restored bTat transactivation to levels observed
with the addition of serum (Fig. 3A, compare lanes 4 to 6 with lane 7).
All cyclins T1 were expressed at similar levels (Fig. 3B). In keeping
with our binding studies and coexpression data from many laboratories
(1, 2, 5, 13, 16, 23, 30), we conclude that different
cyclins T1 can form productive complexes with bTat and bTAR.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 3.
Cyclins T1 from different species increase bTat
transactivation in serum-starved Cf2Th cells. (A) bTat transactivates
bLTR via different cyclins T1. Cells were serum starved before and
after transfection (lanes 1, and lanes 3 to 6), before transfection
only (lane 7), or grown in the medium with serum (lane 2). pBLTRCAT
(0.3 µg) was expressed alone (lane 1, white bar) or together with 0.1 µg of pbTat (lanes 2 to 7). To bTat were added effector plasmids (1.0 µg) phCycT1, peCycT1, and pmCycT1 (lanes 4 to 6, striped bars). In
all transfections, the amount of DNA was equilibrated with
pEFBOS. Values are as in Fig. 2B. (B) Amounts of exogenously
expressed cyclins T1 determined by Western blotting. Numbers under the
Western blot correspond to lanes from the transient transfection assay
(A).
|
|
The formation of the complex between bTat and bTAR, which occurs
independently of the cyclin T1, explains the lack of species-specific
restriction to bTat transactivation.
Previous studies of different
lentivirus Tat proteins established that the binding of Tat to the
cyclin T1 is required for the formation of the tripartite complex
between Tat, cyclin T1, and TAR as well as efficient Tat
transactivation (31). It is also known that the ARM peptide
from bTat binds to bTAR with high affinity and specificity and that
mutations in the central loop in bTAR do not affect bTat
transactivation (3, 6, 25, 27). Since bTat binds to several
different cyclins T1, the simplest scenario to explain the broad host
range of bTat would have bTat bind to bTAR alone without the assistance
of any cyclin T1. To prove this hypothesis, an EMSA was performed with
bacterially expressed GST, as well as hybrid GST-hCycT1 and GST-bTat
proteins, and in vitro-transcribed
-32P-labeled or
unlabeled wild-type bTAR or mutated bTAR transcripts, which were
changed in the stem or central loop regions, respectively (Fig.
4). Neither GST alone nor the hybrid
GST-hCycT1 protein bound to the labeled probe (Fig. 4, lanes 2 and 3).
In sharp contrast, the hybrid GST-bTat protein bound strongly to bTAR
(Fig. 4, lane 4). The addition of the hybrid GST-hCycT1 protein did not
improve the binding of the hybrid GST-bTat protein to bTAR, but
resulted in a tripartite complex between the hybrid GST-CycT1 and
GST-bTat proteins and bTAR (Fig. 4, lane 5). To demonstrate the
specificity of this binding, competition experiments using unlabeled
bTAR transcripts were performed. Excessive amounts of the unlabeled wild-type bTAR RNA completely blocked the formation of RNA-protein complexes (Fig. 4, lane 6). Importantly, the unlabeled mutant bTAR RNA,
which changed the stem, did not compete with the labeled wild-type bTAR
(Fig. 4, lane 7), confirming that this region is critical for the
binding of bTat to bTAR (6, 25, 27). Moreover, the unlabeled
bTAR RNA with mutations in the central loop had the same effect as the
wild-type bTAR (Fig. 4, compare lanes 6 and 8), which agrees with
previous functional studies (3, 6). Thus, these results
demonstrate that bTat does not need the assistance of the cyclin T1 for
its binding to bTAR, which explains the lack of species specificity in
bTat transactivation.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 4.
bTat binds to the upper stem and 5' bulge in bTAR
without the help of the cyclin T1. Where indicated, bacterially
expressed GST, hybrid GST-bTat, and GST-hCycT1 proteins were used in
EMSA. -32P-labeled wild-type bTAR was present in all
reactions. For competition experiments, three different unlabeled
competitor bTAR transcripts were used: bTARWT (lane 6), bTAR S, which
is mutated in the upper stem in bTAR (lane 7), and bTAR L, which is
mutated in the central loop in bTAR (lane 8). The resulting RNA-protein
complexes were resolved on a 6% nondenaturing polyacrylamide gel and
analyzed by autoradiography. Arrows to the right indicate the free bTAR
probe and the presence of distinct RNA-protein complexes.
