Previous Article | Next Article 
Journal of Virology, July 2000, p. 5968-5981, Vol. 74, No. 13
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Immune Responses and Viral Replication in Long-Term
Inapparent Carrier Ponies Inoculated with Equine Infectious
Anemia Virus
Scott A.
Hammond,1,
Feng
Li,1
Brian M.
McKeon Sr.,1
Sheila J.
Cook,2
Charles J.
Issel,2 and
Ronald C.
Montelaro1,*
Department of Molecular Genetics and
Biochemistry, School of Medicine, University of Pittsburgh,
Pittsburgh, Pennsylvania 15261,1 and Gluck
Equine Research Center, Department of Veterinary Science,
University of Kentucky, Lexington, Kentucky 405462
Received 21 July 1999/Accepted 10 April 2000
 |
ABSTRACT |
Persistent infection of equids by equine infectious anemia virus
(EIAV) is typically characterized by a progression during the first
year postinfection from chronic disease with recurring disease cycles
to a long-term asymptomatic infection that is maintained indefinitely.
The goal of the current study was to perform a comprehensive longitudinal analysis of the course of virus infection and development of host immunity in experimentally infected horses as they progressed from chronic disease to long-term inapparent carriage. We previously described the evolution of EIAV genomic quasispecies (C. Leroux, C. J. Issel, and R. C. Montelaro, J. Virol.
71:9627-9639, 1997) and host immune responses (S. A. Hammond,
S. J. Cook, D. L. Lichtenstein, C. J. Issel, and R. C. Montelaro, J. Virol. 71:3840-3852, 1997) in four
experimentally infected ponies during sequential disease episodes
associated with chronic disease during the first 10 months postinfection. In the current study, we extended the studies of these
experimentally infected ponies to 3 years postinfection to characterize
the levels of virus replication and development of host immune
responses associated with the progression from chronic disease to
long-term inapparent infection. The results of these studies revealed
over a 103-fold difference in the steady-state levels of
plasma viral RNA detected during long-term inapparent infection that
correlated with the severity of chronic disease, indicating different
levels of control of virus replication during long-term inapparent
infections. Detailed analyses of antibody and cellular immune responses
in all four ponies over the 3-year course of infection revealed a similar evolution during the first year postinfection of robust humoral
and cellular immunity that then remained relatively constant during
long-term inapparent infection. These observations indicate that immune
parameters that have previously been correlated with EIAV vaccine
protection fail to provide reliable immune correlates of control of
virus replication or clinical outcome in experimental infections. Thus,
these data emphasize the differences between immunity to virus exposure
and immune control of an established viral infection and further
emphasize the need to develop and evaluate novel immunoassays to define
reliable immune correlates to vaccine and infection immunity, respectively.
 |
INTRODUCTION |
Equine infectious anemia virus
(EIAV) infection of horses provides a novel system in which to examine
the natural immunological control of lentivirus replication and disease
(reviewed in reference 27). Horses infected in the
field or experimentally with EIAV typically develop within the first
month postinfection acute disease (fever, diarrhea, lethargy, anemia,
and thrombocytopenia) and an associated high level of infectious plasma
viremia. Following this initial clinical episode that lasts 3 to 5 days, most infected horses experience recurring disease episodes and
associated waves of viremia at irregular intervals. This cyclic disease
is designated chronic EIA. The frequency of disease episodes and the
severity of clinical symptoms typically decrease with time and are
usually completely resolved by 1 year postinfection. At this time,
persistently infected horses become clinically asymptomatic for EIA and
negative for infectious plasma viremia, indicating a highly effective
control of virus replication and disease. In fact, most horses infected by EIAV are inapparent carriers that will remain asymptomatic for the
remainder of their life span of up to 20 years. Thus, the EIAV system
offers a uniquely dynamic model in which to examine changes in viral
replication and host immune responses during the clearly demarcated
progression from chronic disease to a long-term inapparent infection.
A number of studies indicate that the eventual control of EIAV
replication and disease in horses is mediated by host immune responses
that control virus infection to subclinical levels and not by the
attenuation of the virus during persistent infection. For example,
transfer of whole blood from long-term inapparent carriers to naive
horses reproducibly causes infection and disease (11), and
experimental immune suppression of inapparent carriers can cause
recrudescence of disease and associated viremia (19, 43).
Recent analyses of EIAV infection in long-term apparent carriers by
genetic (8, 40) and in situ (29) methods
demonstrate persistent low levels of virus infection and replication
predominantly in tissue macrophages, with negligible virus detectable
in plasma or peripheral blood cells. These studies indicate that the
progression from chronic EIA to inapparent infection is associated with
the evolution of highly effective and enduring host immune responses that are able to suppress EIAV replication, despite the array of
persistence and escape mechanisms employed by this virus. A major goal
of EIAV research during the past decade has been to elucidate the
specificity of the humoral and cellular immune responses that achieve
control of virus replication in inapparent carriers. This information
then can provide immunological goals for EIAV vaccine development and
serve as a model to guide the design of vaccine strategies for other
animal and human lentiviruses.
To date, there have been only limited analyses of the development of
host immune responses to experimental EIAV infection, and most of these
studies have focused on the development of antibody and cellular immune
responses during chronic EIA, with only limited cross-sectional
analyses of long-term inapparent carriers. In general, these studies
indicate that chronic disease is associated with the rapid development
of high-titer broadly neutralizing serum antibodies (28, 31,
32) and robust cellular immunity (6, 25, 45), but not
with the presence of antibody-dependent cellular cytotoxicity (41,
42). While these analyses identify various immune responses to
EIAV infection, they do not define specific immune mechanisms
responsible for the resolution of individual disease cycles or for the
progression to long-term asymptomatic infections. An additional
limitation of these EIAV immunology studies is the lack of a
comprehensive longitudinal characterization of the evolution of humoral
and cellular immune responses in a single set of experimentally
infected ponies during the progression from chronic EIA to long-term
asymptomatic infection.
To perform a comprehensive longitudinal analysis of host immune
responses to EIAV infection, we initiated an experiment to characterize
in detail virus infection and host immune responses in a group of four
ponies experimentally infected with our reference EIAVPV
strain (6, 20). Two of the experimentally infected ponies
experienced multiple disease cycles characteristic of chronic EIA,
while two ponies became asymptomatic after the initial acute disease
episode. Thus, the four experimental infections fortuitously separated
clinically into two distinct groups, providing a novel opportunity to
assess the evolution of the virus infection and host immunity during
very different time frames for the establishment of long-term
asymptomatic infections. We previously reported on the evolution of
EIAV quasispecies during sequential febrile episodes associated with
chronic EIA in one of the experimentally infected ponies
(20). In addition, we characterized in detail the
development of humoral and cellular immune responses in all four
experimentally infected ponies during the first 10 months postinfection
to elucidate the changes in host immunity during chronic EIA
(6). The results of these studies revealed for the first
time a similar complex and lengthy maturation of humoral and cellular
immune responses during the first 10 months postinfection in all four
ponies, regardless of the clinical course of the infection. This
maturation of immune responses to EIAV appears to be common to the
early stages of lentivirus infections, including simian
immunodeficiency virus (SIV) or simian-human immunodeficiency virus
infection of monkeys and human immunodeficiency virus type 1 (HIV-1)
infection of humans (2, 3). Moreover, we have demonstrated
further that the serological parameters that define mature and immature
immune responses can also be useful in distinguishing protective and nonprotective immune responses to experimental EIAV (7) and SIV (3) vaccines.
While these studies provide fundamental information on the development
of EIAV-specific immune responses during the early stages of persistent
infection and chronic EIA, they do not address the important issue of
the nature of immune responses that are associated with the enduring
suppression of virus replication and disease in long-term inapparent
carriers. Thus, we have continued to monitor virus infection and to
analyze antibody and cellular immune responses in the four
experimentally infected ponies for up to 3 years postinfection. We
describe here the first comprehensive longitudinal study of persistent
EIAV infection in experimentally infected ponies during the progression
from chronic disease to maintenance of long-term inapparent infections.
The results of these longitudinal studies over a 3-year period reveal
fundamental new information about the steady-state levels of EIAV
replication in inapparent carriers, the kinetics of immune maturation
to persistent infection, and the nature of the host immunity associated
with long-term asymptomatic infections.
 |
MATERIALS AND METHODS |
Experimental subjects.
