Previous Article | Next Article 
Journal of Virology, June 2000, p. 5726-5728, Vol. 74, No. 12
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Unwinding of a Herpes Simplex Virus Type 1 Origin of Replication
(OriS) by a Complex of the Viral Origin Binding Protein
and the Single-Stranded DNA Binding Protein
Xiaodun
He and
I. R.
Lehman*
Department of Biochemistry, Stanford
University, Stanford, California 94305-5037
Received 14 February 2000/Accepted 29 March 2000
 |
ABSTRACT |
A herpes simplex virus type 1 (HSV-1) OriS analogue in
which the A+T sequence linking the box I and II elements was replaced by two single-stranded oligo(dT)s is unwound by the UL9 protein-ICP8 complex. Unwinding of wild-type OriS by the UL9
protein-ICP8 complex was also observed under conditions which
destabilize the A+T sequence. These experiments support a model for the
unwinding of OriS in which destabilization of the A+T
sequence can generate a single-stranded DNA binding site for ICP8,
which then associates with the UL9 protein bound to boxes I and II to
promote the bidirectional unwinding of OriS.
 |
TEXT |
Herpes simplex virus type 1 (HSV-1)
encodes a 94-kDa origin binding protein, the product of the UL9 gene,
which is essential for HSV-1 DNA replication (5, 10). The
origin binding protein (UL9 protein) is a homodimer that binds the two
inverted pentanucleotide repeats, boxes I and II of the HSV-1 origin of
replication, OriS. Boxes I and II are linked by an A+T-rich
sequence of 18 nucleotide residues (5). In addition to its
origin binding activity, the UL9 protein possesses DNA-dependent ATPase
and 3'-5' helicase activities (3, 6). Despite its helicase
activity, we have been unable to detect the unwinding of duplex DNA
containing OriS (9).
Previous studies have shown that a complex of the UL9 protein and the
HSV-1-encoded single-stranded DNA binding protein, ICP8, can
efficiently unwind a duplex box I if it possesses a 3' single-stranded tail at least 18 nucleotides in length, positioned downstream of box I
(8). These findings suggested a model for the unwinding of
OriS in which a complex of the UL9 protein bound to boxes I and II and ICP8 bound to single-stranded DNA generated at the A+T-rich
linker, possibly as a consequence of transcription (4), unwinds the origin of DNA replication to provide access to the replication machinery, thereby permitting the initiation of DNA replication.
To test this model, we have investigated the ability of the UL9
protein-ICP8 complex to unwind an OriS analogue in which
the A+T-rich linker has been replaced by two single strands each
consisting of 18 deoxythymidylate residues. We have found this
OriS analogue to be unwound by the complex. In addition, we
have found that at temperatures that would be expected to destabilize
the A+T-rich linker, some unwinding of wild-type OriS can
be observed. OriS bearing mutations in boxes I and II which
inhibit binding of UL9 protein could not be unwound under these
conditions. These findings support the model in which destabilization
of the A+T-rich linker to provide a binding site for ICP8 represents
the initial event in the UL9 protein-promoted unwinding of
OriS.
The structure of the duplex oligonucleotides used are shown in Fig.
1. The single-stranded oligonucleotides
were purchased from Operon Technologies, Inc. They were purified prior
to use by 16% polyacrylamide electrophoresis under denaturing
conditions. The concentration of single-stranded oligonucleotides
was determined spectrophotometrically assuming that 1 absorbance
unit at 260 nm is equivalent to 30 µg/ml. For double-stranded DNA 1 absorbance unit is equivalent to 50 µg/ml. Oligonucleotides
were labeled with [
-32P]ATP, using T4
polynucleotide kinase according to a protocol supplied by the U.S.