|
|
 |
DISCUSSION |
In this study, we demonstrated that the lack of species-specific
restriction to bTat transactivation reflects the ability of bTat to
bind efficiently to bTAR without the cyclin T1. Thus, bTat bound
equally well to bTAR in the presence and absence of hCycT1. Moreover,
this binding did not require the central loop and was specific to the
upper stem and 5' bulge in bTAR. Additionally, bTat bound
indistinguishably to cyclins T1 from three different species, and they
all restored levels of bTat transactivation in serum-starved canine
Cf2Th cells. Finally, the lack of robust and bTAR-dependent effects
could be blamed on the weakness of the bLTR in lapine EREp cells.
Linking the hLTR to bTAR rescued the function of bTat in these cells.
We conclude that the binding of bTat to bTAR is independent of the
recruitment of a species-specific CycT1 and thus P-TEFb to the bLTR.
Since bTat functions in cells from many species, there was no need to
isolate the bovine cyclin T1 (bCycT1). Moreover, comparisons between
known cyclins T1 revealed that their sequences are 90% identical
(1, 2, 15, 16, 23, 30). Because bTat contains an identical
array of cysteines to that in hTat and only the 300 N-terminal residues
of the cyclins T1 were required for our functional and binding studies,
the binding of bTat to bCycT1 is expected to resemble that of hTat to
hCycT1. In this tripartite complex, the ARM of bTat binds to the upper
stem and 5' bulge in bTAR. The activation domain of bTat then binds
independently to the surface of bCycT1, which is located on the side
opposite to where CDK9 binds. Thus, bTat brings P-TEFb to bTAR for the
transcriptional needs of BIV. Moreover, we resolved the dilemma of why
some cells that are permissive for BIV infection do not support bTat
transactivation (13). In these cells, the bLTR is a weak
promoter and probably does not synthesize sufficient amounts of bTAR
transcripts. However, linking a heterologous promoter to bTAR rescued
bTat transactivation. Thus, the inability of bTat to function in these
cells is not due to the defective formation of the tripartite complex
between bTat, P-TEFb, and bTAR. That these cells can be infected by BIV also suggests that virions or other virus proteins activate the integrated bLTR and facilitate the full replicative cycle of the virus.
JDV, which is another bovine lentivirus, is closely related to BIV and
has a broad host range, and its Tat (jTat) has properties similar to
those of bTat (4, 5). jTat not only activates its cognate
LTR (jLTR), but also activates LTRs from other lentiviruses (5). Moreover, residues of the ARM from bTat and jTat are
very similar, and neither protein requires the central loop in TAR for
efficient transactivation (5). Taken together, these data lead us to speculate that jTat also binds to the upper stem and 5'
bulge in jTAR independently of bCycT1 and that these interactions between jTat and jTAR and jTat and bCycT1 occur independently. Thus,
BIV and JDV are more closely related to each other than other
lentiviruses and have adopted similar strategies for efficient replication in their primary host.
The model that emerges from this study is that unlike other Tat
proteins, bTat binds to a stable structure and specific nucleotides in
bTAR independently of the cyclin T1 (Fig.
5). This binding is of sufficient
affinity and specificity to bring P-TEFb to the transcription complex.
In this scenario, bCycT1 plays no role in the RNA tethering of bTat.
This RNA-protein interaction is simpler than those that require a
combinatorial surface between Tat and the cyclin T1. With HIV-1, hTat
binds to the upper stem and 5' bulge, and hCycT1 binds to the central
loop in hTAR. Only the preassembled complex between hTat and P-TEFb
interacts productively with hTAR (2, 15, 16, 23). With EIAV,
no binding of eTat alone to RNA could be demonstrated. However, the
complex of eTat and eCycT1 binds to the central loop in eTAR (1,
30). These combinatorial surfaces might have increased the
specificity of the RNA tethering by different Tat proteins.
Alternatively, they might have allowed for a more precise positioning
of CDK9 with respect to its cellular targets on the transcription
complex. Nevertheless, because both the N-terminal and C-terminal
-helices in the cyclin box of cyclins T1 are required for the
binding of hTat and eTat and these three Tat proteins are so similar,
we expect that the same binding surface is utilized by bTat
(22). Future mutageneses and structural studies will reveal
the validity of this model and suggest possible inhibitors of Tat
transactivation.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 5.