All animals in this study were
outbred, mixed-breed ponies and maintained as previously documented
(12). The early chronic stages of infection by EIAV in these
ponies have been detailed previously (6). Clinical EIA
episodes were determined by clinical impressions (temperature and
platelet count) in combination with the presence of infectious plasma
viremia (6, 44).
Virus strains.
Three reference strains of EIAV were utilized
in this study. EIAVPr is the prototype, nonpathogenic, cell
culture-adapted strain of EIAV initially derived by cell adaptation of
the Wyoming strain of EIAV (23). The EIAVPV
biological clone is a pathogenic and antigenic variant derived from
EIAVPr (37) and used as a standard challenge in
vaccine trials (5, 12, 33, 44). EIAVWSU5 is a
virulent strain of EIAV generated using procedures described elsewhere
to produce EIAVPV (25). EIAVPV,
EIAVPr, and EIAVWSU5 envelope glycoproteins are
very closely related, having <1% divergence at the amino acid level.
Immunological analyses.
Concanavalin A (ConA) enzyme-linked
immunosorbent assay (ELISA) procedures for analyzing antibody titer,
avidity, and conformational dependence have been described in detail
previously (6). Assays for measuring EIAV-specific
neutralizing antibody activity, lymphoproliferation, and cytolytic T
lymphocytes (CTL) were conducted as previously detailed (6).
Isotyping of the EIAV-specific serum antibodies were conducted as
described for the ConA ELISA listed in reference 6,
except that the secondary antibodies used were polyclonal goat serum
coupled with horseradish peroxidase and having specificity for equine
immunoglobulin Ga (IgGa), IgGb, IgGc, IgG(T), or IgM (Bethyl
Laboratories, Montgomery, Tex.).
Immunoadsorption of isotypic antibodies.
Removal of equine
IgGa and/or IgGb from experimental serum samples was performed using
Sepharose beads covalently coupled with sheep anti-horse IgGa (4.55 mg
of IgG/ml of gel) or sheep anti-horse IgGb (3.8 mg of IgG/ml of gel)
purchased from Bethyl Laboratories. Briefly, 250 µl of immunosorbents
was added to 700 µl of each serum sample at room temperature for 30 min. Beads were pelleted, and the supernatant of serum was transferred
to a fresh tube. The addition of immunosorbent to serum was performed seven times to effectively remove the isotypic IgG from each sample. ConA ELISAs were conducted to confirm the removal of each isotypic IgG
and to measure the remaining EIAV-specific antibody levels for IgG,
IgGa, and IgGb.
Quantitation of virus RNA levels in plasma.
Semiquantitative
measurements of viral genomic RNA molecules present per milliliter of
plasma were conducted as described previously (21). Briefly,
plasma virus pelleting by ultracentrifugation and viral RNA extraction
using RNAzol were performed (22). A single-tube reaction for
cDNA synthesis and PCR amplification using the Promega Access reverse
transcription-PCR (RT-PCR) system (Promega) was utilized. The RT-PCRs
were conducted using 4 µl of plasma viral RNA sample as directed by
the manufacturer, using the EIAV gag-specific primer Gag 34 (GCTGACTCTTCTGTTGTATCG) for both RT and PCR and an EIAV
gag-specific primer, Gag 11 (ATGTATGCTTGCAGAGACATTG), for PCR only. First-strand cDNA synthesis occurred for 45 min at
48°C, and denaturation occurred at 94°C for 2 min. Second-strand cDNA synthesis and DNA amplification used the following cycle conditions: 30 s at 94°C, 30 s at 60°C, and 30 s at
68°C for 40 cycles; 7 min at 68°C for 1 cycle; and holding at
4°C. RT-PCR products were separated by electrophoresis in a 2%
agarose gel. Gels were stained in pH 8.0 Tris-acetate-EDTA buffer
containing a dilution of 1:10,000 SYBR Green I stock solution
(Molecular Probes, Eugene, Oreg.) for 45 min. The intensity of each
band was quantified using a PhosphorImager (Molecular Dynamics,
Sunnyvale, Calif.) and the analytical software ImageQuant (Molecular
Dynamics). Estimation of the number of viral genomic RNA molecules per
milliliter of plasma was based on linear regression analysis of a
standard curve on known amounts of synthetic RNA prepared by in vitro
transcription with a T7 MEGAscript kit (Ambion, Austin, Tex.). The
standard RNA curve was linear in the range of 100 molecules as a lower limit and 106 molecules as an upper limit.
 |
RESULTS |
Experimental EIAV infection of outbred ponies.
Four outbred
ponies were experimentally infected with 103 50% tissue
culture infective doses (TCID50) of EIAVPV. The
clinical progression and immunological analyses of these experimental
infections during the early acute and chronic stages of disease have
been documented up to 10 months post-virus infection (6). We
have continued to monitor these animals for up to 3 years after
infection. The results of these long-term observations revealed that,
after resolution of the initial febrile episode by 3 weeks
postinfection, the ponies separated into two groups based on the
clinical observations of temperature and platelet count. Two ponies,
561 and 562, were observed to have only one EIA-related clinical
episode, at about 17 days postinfection, and then remained clinically
asymptomatic throughout the rest of the study period (Fig.
1B and 2B
and Table 1). The remaining two ponies,
564 and 567, had recurring fevers, typical of chronic EIA, with each
pony experiencing a total of six fevers within 1 to 2 years
postinfection (Fig. 3B and
4B and Table 1). Pony 564 cycled through
six EIA episodes within a 13-month period and had fevers occurring on
days 18, 34, 80, 106, 336, and 377 post-virus infection. Pony 564 was
asymptomatic the last 23 months of observation. Pony 567 had six
clinical episodes associated with EIA occurring over a 2-year span and
on days 19, 40, 223, 258, 640, and 729 post-virus infection. Pony 567 was asymptomatic for the last 12 months during this study. All EIA
febrile episodes listed above coincided with characteristic
thrombocytopenia (panels A in Fig. 1 to 4) and the ability to isolate
infectious virus from plasma (103.5 to 105.5
TCID50 per ml) (Table 1). Attempts to isolate infectious
virus from plasma samples taken during periods of asymptomatic
infections, either between disease cycles or during long-term
inapparent infections, were uniformly negative (data not shown), in
agreement with previous reports of stringent control of EIAV
replication during afebrile periods (16, 18, 29, 38).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 1.
Clinical course and dynamics of virus replication in
pony 561 experimentally infected with EIAV. Shown are platelet counts
per microliter of whole blood (A), daily rectal temperatures (B), and
virus RNA molecules per milliliter of plasma (C) from pony 561 experimentally infected with EIAV. The pony was experimentally infected
with 103 TCID50 of EIAVPV on day 0 and observed for 3 years. Rectal temperatures in excess of 39.2°C, as
denoted by the dashed line in panel B, were considered EIA episodes
only in conjunction with a reduction in the number of circulating
platelets and with the presence of infectious virus cultured from
plasma collected during the febrile episode (Table 1). Infectious virus
could be cultured only during EIA episodes and not during the
asymptomatic periods of the infection. The dashed line in panel A marks
the platelet count, 105,000/µl, at which thrombocytopenia has been
clinically defined. The single EIA febrile episode is marked with an
arrow in panel A and identified with roman numeral I. Viral RNA
molecules per milliliter of plasma were quantitated for a single day
every 4 months postinfection and during the EIA-related febrile
episode. Viral RNA levels below 100 copies per ml are indicated with
asterisks.
|
|

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 2.
Clinical course and dynamics of virus replication in
pony 562 experimentally infected with EIAV. Shown are platelet counts
per microliter of whole blood (A), daily rectal temperatures (B), and
virus RNA molecules per milliliter of plasma (C) from pony 562 experimentally infected with EIAV. The single EIA febrile episode is
marked with an arrow in panel A and identified with roman numeral I. See the Fig. 1 legend for criteria used to designate an EIA-related
disease episode. Viral RNA molecules per milliliter of plasma were
quantitated for a single day every 4 months postinfection and during
the EIA-related febrile episode. Viral RNA levels below 100 copies per
ml are indicated with asterisks.
|
|

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 3.