Biochemical Corp. Unincorporated nucleotide was removed by Sephadex
G-50 spin column chromatography (Quickspin DNA; Boehringer
Mannheim). Duplex oligonucleotides were formed by briefly mixing
equimolar amounts of the two complementary single-stranded oligonucleotides in 50 mM Tris buffer, pH 8.0, containing 0.1 M NaCl at
90°C for 5 min and then allowing the mixture to cool slowly to
room temperature overnight. The annealed DNA was passed through a Sephadex G-50 spin column to remove
single-stranded DNA.
To form the box I substrate, the 44-mer
5'-CGCGAAGCG TTCGCACTTCGTCCCGCCTTCCTGCGCCTTCCTGT-3' was
annealed to the 36-mer 5'-CATGCTCGCAGCGGGACGAAGTGCGAACGCTTCGCG-3' to generate a 26-bp box I duplex with an 18-nucleotide 3' and a
10-nucleotide 5' single-stranded tail.
To form the duplex OriS,
5'-CGCGAAGCGTTCGCACTT CGTCCCAATATATATATATTATTAGGGCGAAGTGCG AGCACTGGC-3'
was annealed to
5'-GCCAGTGCTCGCA CTTCGCCCTAATAATATATATATATTGGGACGAAGT GCGAACGCTTCGCG-3'.
The mutant OriS was generated by annealing
5'-CGCGAAGCGGGCGCACTTCGTCCCAATA TATATATATTATTAGGGCGAAGTGCGCCCACTGGC- 3' to 5'-GCCAGTGGGCGCACTTCGCCCTAATAATA TATATATATTGGGACGAAGTGCGCGCTCCTCGCG-3'. OriST18
was generated by annealing
5'-CGCGAAGCGTTCG CACTTCGTCCCTTTTTTTTTTTTTTTTTTGGGCGAAGT GCGAGCACTGGC-3'
to
5'-GCCAGTGCTCGCACTTCGC CCTTTTTTTTTTTTTTTTTTGGGACGAAGTGCGAACG CTTCGCG-3'.
To measure the unwinding of the duplex oligonucleotides, reaction
mixtures (25 µl) containing 50 mM HEPES-KOH (pH 8.15), 10 mM NaCl, 10 MgCl2, 2.0 mM dithiothreitol, 10% (vol/vol) glycerol, 10 µg of bovine serum albumin, 2 pmol of box I substrate, 1.0 pmol of
OriS, 1.8 pmol of OriST18 1.8 pmol
of mutant OriS, 1.6 pmol ICP8 (8), and 1.6 pmol
of UL9 protein (8) were incubated on ice for 5 min. ATP (50 µM) was added, and the reaction mixtures were incubated at 37°C for
60 min. The reactions were terminated by the addition of 6.5 µl of
stop solution (100 mM EDTA, 1% sodium dodecyl sulfate, 20 µg of
proteinase K) for an additional 10 min. at 37°C, followed by
electrophoresis through a 15% polyacrylamide gel at 10 V/cm. The gel
was then dried on Whatman DE81 paper at 80°C under vacuum and
quantitated with a PhosphorImager (Molecular Dynamics) or exposed to
Kodak XAR X-ray film.
Unwinding of OriST18.
Earlier studies
with the box I substrate had led to a model in which destabilization of
the A+T sequence linking boxes I and II to provide a binding site for
ICP8 was the first step in the unwinding of OriS by the UL9
protein (8). Unwinding of OriS is required to
provide an entry site for the replication machinery needed to initiate
DNA replication. In vivo, destabilization could result from
transcription from promoter sites flanking OriS
(4). To test this notion, we generated an OriS
duplex, OriST18, in which the A+T region was
replaced by two unpaired single strands, each containing 18 thymidylate
residues, a structure analogous to OriS in which the A+T
sequence had been unwound (Fig. 1). As shown in Fig.
2, in the presence of UL9 protein and
ICP8, substantial (20%) unwinding of this structure occurred in 60 min; at 120 min, 30% if the OriST18 was
unwound. Under the same conditions, the extent of unwinding of the
wild-type OriS duplex was 5 and 8%, respectively. The
extent of unwinding of the wild-type OriS, though small, is
nevertheless significant, since less than 2% of the mutant
OriS was unwound under these conditions. This mutant
contained base changes in both boxes I and II and did not bind the UL9
protein (7).

