Previous Article | Next Article 
Journal of Virology, June 2000, p. 5337-5346, Vol. 74, No. 11
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Persistence and Reactivation of Bovine Herpesvirus
1 in the Tonsils of Latently Infected Calves
M. T. C.
Winkler,
A.
Doster, and
C.
Jones*
Center for Biotechnology, Department of
Veterinary and Biomedical Sciences, University of Nebraska,
Lincoln, Lincoln, Nebraska 68583-0905
Received 9 December 1999/Accepted 7 March 2000
 |
ABSTRACT |
Bovine herpesvirus 1 (BHV-1), like other members of the
Alphaherpesvirinae subfamily, establishes latent infection
in sensory neurons. Reactivation from latency can occur after natural
or corticosteroid-induced stress culminating in recurrent disease and/or virus transmission to uninfected animals. Our previous results
concluded that CD4+ T cells in the tonsil and other
adjacent lymph nodes are infected and undergo apoptosis during acute
infection (M. T. Winkler, A. Doster, and C. Jones, J. Virol.
73:8657-8668, 1999). To test whether BHV-1 persisted in
lymphoreticular tissue, we analyzed tonsils of latently infected calves
for the presence of viral DNA and gene expression. BHV-1 DNA was
consistently detected in the tonsils of latently infected calves.
Detection of the latency-related transcript (LRT) in tonsils of
latently infected calves required nested reverse transcription-PCR
(RT-PCR) suggesting that only a few cells contained viral DNA or that
LRT is not an abundant transcript. bICP0 (immediate-early and early
transcripts), ribonucleotide reductase (early transcript), and
glycoprotein C (late transcript) were not detected by RT-PCR in
latently infected calves. When reactivation was initiated by
dexamethasone, bICP0 and ribonucleotide reductase transcripts were
detected. Following dexamethasone treatment, viral nucleic acid was
detected simultaneously in trigeminal ganglionic neurons and lymphoid
follicles of tonsil. LRT was detected at 6 and 24 h after
dexamethasone treatment but not at 48 h. Dexamethasone-induced reactivation led to apoptosis that was localized to tonsillar lymphoid
follicles. Taken together, these findings suggest that the tonsil is a
site for persistence or latency from which virus can be reactivated by
dexamethasone. We further hypothesize that the shedding of virus from
the tonsil during reactivation plays a role in virus transmission.
 |
INTRODUCTION |
Bovine herpesvirus 1 (BHV-1) is an
important viral pathogen of cattle that can cause severe respiratory
disease, conjunctivitis, abortions, vulvovaginitis, balanopostitis, and
systemic infection in neonate calves. Secondary bacterial infections
resulting in bronchopneumonia and death are common (reviewed in
reference 38). BHV-1 belongs to the
Alphaherpesvirinae subfamily and shares a number of
biological properties with herpes simplex virus 1 (HSV-1) and HSV-2
(13, 33). After initial replication in the mucosa of the
upper respiratory tract and eye, latency is established in sensory
neurons of trigeminal ganglia (TG). The virus can persist in a latent
state for the lifetime of the infected host but can also periodically
reactivate (reviewed in references 13 and 33). Successful long-term BHV-1 latency requires at
least four distinct events: (i) establishment, (ii) maintenance of the
latent state, (iii) reactivation, and (iv) shedding of infectious
virus. During productive infection of tissue culture cells, BHV-1 gene expression proceeds in a well-characterized cascade. Immediate-early (IE) gene products are initially expressed, and they subsequently transactivate early (E) and late (L) gene expression (reviewed in
reference 13). In contrast to what is found for
productive infection of permissive cells, the latency-related
transcript (LRT) is the only abundant transcript detected in latently
infected neurons (24, 25). LRT is antisense to the IE bICP0
gene. During reactivation, virus is translocated back to the initial
site of infection, from which it can spread to other susceptible hosts. The process of viral reactivation occurs after exogenous administration of corticosteroids or elevated levels of natural corticosteroids as a
consequence of stress (21, 31, 32). The synthetic
corticosteroid dexamethasone (DEX) efficiently reactivates BHV-1 in
latently infected rabbits and calves (19, 23, 32).
BHV-1 can infect and replicate in the tonsil during acute infection of
cattle (28, 37). T lymphocytes in the tonsil or adjacent
lymph nodes are infected and undergo apoptosis (37). Respiratory infections caused by many viruses, including herpesviruses, frequently target the tonsil as an important site for initial replication. For example, the tonsillar epithelium and lymphocytes play
a central role in primary Epstein-Barr virus infection and perhaps
latency (1). Canine herpesvirus 1 DNA has been detected in
tonsils of latently infected dogs (6), and during
reactivation virus was recovered from tonsil tissues (20).
HSV-1 has been detected in bone marrow of humans (8) and in
other nonneural sites in small-animal models (17, 29).
Pseudorabies virus (PRV) DNA has also been detected in tonsils (2,
3, 16, 35, 36) of latently infected swine. Nearly 80% of
latently infected swine contain detectable levels of the PRV
latency-associated transcript in tonsils (9). Although TG is
the major site for
-herpesvirus latency following infection, several
studies demonstrate that persistence or latency can occur in nonneural sites.
In this study, we demonstrate that BHV-1 DNA was consistently detected
in tonsil during latency. LRT, but not bICP0 (IE and E transcripts) and