Clinical course and dynamics of virus replication in
pony 564 experimentally infected with EIAV. Shown are platelet counts
per microliter of whole blood (A), daily rectal temperatures (B), and
virus RNA molecules per milliliter of plasma (C) from pony 564 experimentally infected with EIAV. EIA febrile episodes for the pony
are marked with an arrow in panel A and individually identified with
consecutive roman numerals I through VI. See the Fig. 1 legend for
criteria used to designate an EIA-related disease episode. Viral RNA
molecules per milliliter of plasma were quantitated for a single day
every 4 months postinfection and during each EIA-related febrile
episode.
|
|

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 4.
Clinical course and dynamics of virus replication in
pony 567 experimentally infected with EIAV. Shown are platelet counts
per microliter of whole blood (A), daily rectal temperatures (B), and
virus RNA molecules per milliliter of plasma (C) from pony 567 experimentally infected with EIAV. EIA febrile episodes for the pony
are marked with an arrow in panel A and individually identified with
consecutive roman numerals I through VI. See the Fig. 1 legend for
criteria used to designate an EIA-related disease episode. Viral RNA
molecules per milliliter of plasma were quantitated for a single day
every 4 months postinfection and during each EIA-related febrile
episode.
|
|
Dynamics of virus replication measured by RT-PCR assays of plasma
viral RNA.
The levels of virus replication during experimental
EIAV infections have typically been measured using assays of plasma
virus infectivity in cell culture, as noted above. However, these
measurements of viral replication levels are complicated by the
presence of neutralizing antibodies that may mask virus particles in
plasma samples. With the recent development in our lab of a
nonradioactive semiquantitative RT-PCR assay for EIAV genomic RNA
(21, 26), we were able for the first time to monitor the
dynamics of virus replication by quantifying viral genomic RNA in the
plasma of the experimentally infected ponies as they progressed from
chronic disease to long-term inapparent infections. Thus, EIAV genomic RNA levels in the plasma of each pony were measured during febrile episodes associated with chronic disease and then every 4 months during
long-term asymptomatic infections over the 3-year observation period
(panels C in Fig. 1 to 4). The results of these assays typically
detected 108 to 109 copies of viral genomic RNA
per ml of plasma during each disease episode, consistent with the high
levels of infectious virus detected in the plasma during febrile
episodes (Table 1). However, the plasma RNA analyses revealed for the
first time a marked difference in the levels of virus replication
associated with asymptomatic infections. The separation of infected
ponies into two clinically distinct groups was further demonstrated by
the quantitation of virus genomic RNA present in the plasma of each
pony. Concurring with the lack of recurring clinical cycles in ponies
561 and 562, minimal (several hundred RNA copies per ml) to
undetectable amounts of virus genomic RNA could be detected in these
two ponies at all time points after the initial febrile episode (Fig.
1C and 2C). In distinct contrast, greater amounts (>104
RNA copies per ml) of virus RNA could be measured for almost every time
point sampled for ponies 564 and 567. Interestingly, however, the
levels of plasma RNA detected in ponies 564 and 567 at various times
during long-term asymptomatic infection generally ranged from
104 to 105 copies per ml, indicating relatively
high levels of EIAV replication in these inapparent carriers. Thus,
these results demonstrate that long-term inapparent carriers of EIAV,
while remaining asymptomatic, can differ substantially in the level of
control of virus replication. These observations provide new insights
into virus-host dynamics that have not been previously revealed by
measurements of infectious virus in plasma of inapparent carriers,
presumably due to the inhibitory effect of broadly neutralizing serum
antibodies present in inapparent carriers.
Evolution of the humoral response to EIAV.
While previous
studies from our lab and others have focused on host immune responses
associated with chronic EIA, there has been to date no systematic
longitudinal analysis of changes in host immunity to EIAV during the
progression to and maintenance of long-term asymptomatic infections. As
described in the following three sections, the evolution of the humoral
immune response specific for EIAV was characterized using quantitative
assays including virus envelope-specific endpoint titer of total IgG,
IgM, and subclasses of IgG; qualitative assays of avidity index and
conformation dependence; and a functional assay which measured the
levels of virus neutralizing activity. These analyses were initiated to characterize antibody responses associated with long-term clinical latency and to compare the evolution of antibody responses in ponies
experiencing single or multiple EIA disease cycles.
(i) Quantitative analyses of the antibody response to EIAV
envelope.
Previous studies have documented the levels of total IgG
specific for envelope glycoproteins during the initial 10 months postinfection (6). Infected ponies seroconverted with
specificity for EIAV envelope proteins by 3 weeks postinfection and
reached steady-state levels within 2 to 3 months. Thereafter, levels of envelope-specific IgG remained consistent up to 10 months
postinfection. To extend and expand this initial analysis of antibody
responses to persistent EIAV infection in the four experimentally
infected ponies, we monitored over the 3-year observation period the
production of EIAV envelope-specific IgM, total IgG, and the subclasses
of IgG [IgGa, IgGb, IgGc, and IgG(T)] in a ConA ELISA (Fig.
5). Titers of envelope-specific IgM
reached maximum values at the time of seroconversion 3 weeks
postinfection in all ponies (Fig. 5A). Levels of IgM specific for
envelope gradually declined during the first 2 to 3 months with a
steady-state level of 1:102 to 1:103 that was
maintained for the remainder of the study. Both IgG and IgM levels
reached their respective set points at approximately the same time, 2 to 3 months postinfection, reflecting consistent levels of isotype
switching occurring from IgM to IgG in the ponies for antibodies
specific for EIAV envelope.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 5.
EIAV-specific endpoint titers of IgG, IgM, and isotypic
IgG in EIAV-infected ponies. By longitudinal analyses, the Env-specific
antibodies in ponies 561, 562, 564, and 567 experimentally infected
with EIAV were quantitated in a ConA ELISA as described in Materials
and Methods using secondary polyclonal antibodies specific for IgM,
IgG, IgGa, IgGb, IgGc, and IgG(T). The log10 of the
reciprocal dilution that was 2 standard deviations above background was
plotted for each time point.
|
|
Quantitative analyses of the endpoint titer of IgG specific for EIAV
envelope glycoproteins were performed for samples collected
from each
pony beyond the initial 10 months and up to 3 years
postinfection.
Levels of envelope-specific IgG as measured in
a ConA ELISA remained at
the steady-state levels established 2
to 3 months postinfection. The
IgG endpoint titer was maintained
in each pony within the range of
1:10
5 to 1:10
6 (Fig.
5A). Interestingly, the
levels of envelope-specific IgG
remained comparatively similar and
constant among the four infected
ponies throughout the entire 3-year
period of study, even though
they had dissimilar clinical responses and
levels of virus replication.
Thus, no association could be ascertained
between the overall
levels of antibody specific for envelope
glycoprotein produced
and the outward signs of clinical disease
(febrile episodes and
platelet reduction) or the levels of virus
replication, as measured
by levels of plasma viral
RNA.
Serum samples were next analyzed to quantitate the levels of each IgG
subclass with specificity for EIAV envelope glycoprotein.
Polyclonal anti-IgG subclass antibodies were used to distinguish
the
relative levels of envelope-specific antibody. Endpoint titers
of
envelope-specific IgGa mirrored the levels of total IgG with
maximum
dilutions of 1:10
5 to 1:10
6 reached within 2 to
3 months postinfection and remained constant
for the remainder of the
study (Fig.
5C). Envelope-specific IgGb
was observed by 3 weeks
postinfection, reached maximum levels
by 1 to 2 months postinfection,
and was consistently present during
the course of the study at titers
between 1:10
4 and 1:10
6 (Fig.
5D).
Envelope-specific IgGc was detected in three out of
the four ponies by
3 weeks postinfection and remained at lower
titers (generally less than
1:10
4) than did IgGa and IgGb (Fig.
5E). Levels of
envelope-specific
IgGc were more divergent among the four infected
ponies. In fact,
no significant amount of envelope-specific IgGc was
ever detected
in serum from pony 567, while IgGc levels in the other
three ponies
varied from 1:10
2 to 1:10
4 over
the observation period. All ponies had detectable IgG(T)
levels, first
observed at 3 weeks postinfection and maintained
at variable levels,
but always less than 1:10
4, throughout the entire study
period (Fig.