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 2.
Unwinding of OriS, mutant OriS,
OriST18, and box I substrate by UL9 protein and
ICP8. Individual reaction mixtures containing 1.0 pmol of
OriS, 1.8 pmol of mutant OriS, 1.6 pmol of
OriST18, or 2.0 pmol of box I substrate, 1.6 pmol of UL9 protein, and 1.6 pmol of ICP8 were prepared as described in
the text. They were incubated at 37°C for the times indicated. The
products were electrophoresed through a 15% polyacrylamide gel. (A)
Autoradiogram; (B) quantitation of products with a PhosphorImager.
Percent unwinding is the ratio of the intensities of the
single-stranded DNA product and the double-stranded DNA substrate. ,
double-stranded DNA substrate heated at 100°C for 5 min and then
chilled on ice. ss, single stranded; ds, double stranded.
|
|
Unwinding of OriS.
In another approach, unwinding
of wild-type OriS was measured under conditions which
would be expected to destabilize preferentially the A+T region, i.e.,
elevated temperature. As shown in Fig. 3, increasing the temperature of the reaction from 40 to 45°C resulted in an increase in the extent of unwinding from 5 to 18%.
Previous experiments had demonstrated that the nonspecific helicase
activity of the UL9 protein increased linearly from 33 to 45°C, then
decreased at 55°C (2), where denaturation of the enzyme
occurs (data not shown). The greater-than-threefold increase in the
extent of unwinding of OriS with a 5°C increase in the
temperature of incubation is consistent with the destabilization of the
A+T sequence linking boxes I and II to provide a single-stranded DNA
binding site for ICP8. In contrast to OriS, the difference
in the extent of unwinding of the OriST18
analogue between 40°C and 45°C was only 1.6-fold, an increase to be
expected from the Q10 of the enzyme (2). The box
I substrate, which is efficiently unwound over a broad range of
temperatures, was maximally unwound (>80%) at 35°C.

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 3.
Effect of temperature on unwinding of OriS,
OriST18, and box I substrate by UL9 protein and
ICP8. Reaction mixtures were prepared as described in the text and
incubated for 60 min at the temperatures indicated. The products were
electrophoresed through a 15% polyacrylamide gel and quantitated with
a PhosphorImager.
|
|
Effect of the UL9 protein/ICP8 ratio.
ICP8 presumably serves
two functions in the unwinding of OriS: (i) as a component
of the UL9 protein-ICP8 complex which constitutes the active helicase
(8) and (ii) as a single-stranded DNA binding protein that
binds the single strands generated as a consequence of helicase action,
thereby preventing their reannealing (1, 11). We
therefore investigated the effect of varying the concentration of ICP8
relative to the UL9 protein on the extent of unwinding of the
OriS analogue OriST18. As shown in
Fig. 4, in accord with a dual function
for ICP8, the maximal extent of unwinding was significantly reduced at
a UL9 protein to ICP8 ratio of 2:1.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 4.
Effect of the UL9 protein/ICP8 ratio on unwinding of
OriST18. Reaction mixtures were prepared as
described in the text. Increasing amounts of enzyme solution containing
the indicated UL9 protein/ICP8 ratios were added, and the reaction
mixtures were incubated for 60 min. The products were electrophoresed
through a 15% polyacrylamide gel and quantitated with a
PhosphorImager.
|
|
It is also possible that an excess of UL9 protein may have a dominant
negative effect on unwinding.
 |
ACKNOWLEDGMENTS |
This work was supported by NIH research grant AI26538.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry, Beckman Center, Stanford University, Stanford, CA
94305-5037. Phone: (650) 723-6164. Fax: (650) 723-6783. E-mail:
blehman{at}cmgm.stanford.edu.
 |
REFERENCES |
| 1.
|
Bayliss, G. J.,
H. S. Marsden, and J. Hay.
1975.