ribonucleotide reductase (RR; E transcript), was detected in tonsils of
latently infected calves. Following DEX injection, RR and bICP0 RNA was
readily detected. LRT was detected at 6 and 24 h after DEX
treatment but not at 48 h. DEX treatment of latently infected
calves increased apoptosis in their tonsils. Taken together, the data
from this study suggested that the tonsil is a site for BHV-1 latency
or persistency and that this virus can be reactivated in vivo.
 |
MATERIALS AND METHODS |
Virus and cells.
MDBK cells (American Type Culture
Collection, Manassas, Va.) were maintained in Earle's modified
Eagle's media (EMEM) with 10% fetal calf serum. The Cooper strain of
BHV-1, supplied by the National Veterinary Services Laboratory, Animal
and Plant Health Inspection Services, Ames, Iowa, was propagated in
MDBK cells with a multiplicity of infection of 0.05. When cytopathic effect (CPE) was evident, virus was harvested, titrated in MDBK cells,
aliquoted, and stored at
70°C.
Animals.
Holstein calves (5 to 6 months old) that were
seronegative for BHV-1 were used for these studies. Calves were
inoculated in the right and left conjunctival sacs and intranasally, 1 ml per site, with 107 50% tissue culture infective doses
of BHV-1 Cooper strain/ml. Experiments using animals were done in
accordance with the American Association of Laboratory Animal Care
guidelines. Calves were housed under strict isolation containment and
given antibiotics before and after BHV-1 infection to prevent secondary
bacterial infection. The calves can be broken down into four groups: 1, latently infected (
60 days postinfection (dpi); 2, latently infected and treated with DEX for various times to initiate reactivation; 3, mock infected; and 4, mock infected and treated with DEX for 6, 24, or
48 h.
Nasal and ocular secretions from calves in groups 1 and 2 at days 1, 2, 5, 7, 9, 12, and 30 after DEX-induced reactivation were collected.
Swabs were also obtained from mock-infected (groups 3 and 4) and
latently infected calves (group 1). Swabs were placed into 2 ml of EMEM
containing 0.05 mg of gentamicin/ml immediately after collection, and
infectious virus was detected by inoculation with MDBK cells. A sample
was considered negative when CPE was not observed after three passages.
Each passage was maintained for three consecutive days (37°C in a 5%
CO2 incubator). Nasal and ocular swabs were also obtained
from calves for DNA extraction for PCR. Alkaline extraction of DNA was
performed as described previously (27).
DEX treatment and tissue collection.
Mock-infected calves
and latently infected calves, 60 dpi, were given a single dose of
water-soluble DEX (catalogue no. D2915; Sigma Chemical Co., St. Louis,
Mo.) by the intravenous route (0.4 mg/kg of body weight). TG and
pharyngeal tonsil were obtained from mock-infected, mock-infected and
DEX-treated (6, 24, and 48 h), latently infected (60 to 70 dpi),
and latently infected and DEX-treated (6, 24, and 48 h) calves.
Tissue samples were subjected to nucleic acid extractions and processed
by routine histological methods or processed for electron microscopy.
Preparation of CD4+ and CD8+ lymphocytes
from peripheral blood mononuclear cells.
Peripheral blood
lymphocytes (PBL) from mock-infected calves and calves latently
infected with BHV-1 at 1, 2, 5, 7, 9, 12, and 30 days after DEX
treatment were prepared by density gradient centrifugation on
Histopaque 1083 (Sigma Chemical Co.) as previously described
(37).
Flow cytometry.
Indirect immunofluorescence analysis was
performed according to standard techniques. PBL were incubated with
primary monoclonal antibodies, mouse immunoglobulin G1 (IgG1)
anti-bovine CD4 (MCA834; Serotec, Oxford, United Kingdom), mouse IgG2a
anti-bovine CD8 (MCA837), and mouse IgG2a anti-bovine WC1 (MCA838) for
1 h at 4°C as described before (37).
In situ hybridization.
Double-stranded DNA probes specific
for BHV-1 were synthesized and labeled by PCR with digoxigenin-dUTP
(Boehringer Mannheim Corp., Indianapolis, Ind.). PCR conditions using
ICP4, RR, and gC upstream and downstream primers have been previously
described and are listed below (12, 30). The coding sequence
for the BHV-1 gC glycoprotein was contained in plasmid pKS92-2 and was obtained from S. I. Chowdhury (Kansas State University). In situ hybridization was performed as described before in RNase-free conditions (37) using 0.1 ng of each probe/ml added to the
prehybridization mixture.
Immunohistochemistry.
Tissues sections, deparaffinized and
rehydrated in a graded ethanol series, as described above, were treated
with 0.05% protease (protease XIV; Sigma) in Tris buffer (0.05 M Tris,
pH 7.6) for 7 min at room temperature. Nonspecific binding was blocked
by incubation with 5% normal swine serum (Sigma) for 45 min at room temperature. The monoclonal antibody directed against the BHV-1 gD
glycoprotein (MM113) was obtained from S. Srikumaran (University of
Nebraska, Lincoln). Immunohistochemistry was performed as previously described (34, 37).
Nucleic acid extractions.
DNA and RNA extraction from bovine
tissues (mock-infected and BHV-1-infected calves) was performed as
described previously (30, 37).
DNase I treatment, RT, and PCRs.
DNase I treatment, reverse
transcription (RT), and PCR were done as described before using primers
specific for BHV-1 genes (30). The IE gene tested was the
bICP0 gene, and the primers were +TTCTCTGGGCTCGGGGCTGC and
AGAGGTCGAACAAACACCCGCGGT. The internal-hybridization
primer for the bICP0 gene was CCGCAAGGGCGGCGCGCTAGC.
The E gene that was tested was the RR gene, and the primers were
+GACGCCTGCTCGCTGCTATCC and