5F). These data demonstrate
that EIAV infection
of outbred ponies induced an envelope-specific
antibody response within
3 weeks postinfection characterized by
high levels of IgM that rapidly
switched isotype to predominantly
IgGa and IgGb, with minor levels of
IgGc and IgG(T). While the
levels of IgGa and IgGb increased to
steady-state levels within
1 month postinfection, the IgGc and IgG(T)
levels tended to fluctuate
over the 3-year observation period. The
quantitative measurements
of antibody responses to EIAV envelope
proteins appeared similar
in all four ponies, regardless of the number
of disease episodes,
indicating a lack of correlation between antibody
levels and clinical
progression.
(ii) Avidity and conformational dependence of EIAV
envelope-specific antibodies.
Using qualitative assays of antibody
avidity and conformational dependence, we previously demonstrated a
maturation envelope-specific antibody response to EIAV infection during
the first 10 months postinfection (6) and a correlation of
these antibody parameters with the efficacy of experimental EIAV
vaccines (7). Therefore, we next sought to utilize these
measurements of antibody avidity (Fig.
6A) and conformational dependence (Fig.
6B) to define the evolution of EIAV-specific antibody populations
during the progression from chronic EIA to long-term asymptomatic
infections. As reported previously, the initial envelope-specific
antibody responses within the first 2 months postinfection displayed
avidity values of less than 5%, despite reaching antibody endpoint
titers of about 1:105 (Fig. 6A). Thereafter, avidity values
gradually increased from low avidity (<30%) to high avidity (>50%),
until reaching an average value of 65% by 13 months postinfection that
was maintained for the remainder of the observation period. The
longitudinal analyses of antibody conformational dependence in the
total IgG population (Fig. 6B) revealed a progression of antibody
properties that paralleled the changes observed in antibody avidity. As
reported previously, the conformational dependence of envelope-specific
antibodies was determined to be less than 1.0 for the first 2 months
postinfection, indicating a predominance of antibody specific for
linear envelope determinants. The conformational dependence values
gradually increased over the first 10 months postinfection to a value
of about 1.5, reflecting a gradual increase in antibody directed to
conformationally dependent envelope determinants. Interestingly,
the conformational dependence value observed at 10 months postinfection
was maintained in three (561, 564, and 567) of the four ponies up to
the end of the 3-year observation period. In contrast, pony 562 antibody conformation continued to increase to a value of 2.0 at about 2 years postinfection, before declining to a steady-state level of 1.5, as observed for the other ponies.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 6.
Avidity and conformational dependence of Env-specific
IgG in EIAV-infected ponies. By longitudinal analyses, the avidity
index (A) and conformational dependence of Env-specific polyclonal IgG
(B) were measured in a ConA ELISA as described in Materials and Methods
for ponies 561, 562, 564, and 567. (A) Avidity index measurements are
presented as percentages of the antibody-antigen complexes resistant to
washes with 8 M urea. (B) Conformation ratio was calculated by
measuring antibody reactivities against native EIAVPV
envelope glycoproteins and against denatured envelope glycoproteins
prepared by an initial urea denaturation followed by a reduction and
carboxymethylation of protein sulfhydryl groups. Conformation ratios of
>1.0 indicated antibody reactivities to epitopes which were
predominantly conformational in nature, while ratios of <1.0 denoted
antibody reactivities to epitopes which were predominantly linear in
form.
|
|
Taken together, these longitudinal analyses of antibody avidity and
conformational dependence demonstrate dynamic changes
in
envelope-specific antibody populations during the first year
postinfection, long after the quantitative levels of antibody
have
reached a maximum after 2 months postinfection. Following
the evolution
of antibody during the first year postinfection,
antibody responses
appear to reach steady-state values that are
maintained indefinitely in
longterm asymptomatic infections. Interestingly,
a similar maturation
of antibody responses is observed with all
four ponies, regardless of
the very different clinical progressions
or levels of virus replication
observed in these persistent infections.
Thus, the antibody avidity and
conformational dependence assays
do not appear to provide correlates of
disease progression or
virus replication during persistent infection,
although they have
proven useful in distinguishing experimental EIAV
vaccine efficacy
(
7).
(iii) EIAV-specific serum neutralizing activity.
To extend our
quantitative and qualitative characterization of the evolution of the
humoral immune responses to persistent EIAV infection, we analyzed the
functional capacity of immune serum to neutralize infectious
EIAVPV. Longitudinal serum samples collected over the
3-year observation period were analyzed in a quantitative infectious
center assay to estimate the dilution of serum which neutralized 50%
of the input virus; analyses during the acute and chronic periods of an
EIAV infection showed that neutralizing antibody activity developed
slowly, becoming detectable in vitro between 2 and 3 months
postinfection, and, in general, continued to increase in activity up to
10 months postinfection (6). The current extended
longitudinal analysis of serum neutralization activity in the four
infected ponies revealed that the levels of neutralizing antibody
continued to increase and reached a steady-state level approximately 2 years postinfection, having 50% titers at dilutions ranging between
1:200 and 1:400 (Fig. 7). The slow
evolution of neutralizing antibodies was similar in all four ponies,
regardless of the number of disease episodes or steady-state levels of
virus replication. In addition, it is important to note that serum
neutralization was first detected and increased in level after the
quantitative levels of antibody had reached maximum titer by 2 months
postinfection. This observation demonstrates further the dynamic
evolution in virus-specific antibody populations while relatively
constant levels of serum antibody to EIAV are maintained.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 7.
EIAV-Specific serum neutralizing activity in
EIAV-infected ponies. The mean reciprocal dilutions of serum which
neutralized 50% of input EIAVPV as measured in an
infectious center assay are presented for ponies 561, 562, 564, and
567. The number in parentheses in panel A indicates the reciprocal
dilution at which 50% neutralizing serum activity was measured for
data points that would not fit on the graphs using the presented scale.
Data presented are representative of three separate experiments.
Febrile episodes for each animal are indicated at the top of each panel
in consecutive roman numerals.
|
|
Previous studies have measured the levels of serum neutralization in
EIAV-infected horses (
17,
18,
31,
32,
36),
but to date there
has not been a thorough analysis of the contribution
of various
antibody subclasses to this neutralization activity.
With the
development of antibody reagents to distinguish equine
IgG subclasses,
we examined for the first time the role of different
Ig populations in
serum neutralization activity. Differences in
the levels of
neutralizing antibody activity present in the IgGa
and IgGb subclasses
of IgG were measured by a subtractive absorption
method to remove each
subclass of IgG from the immune serum before
testing. Serial absorption
of immune serum, using polyclonal subclass-specific
antibody covalently
coupled to Sepharose beads, effectively and
quantitatively removed each
subclass of IgG to background levels
as determined by ELISA (Table
2). EIAV-neutralizing activity
of immune
serum was still present after absorption with either
anti-IgGa or
anti-IgGb immunosorbent (Table
2). However, removal
of both IgGa and
IgGb from immune serum consistently eliminated
all detectable
virus-neutralizing activity (Table
2). These results
indicated that
EIAV-neutralizing antibody activity resided predominantly
with the IgGa
and IgGb subclasses of IgG. Furthermore, the data
implied that the
remaining antibody components [IgGc, IgG(T),
IgM, and IgA] did not
appear to have significant neutralizing
activity. Similar results were
obtained in absorption experiments
with serum samples collected at
various time points over the 3-year
observation period (data not
shown), indicating a consistent association
of IgGa and IgGb subclasses
with the observed serum neutralization.
CTL responses of EIAV-infected ponies.
To complement the
assays of antibody responses to persistent EIAV infection, we also
performed a longitudinal analysis of cell-mediated immune responses
specific for EIAV antigens for up to 3 years postinfection. The two
methods utilized to characterize the cell-mediated responses were
assays of T-cell proliferation to autologous EIAV-infected macrophages
and measurements of memory cytolytic T-lymphocyte (CTLm) activity
specific for EIAV Gag and Env antigens. In our previous analyses of
cellular immune responses during chronic EIA, it was shown that
T-lymphocyte proliferation to EIAV-infected macrophages was first
detected (stimulation index, >10) by 3 weeks postinfection, concurrent
with the acute febrile episode (6). During the initial 10 months postinfection, T-cell proliferative responses increased
gradually and reached a steady-state level (stimulation index between
20 and 60) by about 9 months postinfection (6). Extending
these longitudinal lymphoproliferation assays over the entire 3-year
observation period demonstrated relatively constant stimulation indices
ranging from 20 to 60 (data not shown). There was no significant
difference in the levels of proliferation detected in the four ponies,
indicating a lack of apparent correlation with clinical progression or
levels of virus replication.