Model for the formation of the tripartite complex
between bTat, P-TEFb, and bTAR. The binding of bTat to bTAR (step 1)
and the recruitment of P-TEFb (step 2) occur independently in BIV. The
ARM from bTat interacts with the upper stem and 5' bulge, but not the
central loop, in bTAR. The activation domain from bTat binds to the
cyclin T1. The binding of bTat to bTAR is of sufficient affinity and
specificity to recruit P-TEFb from different species to bLTR for
efficient elongation of transcription.
|
|
 |
ACKNOWLEDGMENTS |
We thank Paula Zupanc-Ecimovic and Michael Armanini for expert
secretarial assistance; Steven E. Fong for providing pBLTRCAT, pBIV127,
and Cf2Th and EREp cell lines; Nabila Jabrane-Ferrat and Christoph
Turck for help with experiments; and other members of our laboratory
for comments on the manuscript.
Koh Fujinaga is supported by a fellowship from the Universitywide AIDS
Research Program. This work was supported by the Howard Hughes Medical Institute.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Room N215,
UCSF-Mt. Zion Cancer Center, 2340 Sutter St., San Francisco, CA 94115. Phone: (415) 502-1905. Fax: (415) 502-1901. E-mail:
matija{at}itsa.ucsf.edu.
 |
REFERENCES |
| 1.
|
Bieniasz, P. D.,
T. A. Grdina,
H. P. Bogerd, and B. R. Cullen.
1999.
Highly divergent lentiviral Tat proteins activate viral gene expression by a common mechanism.
Mol. Cell. Biol.
19:4592-4599[Abstract/Free Full Text].
|
| 2.
|
Bieniasz, P. D.,
T. A. Grdina,
H. P. Bogerd, and B. R. Cullen.
1998.
Recruitment of a protein complex containing Tat and cyclin T1 to TAR governs the species specificity of HIV-1 Tat.
EMBO J.
17:7056-7065[CrossRef][Medline].
|
| 3.
|
Carpenter, S.,
S. A. Nadin-Davis,
Y. Wannemuehler, and J. A. Roth.
1993.
Identification of transactivation-response sequences in the long terminal repeat of bovine immunodeficiency-like virus.
J. Virol.
67:4399-4403[Abstract/Free Full Text].
|
| 4.
|
Chadwick, B. J.,
R. J. Coelen,
G. E. Wilcox,
L. M. Sammels, and G. Kertayadnya.
1995.
Nucleotide sequence analysis of Jembrana disease virus: a bovine lentivirus associated with an acute disease syndrome.
J. Gen. Virol.
76:1637-1650[Abstract/Free Full Text].
|
| 5.
|
Chen, H.,
G. Wilcox,
G. Kertayadnya, and C. Wood.
1999.
Characterization of the Jembrana disease virus tat gene and the cis- and trans-regulatory elements in its long terminal repeats.
J. Virol.
73:658-666[Abstract/Free Full Text].
|
| 6.
|
Chen, L., and A. D. Frankel.
1994.
An RNA-binding peptide from bovine immunodeficiency virus Tat protein recognizes an unusual RNA structure.
Biochemistry
33:2708-2715[CrossRef][Medline].
|
| 7.
|
Clements, J. E.
1991.
Genetic regulation of the ungulate lentiviruses.
AIDS
5:S15-S20.
|
| 8.
|
Davis, J. L., and J. E. Clements.
1989.
Characterization of a cDNA clone encoding the visna virus transactivating protein.
Proc. Natl. Acad. Sci. USA
86:414-418[Abstract/Free Full Text].
|
| 9.
|
de Parseval, A., and J. H. Elder.
1999.
Demonstration that orf2 encodes the feline immunodeficiency virus transactivating (Tat) protein and characterization of a unique gene product with partial Rev activity.
J. Virol.
73:608-617[Abstract/Free Full Text].
|
| 10.
|
Dorn, P. L., and D. Derse.
1988.
cis- and trans-acting regulation of gene expression of equine infectious anemia virus.
J. Virol.
62:3522-3526[Abstract/Free Full Text].
|
| 11.
|
Egberink, H., and M. C. Horzinek.
1992.
Animal immunodeficiency viruses.
Vet. Microbiol.
33:311-331[CrossRef][Medline].
|
| 12.
|
Fong, S. E.,
J. D. Greenwood,
J. C. Williamson,
D. Derse,
L. A. Pallansch,
T. Copeland,
L. Rasmussen,
A. Mentzer,
K. Nagashima,
G. Tobin, and M. A. Gonda.
1997.