Herpes simplex virus proteins: DNA-binding proteins in infected cells and in the virus structure.
Virology
68:124-134[CrossRef][Medline].
|
| 2.
|
Boehmer, P. E.,
M. S. Dodson, and I. R. Lehman.
1993.
The herpes simplex virus type 1 origin binding protein: DNA helicase activity.
J. Biol. Chem.
268:1220-1225[Abstract/Free Full Text].
|
| 3.
|
Bruckner, R. C.,
J. J. Crute,
M. S. Dodson, and I. R. Lehman.
1991.
The herpes simplex virus 1 origin binding protein: a DNA helicase.
J. Biol. Chem.
266:2669-2674[Abstract/Free Full Text].
|
| 4.
|
Dabrowski, C. E., and P. A. Schaffer.
1991.
Herpes simplex virus type 1 origin-specific binding protein: oriS-binding properties and effects of cellular proteins.
J. Virol.
65:3140-3150[Abstract/Free Full Text].
|
| 5.
|
Elias, P., and I. R. Lehman.
1988.
Interaction of origin binding protein with an origin of replication of herpes simplex virus 1.
Proc. Natl. Acad. Sci. USA
85:2959-2963[Abstract/Free Full Text].
|
| 6.
|
Fierer, D. S., and M. D. Challberg.
1992.
Purification and characterization of UL9, the herpes simplex virus type 1 origin-binding protein.
J. Virol.
66:3986-3995[Abstract/Free Full Text].
|
| 7.
|
Hernandez, T. R.,
R. E. Dutch,
I. R. Lehman,
C. Gustafsson, and P. Elias.
1991.
Mutations in a herpes simplex virus type 1 origin that inhibit interaction with origin-binding protein also inhibit DNA replication.
J. Virol.
65:1649-1652[Abstract/Free Full Text].
|
| 8.
|
Lee, S. S-K., and I. R. Lehman.
1997.
Unwinding of the box I element of a herpes simplex virus type I origin by a complex of the virus origin binding protein, single-strand DNA binding protein, and single-stranded DNA.
Proc. Natl. Acad. Sci. USA
94:2838-2842[Abstract/Free Full Text].
|
| 9.
|
Lehman, I. R., and P. E. Boehmer.
1999.
Replication of herpes simplex virus DNA.
J. Biol. Chem.
274:28059-28062[Free Full Text].
|
| 10.
|
Olivo, P. D.,
N. J. Nelson, and M. D. Challberg.
1988.
Herpes simplex virus DNA replication: the UL9 gene encodes an origin-binding protein.
Proc. Natl. Acad. Sci. USA
85:5414-5418[Abstract/Free Full Text].
|
| 11.
|
Quinn, J. P., and D. J. McGeoch.
1985.
DNA sequence of the region of the genome of herpes simplex virus type 1 containing the genes for DNA polymerase and the major DNA binding protein.
Nucleic Acids Res.
13:8143-8163[Abstract/Free Full Text].
|
Journal of Virology, June 2000, p. 5726-5728, Vol. 74, No. 12
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Schildgen, O., Graper, S., Blumel, J., Matz, B.
(2005). Genome Replication and Progeny Virion Production of Herpes Simplex Virus Type 1 Mutants with Temperature-Sensitive Lesions in the Origin-Binding Protein. J. Virol.
79: 7273-7278
[Abstract]
[Full Text]
-
Colletti, K. S., Xu, Y., Yamboliev, I., Pari, G. S.
(2005). Human Cytomegalovirus UL84 Is a Phosphoprotein That Exhibits UTPase Activity and Is a Putative Member of the DExD/H Box Family of Proteins. J. Biol. Chem.
280: 11955-11960
[Abstract]
[Full Text]
-
Trego, K. S., Zhu, Y., Parris, D. S.