EIAV-specific CTL were analyzed in a
51Cr release assay
against target cells that expressed both major histocompatibility
complex
class I and major histocompatibility complex class II to
measure
contributions of both CD4
+ and CD8
+
CTL. Antigens were introduced into the target cells by infection
with
recombinant vaccinia virus vectors encoding the genes for

-galactosidase, EIAV Gag, or EIAV Env. Attempts to detect CTL
activity in circulating peripheral blood mononuclear cells isolated
at
various time points during the course of the experimental infections
were uniformly negative, indicating a low level of circulating
CTL.
Therefore, effector T cells were stimulated in vitro with
autologous
macrophages infected with EIAV to activate and expand
the CTLm
populations specific for EIAV. The results of these studies
(Fig.
8) demonstrated detectable CTLm activity
in all ponies within
3 to 4 weeks postinfection, concurrent with the
initial acute
disease episode, as noted previously (
6).
After the initial
observation of CTLm activity, however, the levels and
specificity
of the observed CTL activity differed greatly among the
four infected
ponies. Pony 561 displayed minimal CTLm activity until
approximately
1 year postinfection (Fig.
8A). At about 12 months
postinfection,
both Gag- and Env-specific CTLm activities were first
detected,
and these CTLm activities remained at relatively high levels
at
all subsequent time points tested during the following 2 years
of
infection. Ponies 562 and 564 in general consistently displayed
significant levels of both Gag- and envelope-specific CTLm over
the
entire observation period (Fig.
8B and C). In contrast, pony
567 had
only envelope-specific CTLm activity (Fig.
8D) during
the first year
postinfection. Interestingly, both Gag- and envelope-specific
CTL
activities were then consistently detected up to 3 years postinfection.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 8.
EIAV-specific cytolytic T-cell activity in EIAV-infected
ponies. EIAV-specific CTLm activity was measured using fresh peripheral
blood mononuclear cells that had been activated and expanded by in
vitro coculture with recombinant human interleukin-2 and autologous
EIAV-infected macrophages from ponies 561, 562, 564, and 567. The net
specific lysis was determined by subtracting the level of lytic
activity of the T cells against autologous cells expressing a control
antigen, -galactosidase, from autologous cells expressing either
EIAV Gag (vac-gag) or Env (vac-env). The standard error of the mean
percent specific lysis was always less than 3%. Febrile episodes for
each animal are indicated at the top of each panel in consecutive roman
numerals.
|
|
The highly divergent patterns of CTL activity observed during the
3-year observation period fail to establish any correlation
between the
CTL levels and specificity and the severity of disease
(number of
disease cycles) resulting from the experimental infection.
For example,
ponies 561 and 562 both experienced only a single
acute disease
episode. However, only minor levels of CTLm activity
were detectable in
pony 561 during the first year postinfection,
while pony 562 consistently displayed high levels of CTLm starting
at 1 month
postinfection and continuing through the 3-year observation
period
(Fig.
8A and B). Similarly, the two ponies (564 and 567)
experiencing
six disease episodes displayed markedly different
levels of CTLm during
the first year postinfection (Fig.
8C and
D).
In contrast to the early stages of EIAV infection that were
characterized by diverse CTLm levels, there were uniformly high
levels
of Env- and Gag-specific CTLm detected in all of the infected
ponies
after 1 year postinfection. While it is tempting to correlate
high
levels of CTLm with the maintenance of long-term inapparent
infections,
it must be noted that pony 564 and pony 567 continued
to experience
disease episodes in the presence of high levels
of CTLm activity (Fig.
8C and
D).
 |
DISCUSSION |
The current study describes for the first time a comprehensive
longitudinal analysis of the dynamics of EIAV replication and host
immune responses in experimentally infected ponies as they progress
from chronic disease to long-term inapparent infections. These studies
complement and extend our previous analyses of the early stages of EIAV
infection in the same four experimentally infected ponies, including
the evolution of genomic quasispecies during sequential febrile
episodes (20) and the development of host immunity during
chronic EIA (6). The results of these analyses reveal a
number of new insights into virus-host interactions in this lentivirus
system but also raise a number of important questions that require
further investigation.
The first unexpected finding from the current study was the wide range
of virus replication levels observed in the four ponies during
long-term inapparent infections. Numerous studies from our lab
(6) and others (16, 18, 29, 38) have previously reported a lack of detectable infectious virus in the plasma of long-term inapparent carriers of EIAV. Based on these studies, it has
been assumed that host immune responses effectively suppress EIAV
replication to minimal levels during asymptomatic periods of chronic
EIA and in long-term inapparent infections. We recently used sensitive
PCR assays in a cross-sectional analysis to monitor the levels of virus
infection and replication in various tissues of experimentally infected
equids during the initial acute disease and during long-term inapparent
infections (8). The results of these studies indicated
plasma RNA levels of 105 to 108 copies per ml
during acute disease and less than 100 copies per ml in the two
inapparent carriers examined in the study. These latter observations
appear to support the concept that the lack of detectable infectious
virus in the plasma of inapparent carriers is in fact due to effective
suppression of virus replication and not only to the presence of high
levels of serum neutralizing antibodies. In contrast to these earlier
observations, however, the current study clearly demonstrates dramatic
differences in the steady-state levels of EIAV replication associated
with long-term inapparent infection, suggesting the development of very
different levels of immune control during persistent infection. While
all four of the ponies were consistently negative for infectious virus during asymptomatic infections, the two ponies that experienced only a
single disease episode typically contained an undetectable number to
<103 copies of RNA per ml, apparently reflecting effective
suppression of virus replication. In contrast, the other two ponies
that experienced multiple disease cycles usually displayed plasma RNA
levels ranging from 104 to 106 copies per ml
during the long-term asymptomatic infection, evidently indicating a
rather tenuous control of the viral infection to subclinical levels.
Although the number of animals used in the study is relatively small,
the range of steady-state virus replication levels revealed in this
study is similar to the range of steady-state virus replication levels
observed with SIV-infected monkeys (4, 9, 13) and
HIV-1-infected patients (35). As in these latter lentivirus
infections, the basis for the difference in steady-state EIAV
replication levels in inapparent carriers remains to be determined.
A primary focus of the current study was to characterize the
development of host immune responses during the progression of persistent EIAV infection from chronic EIA to long-term inapparent carriage, with the goal of identifying immune responses that establish sustained control of virus replication and disease. Our previous study
of humoral and cellular immune responses during the first 10 months
postinfection in these four experimental infections revealed a complex
and lengthy evolution of antibody and cellular immune responses,
regardless of the clinical course of the infection (6). The
current studies demonstrate a continued progression in EIAV-specific
antibody and CTL responses to about 12 months postinfection. At this
time, there appears to be an establishment of relatively stable humoral
and cellular immune responses that is maintained for the remainder of
the 3-year observation period. The virus-specific immunity is
associated with consistently high levels of serum antibodies that are
characterized by high avidity (>60%), predominant specificity for
conformational envelope determinants (conformational ratios, >1.5),
and effective virus neutralization. In addition, inapparent infections
are associated with consistently high levels of CTL activity to EIAV
Gag and envelope proteins. Thus, the immune responses associated with
the maintenance of long-term inapparent EIAV infections are in distinct
contrast to immune responses observed early during persistent
infections that are characterized by high-titer antibody that is of low
avidity and poorly neutralizing and relatively inconsistent CTL
activity (6). Taken together, these studies demonstrate a
maturation of immune responses to persistent EIAV infection that is
similar to that reported previously for SIV and simian-human
immunodeficiency virus infection of monkeys and HIV-1 infection of
humans (2). However, the 12-month time required for immune
maturation in the EIAV system appears to be substantially longer than
the average of 8 months required for immune maturation in the other
lentivirus systems. The basis for this difference is uncertain at this time.