Bovine immunodeficiency virus tat gene: cloning of two distinct cDNAs and identification, characterization, and immunolocalization of the tat gene products.
Virology
233:339-357[CrossRef][Medline].
|
| 13.
|
Fong, S. E.,
L. A. Pallansch,
J. A. Mikovits,
C. S. Lackman-Smith,
F. W. Ruscetti, and M. A. Gonda.
1995.
cis-acting regulatory elements in the bovine immunodeficiency virus long terminal repeat.
Virology
209:604-614[CrossRef][Medline].
|
| 14.
|
Fujinaga, K.,
T. P. Cujec,
J. Peng,
J. Garriga,
D. H. Price,
X. Graña, and B. M. Peterlin.
1998.
The ability of positive transcription elongation factor b to transactivate human immunodeficiency virus transcription depends on a functional kinase domain, cyclin T1, and Tat.
J. Virol.
72:7154-7159[Abstract/Free Full Text].
|
| 15.
|
Fujinaga, K.,
R. Taube,
J. Wimmer,
T. P. Cujec, and B. M. Peterlin.
1999.
Interactions between human cyclin T, Tat, and the transactivation response element (TAR) are disrupted by a cysteine to tyrosine substitution found in mouse cyclin T.
Proc. Natl. Acad. Sci. USA
96:1285-1290[Abstract/Free Full Text].
|
| 16.
|
Garber, M. E.,
P. Wei,
V. N. KewalRamani,
T. P. Mayall,
C. H. Herrmann,
A. P. Rice,
D. R. Littman, and K. A. Jones.
1998.
The interaction between HIV-1 Tat and human cyclin T1 requires zinc and a critical cysteine residue that is not conserved in the murine CycT1 protein.
Genes Dev.
12:3512-3527[Abstract/Free Full Text].
|
| 17.
|
Garriga, J.,
J. Peng,
M. Parreno,
D. H. Price,
E. E. Henderson, and X. Grana.
1998.
Upregulation of cyclin T1/CDK9 complexes during T cell activation.
Oncogene
17:3093-4002[CrossRef][Medline].
|
| 18.
|
Garvey, K. J.,
M. S. Oberste,
J. E. Elser,
M. J. Braun, and M. A. Gonda.
1990.
Nucleotide sequence and genome organization of biologically active proviruses of the bovine immunodeficiency-like virus.
Virology
175:391-409[CrossRef][Medline].
|
| 19.
|
Gonda, M. A.,
D. G. Luther,
S. E. Fong, and G. J. Tobin.
1994.
Bovine immunodeficiency virus: molecular biology and virus-host interactions.
Virus Res.
32:155-181[CrossRef][Medline].
|
| 20.
|
Herrmann, C. H.,
R. G. Carroll,
P. Wei,
K. A. Jones, and A. P. Rice.
1998.
Tat-associated kinase, TAK, activity is regulated by distinct mechanisms in peripheral blood lymphocytes and promonocytic cell lines.
J. Virol.
72:9881-9888[Abstract/Free Full Text].
|
| 21.
|
Hess, J. L.,
J. E. Clements, and O. Narayan.
1985.
cis- and trans-acting transcriptional regulation of visna virus.
Science
229:482-485[Abstract/Free Full Text].
|
| 22.
|
Jones, K. A., and B. M. Peterlin.
1994.
Control of RNA initiation and elongation at the HIV-1 promoter.
Annu. Rev. Biochem.
63:717-743[CrossRef][Medline].
|
| 23.
|
Kwak, Y. T.,
D. Ivanov,
J. Guo,
E. Nee, and R. B. Gaynor.
1999.
Role of the human and murine cyclin T proteins in regulating HIV-1 tat-activation.
J. Mol. Biol.
288:57-69[CrossRef][Medline].
|
| 24.
|
Liu, Z.-Q.,
D. Sheridan, and C. Wood.
1992.
Identification and characterization of the bovine immunodeficiency-like virus tat gene.
J. Virol.
66:5137-5140[Abstract/Free Full Text].
|
| 25.
|
Pallansch, L. A.,
C. S. Lackman-Smith, and M. A. Gonda.
1992.
Bovine immunodeficiency-like virus encodes factors which trans activate the long terminal repeat.