(2005). The herpes simplex virus type 1 DNA polymerase processivity factor, UL42, does not alter the catalytic activity of the UL9 origin-binding protein but facilitates its loading onto DNA. Nucleic Acids Res
33: 536-545
[Abstract]
[Full Text]
-
Grose, C., Tyler, S., Peters, G., Hiebert, J., Stephens, G. M., Ruyechan, W. T., Jackson, W., Storlie, J., Tipples, G. A.
(2004). Complete DNA Sequence Analyses of the First Two Varicella-Zoster Virus Glycoprotein E (D150N) Mutant Viruses Found in North America: Evolution of Genotypes with an Accelerated Cell Spread Phenotype. J. Virol.
78: 6799-6807
[Abstract]
[Full Text]
-
Ma, Y., Wang, T., Villemain, J. L., Giedroc, D. P., Morrical, S. W.
(2004). Dual Functions of Single-stranded DNA-binding Protein in Helicase Loading at the Bacteriophage T4 DNA Replication Fork. J. Biol. Chem.
279: 19035-19045
[Abstract]
[Full Text]
-
Trego, K. S., Parris, D. S.
(2003). Functional Interaction between the Herpes Simplex Virus Type 1 Polymerase Processivity Factor and Origin-Binding Proteins: Enhancement of UL9 Helicase Activity. J. Virol.
77: 12646-12659
[Abstract]
[Full Text]
-
Makhov, A. M., Lee, S. S.-K., Lehman, I. R., Griffith, J. D.
(2003). Origin-specific unwinding of herpes simplex virus 1 DNA by the viral UL9 and ICP8 proteins: Visualization of a specific preunwinding complex. Proc. Natl. Acad. Sci. USA
100: 898-903
[Abstract]
[Full Text]
-
Aslani, A., Olsson, M., Elias, P.
(2002). ATP-dependent Unwinding of a Minimal Origin of DNA Replication by the Origin-binding Protein and the Single-strand DNA-binding Protein ICP8 from Herpes Simplex Virus Type I. J. Biol. Chem.
277: 41204-41212
[Abstract]
[Full Text]
-
Cohrs, R. J., Wischer, J., Essman, C., Gilden, D. H.
(2002). Characterization of Varicella-Zoster Virus Gene 21 and 29 Proteins in Infected Cells. J. Virol.
76: 7228-7238
[Abstract]
[Full Text]
-
Tanguy Le Gac, N., Boehmer, P. E.
(2002). Activation of the Herpes Simplex Virus Type-1 Origin-binding Protein (UL9) by Heat Shock Proteins. J. Biol. Chem.
277: 5660-5666
[Abstract]
[Full Text]
-
He, X., Lehman, I. R.
(2001). An initial ATP-independent step in the unwinding of a herpes simplex virus type I origin of replication by a complex of the viral origin-binding protein and single-strand DNA-binding protein. Proc. Natl. Acad. Sci. USA
10.1073/pnas.061028298v1
[Abstract]
[Full Text]
-
Arana, M. E., Haq, B., Tanguy Le Gac, N., Boehmer, P. E.
(2001). Modulation of the Herpes Simplex Virus Type-1 UL9 DNA Helicase by Its Cognate Single-strand DNA-binding Protein, ICP8. J. Biol. Chem.
276: 6840-6845
[Abstract]
[Full Text]
-
Marintcheva, B., Weller, S. K.
(2001). Residues within the Conserved Helicase Motifs of UL9, the Origin-binding Protein of Herpes Simplex Virus-1, Are Essential for Helicase Activity but Not for Dimerization or Origin Binding Activity. J. Biol. Chem.
276: 6605-6615
[Abstract]
[Full Text]
-
He, X., Lehman, I. R.
(2001). An initial ATP-independent step in the unwinding of a herpes simplex virus type I origin of replication by a complex of the viral origin-binding protein and single-strand DNA-binding protein. Proc. Natl. Acad. Sci. USA
98: 3024-3028
[Abstract]
[Full Text]