While the current studies define the dynamics of immune maturation to
persistent EIAV infection, they do not appear to define specific immune
properties that correlate with the development of immune control of
virus replication and disease during a persistent infection. For
example, a similar evolution of humoral and cellular responses was
observed for all four experimentally infected ponies, regardless of the
number of disease cycles or the steady-state levels of virus
replication observed during the observation period. In certain cases,
cycles of disease were controlled in the early stages of infection in
the absence of detectable neutralizing antibodies or virus-specific
CTL, raising a number of questions about the mechanisms by which the
host pony establishes control of the aggressive virus replication
associated with disease cycles. In addition, pony 567 experienced
disease episodes at about 21 and 24 months postinfection, long after
the establishment of steady-state immunity (and maximum antibody and
cellular immunity) evident at 12 months postinfection. We have
previously demonstrated the utility of antibody avidity and
conformational dependence assays to differentiate immune responses to
experimental SIV and EIAV vaccines and to establish an association
between vaccine efficacy and the capacity of the immunization protocol
to induce mature antibody responses (3, 7). However, the
current studies indicate that, while these parameters may relate to
protection from virus exposure, they do not reliably correlate with
control of established EIAV infections. This discrepancy suggests
fundamental differences between immune mechanisms necessary to protect
against viral exposure and those required for controlling a persistent infection.
Despite extensive efforts to identify reliable immune predictors of
virus replication and clinical progression in HIV-1-infected patients
(2, 10) and SIV-infected monkeys (1-3, 15),
there has been to date no consensus definition of reliable immune
correlates. However, there have been recently a number of studies that
indicate the importance of virus-specific CD8+ CTL and
CD4+ lymphoproliferative responses in controlling
established lentivirus infections (14, 24, 30, 34, 35, 39).
The current longitudinal analysis of persistent EIAV infections does
reveal the maintenance of a high level of virus-specific
lymphoproliferation and CTL in long-term inapparent carriers,
consistent with the essential role of these cellular responses in
enduring suppression of virus replication and disease. However, it
should also be noted that long-term inapparent infections are equally
characterized by sustained high levels of EIAV-specific neutralizing
antibodies that may also contribute to the control of the persistent
infection. Thus, these studies emphasize the need to develop new assays
that can measure novel aspects of antibody and cellular immune
responses to persistent lentivirus infections that may then define
reliable immune correlates of control of lentivirus infections.
 |
ACKNOWLEDGMENTS |
This work was supported by NIH grant 5RO1 AI25810 and by funds
from the Lucille P. Markey Charitable Trust and the Kentucky Agricultural Experiment Station. S.A.H. was supported by NIH AIDS Training Grant 5T32 AI07487.
We thank Walter Storkus from the Department of Medicine at the
University of Pittsburgh School of Medicine for providing the recombinant human interleukin-2; Sekhar Chakrabarti and Bernard Moss of
the NIAID and the NIH AIDS Research and Reference Reagent Program for
the recombinant vaccinia virus vector vSC8; and Gary Thomas, Brian
Meade, and William Arnold at the University of Kentucky for excellent
care and handling of the animals.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: W1144 Biomedical
Science Tower, Department of Molecular Genetics and Biochemistry, School of Medicine, University of Pittsburgh, Pittsburgh, PA 15261. Phone: (412) 648-8869. Fax: (412) 383-8859. E-mail:
rmont{at}pop.pitt.edu.
Present address: IOMAI Corporation, Washington, DC 20037.
 |
REFERENCES |
| 1.
|
Clements, J. E.,
R. C. Montelaro,
M. C. Zink,
A. M. Amedee,
S. Miller,
A. M. Trichel,
B. Jagerski,
D. Hauer,
L. N. Martin,
R. P. Bohm, and M. Murphey-Corb.
1995.
Cross-protective immune responses induced in rhesus macaques by immunization with attenuated macrophage-tropic simian immunodeficiency virus.
J. Exp. Med.
69:2737-2744.
|
| 2.
|
Cole, K. S.,
M. Murphey-Corb,
O. Narayan,
S. V. Joag,
G. M. Shaw, and R. C. Montelaro.
1998.
Common themes of antibody maturation of simian immunodeficiency virus, simian-human immunodeficiency virus, and human immunodeficiency virus type 1 infections.
J. Virol.
72:7852-7859[Abstract/Free Full Text].
|
| 3.
|
Cole, K. S.,
J. L. Rowles,
B. A. Jagerski,
M. Murphey-Corb,
T. Unangst,
J. E. Clements,
J. Robinson,
M. S. Wyand,
R. C. Desrosiers, and R. C. Montelaro.
1997.
Evolution of envelope-specific antibody responses in monkeys experimentally infected or immunized with simian immunodeficiency virus and its association with the development of protective immunity.
J. Virol.
71:5069-5079[Abstract].
|
| 4.
|
Connor, R. I.,
D. C. Montefiori,
J. M. Binley,
J. P. Moore,
S. Bonhoeffer,
A. Gettie,
E. A. Fenamore,
K. E. Sheridan,
D. D. Ho,
P. J. Dailey, and P. A. Marx.
1998.
Temporal analyses of virus replication, immune responses, and efficacy in rhesus macaques immunized with a live, attenuated simian immunodeficiency virus vaccine.
J. Virol.
72:7501-7509[Abstract/Free Full Text].
|
| 5.
|
Hammond, S. A.,
S. J. Cook,
L. D. Falo, Jr.,
C. J. Issel, and R. C. Montelaro.
1999.
A particulate viral protein vaccine reduces viral load and delays progression to disease in immunized ponies challenged with equine infectious anemia virus.
Virology
254:37-49[CrossRef][Medline].
|
| 6.
|
Hammond, S. A.,
S. J. Cook,
D. L. Lichtenstein,
C. J. Issel, and R. C. Montelaro.
1997.
Maturation of the cellular and humoral immune responses to persistent infection in horses by equine infectious anemia virus is a complex and lengthy process.
J. Virol.
71:3840-3852[Abstract].
|
| 7.
|
Hammond, S. A.,
M. L. Raabe,
C. J. Issel, and R. C. Montelaro.
1999.
Evaluation of antibody parameters as potential correlates of protection or enhancement by experimental vaccines to equine infectious anemia virus.
Virology
262:416-430[CrossRef][Medline].
|
| 8.
|
Harrold, S.,
S. J. Cook,
R. F. Cook,
K. E. Rushlow,
C. J. Issel, and R. C. Montelaro.
2000.
Tissue sites of persistent infection and active replication of equine infectious anemia virus during acute disease and asymptomatic infection in experimentally infected equids.
J. Virol.
74:3112-3121[Abstract/Free Full Text].
|
| 9.
|
Hirsch, V. M.,
T. R. Fuerst,
G. Sutter,
M. W. Carroll,
L. C. Yang,
S. Goldstein,
M. Piatak, Jr.,
W. R. Elkins,
W. G. Alvord,
D. C. Montefiori,
B. Moss, and J. D. Lifson.
1996.
Patterns of viral replication correlate with outcome in simian immunodeficiency virus (SIV)-infected macaques: effect of prior immunization with a trivalent SIV vaccine in modified vaccinia virus Ankara.
J. Virol.
70:3741-3752[Abstract].
|
| 10.
|
Igarashi, T.,
C. Brown,
A. Azadegan,
N. Haigwood,
D. Dimitrov,
M. A. Martin, and R. Shibata.
1999.
Human immunodeficiency virus type 1 neutralizing antibodies accelerate clearance of cell-free virions from blood plasma.
Nat. Med.
5:211-216[CrossRef][Medline].
|
| 11.
|
Issel, C. J.,
W. V. Adams, Jr.,
L. Meek, and R. Ochoa.
1982.
Transmission of equine infectious anemia virus from horses without clinical signs of disease.
J. Am. Vet. Med. Assoc.
180:272-275[Medline].
|
| 12.
|
Issel, C. J.,
D. W. Horohov,
D. F. Lea,
W. V. Adams, Jr.,
S. D. Hagius,
J. M. McManus,
A. C. Allison, and R. C. Montelaro.
1992.
Efficacy of inactivated whole-virus and subunit vaccines in preventing infection and disease caused by equine infectious anemia virus.