J. Virol.
66:2647-2652[Abstract/Free Full Text].
|
| 26.
|
Peng, J.,
Y. Zhu,
J. T. Milton, and D. H. Price.
1998.
Identification of multiple cyclin subunits of human P-TEFb.
Genes Dev.
12:755-762[Abstract/Free Full Text].
|
| 27.
|
Puglisi, J. D.,
L. Chen,
S. Blanchard, and A. D. Frankel.
1995.
Solution structure of a bovine immunodeficiency virus Tat-TAR peptide-RNA complex.
Science
270:1200-1203[Abstract/Free Full Text].
|
| 28.
|
Saltarelli, M. J.,
R. Schoborg,
S. L. Gdovin, and J. E. Clements.
1993.
The CAEV tat gene trans-activates the viral LTR and is necessary for efficient viral replication.
Virology
197:35-44[CrossRef][Medline].
|
| 29.
|
Sparger, E. E.,
B. L. Shacklett,
L. Renshaw-Gegg,
P. A. Barry,
N. C. Pedersen,
J. H. Elder, and P. A. Luciw.
1992.
Regulation of gene expression directed by the long terminal repeat of the feline immunodeficiency virus.
Virology
187:165-177[CrossRef][Medline].
|
| 30.
|
Taube, R.,
K. Fujinaga,
D. Irwin,
J. Wimmer,
M. Geyer, and B. M. Peterlin.
2000.
Interactions between equine cyclin T1, Tat, and TAR are disrupted by a leucine-to-valine substitution found in human cyclin T1.
J. Virol.
74:892-898[Abstract/Free Full Text].
|
| 31.
|
Taube, R.,
K. Fujinaga,
J. Wimmer,
M. Barboric, and B. M. Peterlin.
1999.
Tat transactivation: a model for the regulation of eukaryotic transcriptional elongation.
Virology
264:245-253[CrossRef][Medline].
|
| 32.
|
Wei, P.,
M. E. Garber,
S. M. Fang,
W. H. Fischer, and K. A. Jones.
1998.
A novel CDK9-associated C-type cyclin interacts directly with HIV-1 Tat and mediates its high-affinity, loop-specific binding to TAR RNA.
Cell
92:451-462[CrossRef][Medline].
|
Journal of Virology, July 2000, p. 6039-6044, Vol. 74, No. 13
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Gomez Corredor, A., Archambault, D.
(2009). The Bovine Immunodeficiency Virus Rev Protein: Identification of a Novel Lentiviral Bipartite Nuclear Localization Signal Harboring an Atypical Spacer Sequence. J. Virol.
83: 12842-12853
[Abstract]
[Full Text]
-
D'Orso, I., Frankel, A. D.
(2009). Tat acetylation modulates assembly of a viral-host RNA-protein transcription complex. Proc. Natl. Acad. Sci. USA
106: 3101-3106
[Abstract]
[Full Text]
-
Xie, B., Calabro, V., Wainberg, M. A., Frankel, A. D.
(2004). Selection of TAR RNA-Binding Chameleon Peptides by Using a Retroviral Replication System. J. Virol.
78: 1456-1463
[Abstract]
[Full Text]
-
Xie, B., Wainberg, M. A., Frankel, A. D.
(2003). Replication of Human Immunodeficiency Viruses Engineered with Heterologous Tat-Transactivation Response Element Interactions. J. Virol.
77: 1984-1991
[Abstract]
[Full Text]
-
Fujinaga, K., Irwin, D., Taube, R., Zhang, F., Geyer, M., Peterlin, B. M.
(2002). A Minimal Chimera of Human Cyclin T1 and Tat Binds TAR and Activates Human Immunodeficiency Virus Transcription in Murine Cells. J. Virol.
76: 12934-12939
[Abstract]
[Full Text]
-
Liou, L.-Y., Herrmann, C. H., Rice, A. P.
(2002). Transient Induction of Cyclin T1 during Human Macrophage Differentiation Regulates Human Immunodeficiency Virus Type 1 Tat Transactivation Function. J. Virol.
76: 10579-10587
[Abstract]
[Full Text]
-
Martin-Serrano, J., Li, K., Bieniasz, P. D.
(2002). Cyclin T1 Expression Is Mediated by a Complex and Constitutively Active Promoter and Does Not Limit Human Immunodeficiency Virus Type 1 Tat Function in Unstimulated Primary Lymphocytes. J. Virol.
76: 208-219
[Abstract]
[Full Text]