J. Virol.
66:3398-3408[Abstract/Free Full Text].
|
| 13.
|
Joag, S. V.,
Z. Q. Liu,
E. B. Stephens,
M. S. Smith,
A. Kumar,
Z. Li,
C. Wang,
D. Sheffer,
F. Jia,
L. Foresman,
I. Adany,
J. Lifson,
H. M. McClure, and O. Narayan.
1998.
Oral immunization of macaques with attenuated vaccine virus induces protection against vaginally transmitted AIDS.
J. Virol.
72:9069-9078[Abstract/Free Full Text].
|
| 14.
|
Johnson, R. P.,
R. L. Glickman,
J. Q. Yang,
A. Kaur,
J. T. Dion,
M. J. Mulligan, and R. C. Desrosiers.
1997.
Induction of vigorous cytotoxic T-lymphocyte responses by live attenuated simian immunodeficiency virus.
J. Virol.
71:7711-7718[Abstract].
|
| 15.
|
Johnson, R. P.,
J. D. Lifson,
S. C. Czajak,
K. S. Cole,
K. H. Manson,
R. Glickman,
J. Yang,
D. C. Montefiori,
R. Montelaro,
M. S. Wyand, and R. C. Desrosiers.
1999.
Highly attenuated vaccine strains of simian immunodeficiency virus protect against vaginal challenge: inverse relationship of degree of protection with level of attenuation.
J. Virol.
73:4952-4961[Abstract/Free Full Text].
|
| 16.
|
Kim, C. H., and J. W. Casey.
1994.
In vivo replicative status and envelope heterogeneity of equine infectious anemia virus in an inapparent carrier.
J. Virol.
68:2777-2780[Abstract/Free Full Text].
|
| 17.
|
Kono, Y.
1988.
Antigenic variation of equine infectious anemia virus as detected by virus neutralization.
Arch. Virol.
98:91-97[CrossRef][Medline].
|
| 18.
|
Kono, Y.,
K. Hirasawa,
Y. Fukunaga, and T. Taniguchi.
1976.
Recrudescence of equine infectious anemia by treatment with immunosuppressive drugs.
Natl. Inst. Anim. Health Q.
16:8-15.
|
| 19.
|
Kono, Y.,
H. Sentsui, and Y. Murakami.
1976.
Development of specific in vitro lymphocyte stimulation responses in horses infected with equine infectious anemia virus.
Vet. Microbiol.
1:31-43.
|
| 20.
|
Leroux, C.,
C. J. Issel, and R. C. Montelaro.
1997.
Novel and dynamic evolution of equine infectious anemia virus genomic quasispecies associated with sequential disease cycles in an experimentally infected pony.
J. Virol.
71:9627-9639[Abstract].
|
| 21.
|
Li, F.,
C. Leroux,
J. K. Craigo,
S. J. Cook,
C. J. Issel, and R. C. Montelaro.
2000.
The S2 gene of equine infectious anemia virus is a highly conserved determinant of viral replication and virulence properties in experimentally infected ponies.
J. Virol.
74:573-579[Abstract/Free Full Text].
|
| 22.
|
Lichtenstein, D. L.,
K. E. Rushlow,
R. F. Cook,
M. L. Raabe,
C. J. Swardson,
G. J. Kociba,
C. J. Issel, and R. C. Montelaro.
1995.
Replication in vitro and in vivo of an equine infectious anemia virus mutant deficient in dUTPase activity.
J. Virol.
69:2881-2888[Abstract].
|
| 23.
|
Malmquist, W. A.,
D. Barnett, and C. S. Becvar.
1973.
Production of equine infectious anemia antigen in a persistently infected cell line.
Arch. Virol.
42:361-370.
|
| 24.
|
Matano, T.,
R. Shibata,
C. Siemon,
M. Connors,
H. C. Lane, and M. A. Martin.
1998.
Administration of an anti-CD8 monoclonal antibody interferes with the clearance of chimeric simian/human immunodeficiency virus during primary infections of rhesus macaques.
J. Virol.
72:164-169[Abstract/Free Full Text].
|
| 25.
|
McGuire, T. C.,
D. B. Tumas,
K. M. Byrne,
M. T. Hines,
S. R. Leib,
A. L. Brassfield,
K. I. O'Rourke, and L. E. Perryman.
1994.
Major histocompatibility complex-restricted CD8+ cytotoxic T lymphocytes from horses with equine infectious anemia virus recognize Env and Gag/PR proteins.
J. Virol.
68:1459-1467[Abstract/Free Full Text].
|
| 26.
|
Miller, K., and D. R. Storts.
1996.
An improved single buffer, two enzyme system for RT-PCR.
J. NIH Res.
8:48.
|
| 27.
|
Montelaro, R. C.,
J. M. Ball, and K. E. Rushlow.
1993.
Equine retroviruses, p. 257-360.
In
J. Levy (ed.), The Retroviridae, vol. 2. Plenum Press, New York, N.Y.
|
| 28.
|
Montelaro, R. C.,
M. West, and C. Issel.
1984.
Antigenic reactivity of the major glycoprotein of equine infectious anemia virus, a retrovirus.
Virology
136:368-374[CrossRef][Medline].
|
| 29.
|
Oaks, J. L.,
T. C. McGuire,
C. Ulibarri, and T. B. Crawford.
1998.
Equine infectious anemia virus is found in tissue macrophages during subclinical infection.
J. Virol.
72:7263-7269[Abstract/Free Full Text].
|
| 30.
|
Ogg, G. S.,
X. Jin,
S. Bonhoeffer,
P. R. Dunbar,
M. A. Nowak,
S. Monard,
J. P. Segal,
Y. Cao,
S. L. Rowland-Jones,
V. Cerundolo,
A. Hurley,
M. Markowitz,
D. D. Ho,
D. F. Nixon, and A. J. McMichael.
1998.
Quantitation of HIV-1-specific cytotoxic T lymphocytes and plasma load of viral RNA.
Science
279:2103-2106[Abstract/Free Full Text].
|
| 31.
|
O'Rourke, K.,
L. E. Perryman, and T. C. McGuire.
1988.
Antiviral, anti-glycoprotein and neutralizing antibodies in foals with equine infectious anaemia virus.
J. Gen. Virol.
69:667-674[Abstract/Free Full Text].
|
| 32.
|
O'Rourke, K. I.,
L. E. Perryman, and T. C. McGuire.
1989.
Cross-neutralizing and subclass characteristics of antibody from horses with equine infectious anemia virus.
Vet. Immunol. Immunopathol.
23:41-49[CrossRef][Medline].
|
| 33.
|
Raabe, M.,
C. Issel,
S. Cook,
R. Cook,
B. Woodson, and R. Montelaro.
1998.
Immunization with a recombinant envelope protein (rgp90) of EIAV produces a spectrum of vaccine efficacy ranging from lack of clinical disease to severe enhancement.
Virology
245:151-162[CrossRef][Medline].
|
| 34.
|
Rinaldo, C. R.,
P. Gupta,
X. L. Huang,
Z. Fan,
J. I. Mullins,
S. Gange,
H. Farzadegan,
R. Shankarappa,
A. Munoz, and J. B. Margolick.
1998.
Anti-HIV type 1 memory cytotoxic T lymphocyte responses associated with changes in CD4+ T cell numbers in progression of HIV type 1 infection.
AIDS Res. Hum. Retrovir.
14:1423-1433[Medline].
|
| 35.
|
Rosenberg, E. S.,
J. M. Billingsley,
A. M. Caliendo,
S. L. Boswell,
P. E. Sax,
S. A. Kalams, and B. D. Walker.
1997.
Vigorous HIV-1-specific CD4+ T cell responses associated with control of viremia.
Science
278:1447-1450[Abstract/Free Full Text].
|
| 36.
|
Rwambo, P. M.,
C. J. Issel,
W. Adams, Jr.,
K. A. Hussain,
M. Miller, and R. C. Montelaro.
1990.
Equine infectious anemia virus (EIAV) humoral responses of recipient ponies and antigenic variation during persistent infection.
Arch. Virol.
111:199-212[CrossRef][Medline].
|
| 37.
|
Rwambo, P. M.,
C. J. Issel,
K. A. Hussain, and R. C. Montelaro.
1990.
In vitro isolation of a neutralization escape mutant of equine infectious anemia virus (EIAV).
Arch. Virol.
111:275-280[CrossRef][Medline].
|
| 38.
|
Salinovich, O.,
S. L. Payne,
R. C. Montelaro,
K. A. Hussain,
C. J. Issel, and K. L. Schnorr.
1986.
Rapid emergence of novel antigenic and genetic variants of equine infectious anemia virus during persistent infection.
J. Virol.
57:71-80[Abstract/Free Full Text].
|
| 39.
|
Schmitz, J. E.,
M. J. Kuroda,
S. Santra,
V. G. Sasseville,
M. A. Simon,
M. A. Lifton,
P. Racz,
K. Tenner-Racz,
M. Dalesandro,
B. J. Scallon,
J. Ghrayeb,
M. A. Forman,
D. C. Montefiori,
E. P. Rieber,
N. L. Letvin, and K. A. Reimann.
1999.
Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes.
Science
283:857-860[Abstract/Free Full Text].
|
| 40.
|
Sellon, D. C.,
S. T. Perry,
L. Coggins, and F. J. Fuller.
1992.
Wild-type equine infectious anemia virus replicates in vivo predominantly in tissue macrophages, not in peripheral blood monocytes.
J. Virol.
66:5906-5913[Abstract/Free Full Text].
|
| 41.
|
Takahashi, H.,
J. Cohen,
A. Hosmalin,
K. Cease,
R. Houghten,
J. Cornette,
C. DeLisi,
B. Moss,
R. Germain, and J. Berzofsky.
1988.
An immunodominant epitope of the human immunodeficiency virus envelope glycoprotein gp160 recognized by class I major histocompatibility complex molecule-restricted murine cytotoxic T lymphocytes.
Proc. Natl. Acad. Sci. USA
85:3105-3109[Abstract/Free Full Text].
|
| 42.
|
Tschetter, J. R.,
K. M. Byrne,
L. E. Perryman, and T. C. McGuire.
1997.
Control of equine infectious anemia virus is not dependent on ADCC mediating antibodies.
Virology
230:275-280[CrossRef][Medline].
|
| 43.
|
Tumas, D. B.,
M. T. Hines,
L. E. Perryman,
W. C. Davis, and T. C. McGuire.
1994.
Corticosteroid immunosuppression and monoclonal antibody-mediated CD5+ T lymphocyte depletion in normal and equine infectious anaemia virus-carrier horses.
J. Gen. Virol.
75:959-968[Abstract/Free Full Text].
|
| 44.
|
Wang, S.,
K. Rushlow,
C. Issel,
R. Cook,
S. Cook,
M. Raabe,
Y.-H. Chong,
L. Costa, and R. C. Montelaro.
1994.
Enhancement of EIAV replication and disease by immunization with a baculovirus-expressed recombinant envelope surface glycoprotein.
Virology
199:247-251[CrossRef][Medline].
|
| 45.
|
Zhang, W.,
S. M. Lonning, and T. C. McGuire.
1998.
Gag protein epitopes recognized by ELA-A-restricted cytotoxic T lymphocytes from horses with long-term equine infectious anemia virus infection.
J. Virol.
72:9612-9620[Abstract/Free Full Text].
|
Journal of Virology, July 2000, p. 5968-5981, Vol. 74, No. 13
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Tallmadge, R. L., Brindley, M. A., Salmans, J., Mealey, R. H., Maury, W., Carpenter, S.
(2008). Development and Characterization of an Equine Infectious Anemia Virus Env-Pseudotyped Reporter Virus. CVI
15: 1138-1140
[Abstract]
[Full Text]
-
Cullinane, A., Quinlivan, M., Nelly, M., Patterson, H., Kenna, R., Garvey, M., Gildea, S., Lyons, P., Flynn, M., Galvin, P., Neylon, M., Jankowska, K.
(2007). Diagnosis of equine infectious anaemia during the 2006 outbreak in Ireland. Vet Rec.
161: 647-652
[Abstract]
[Full Text]
-
Craigo, J. K., Zhang, B., Barnes, S., Tagmyer, T. L., Cook, S. J., Issel, C. J., Montelaro, R. C.
(2007). Envelope variation as a primary determinant of lentiviral vaccine efficacy. Proc. Natl. Acad. Sci. USA
104: 15105-15110
[Abstract]
[Full Text]
-
Bicout, D. J., Carvalho, R., Chalvet-Monfray, K., Sabatier, P.
(2006). Distribution of Equine Infectious Anemia in Horses in the North of Minas Gerais State, Brazil. jvdi
18: 479-482
[Abstract]
[Full Text]
-
Craigo, J. K., Li, F., Steckbeck, J. D., Durkin, S., Howe, L., Cook, S. J., Issel, C., Montelaro, R. C.
(2005). Discerning an Effective Balance between Equine Infectious Anemia Virus Attenuation and Vaccine Efficacy. J. Virol.
79: 2666-2677
[Abstract]
[Full Text]
-
Howe, L., Craigo, J. K., Issel, C. J., Montelaro, R. C.
(2005). Specificity of serum neutralizing antibodies induced by transient immune suppression of inapparent carrier ponies infected with a neutralization-resistant equine infectious anemia virus envelope strain. J. Gen. Virol.
86: 139-149
[Abstract]
[Full Text]
-
Jin, S., Issel, C. J., Montelaro, R. C.
(2004). Serological Method Using Recombinant S2 Protein To Differentiate Equine Infectious Anemia Virus (EIAV)-Infected and EIAV-Vaccinated Horses. CVI
11: 1120-1129
[Abstract]
[Full Text]
-
Payne, S. L., Pei, X.-f., Jia, B., Fagerness, A., Fuller, F. J.
(2004). Influence of Long Terminal Repeat and Env on the Virulence Phenotype of Equine Infectious Anemia Virus. J. Virol.
78: 2478-2485
[Abstract]
[Full Text]
-
Baccam, P., Thompson, R. J., Li, Y., Sparks, W. O., Belshan, M., Dorman, K. S., Wannemuehler, Y., Oaks, J. L., Cornette, J. L., Carpenter, S.
(2003). Subpopulations of Equine Infectious Anemia Virus Rev Coexist In Vivo and Differ in Phenotype. J. Virol.
77: 12122-12131
[Abstract]
[Full Text]
-
McGuire, T. C., Leib, S. R., Mealey, R. H., Fraser, D. G., Prieur, D. J.
(2003). Presentation and Binding Affinity of Equine Infectious Anemia Virus CTL Envelope and Matrix Protein Epitopes by an Expressed Equine Classical MHC Class I Molecule. J. Immunol.
171: 1984-1993
[Abstract]
[Full Text]
-
Li, F., Craigo, J. K., Howe, L., Steckbeck, J. D., Cook, S., Issel, C., Montelaro, R. C.
(2003). A Live Attenuated Equine Infectious Anemia Virus Proviral Vaccine with a Modified S2 Gene Provides Protection from Detectable Infection by Intravenous Virulent Virus Challenge of Experimentally Inoculated Horses. J. Virol.
77: 7244-7253
[Abstract]
[Full Text]
-
Howe, L., Leroux, C., Issel, C. J., Montelaro, R. C.
(2002). Equine Infectious Anemia Virus Envelope Evolution In Vivo during Persistent Infection Progressively Increases Resistance to In Vitro Serum Antibody Neutralization as a Dominant Phenotype. J. Virol.
76: 10588-10597
[Abstract]
[Full Text]
-
Craigo, J. K., Leroux, C., Howe, L., Steckbeck, J. D., Cook, S. J., Issel, C. J., Montelaro, R. C.
(2002). Transient immune suppression of inapparent carriers infected with a principal neutralizing domain-deficient equine infectious anaemia virus induces neutralizing antibodies and lowers steady-state virus replication. J. Gen. Virol.
83: 1353-1359
[Abstract]
[Full Text]
-
Leroux, C., Craigo, J. K., Issel, C. J., Montelaro, R. C.
(2001). Equine Infectious Anemia Virus Genomic Evolution in Progressor and Nonprogressor Ponies. J. Virol.
75: 4570-4583
[Abstract]
[Full Text]
-
(2000). . Vet Pathol
37: 696-696
[Full Text]