GCCTGTGTAGTTGGTGCTGCGGC.
The
internal-hybridization primer for the RR gene was
TTTCCTTTGGCCCTGATGACTGCCGAG.
The L gene tested was the gC gene, and the primers were
+GAGCAAAGCCCCGCCGAAGGA and

TACGAACAGCAGCACGGGCGG.
The internal-hybridization
primer for the gC gene was
GAACCTGCCCACGCGCTGAAAC.
The nested primer pairs used to amplify a 276-bp external segment of
LRT (nucleotides [nt] 1672 to 1693 and 1947 to 1924)
were
+CGCTCCCCTTCGTCCCTCCTCA and

AGAGGTCGACAAACACCCGCGGT.
The
internal primer pair for an 81-bp segment (nt 1755 to 1775 and
1835 to 1815) was +TTCTCTGGGCTCGGGGCTGC and

GACGAGACCCCCGATTGCCG
(
12). Nested PCR was
performed with 5 µl of the reaction products
from the first
amplification using procedures previously described
for RT-PCR.
Amplified products were electrophoresed in a 2% agarose
gel. The
oligonucleotide that was used as a hybridization probe
to detect the
amplified LRT product spans nt 1781 to 1800 (5'-GCGCTTGCGCCGCGGGGGCT-3').
This oligonucleotide was
labeled by incubation with [

-
32P]ATP and
polynucleotide kinase. All oligonucleotides are listed
in the 5'-to-3'
direction.
Southern blotting.
PCR products were electrophoresed in 2%
agarose gels. The DNA in the gel was denatured, neutralized, and
transferred to nylon membranes. Radioactive probes were prepared by
incubating the respective oligonucleotides with
[
-32P]ATP and polynucleotide kinase. Probes,
hybridization, and washing conditions were as previously described
(30).
In situ detection of apoptosis.
Tissue sections, 4 to 5 µm
thick, on Superfrost Plus slides were prepared as described previously
(37). Apoptosis in tissue was examined by using the terminal
deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling
(TUNEL) assay (Boehringer-Mannheim Corp.). Slides were counterstained
with methyl green (Vector Laboratories), and a cover slip was added
with Permount (Fisher).
Electron microscopy.
Lymphoid tissues from mock-infected and
latently infected calves (48 h after DEX treatment) were cut into
1-mm3 cubes and fixed in 2% buffered glutaraldehyde.
Samples were postfixed in 1% osmium tetroxide in phosphate buffer and
were stained in-block with uranyl acetate. After dehydration, samples
were embedded in Epon araldite, cut to thin sections (70 nm thick),
stained with lead citrate and uranyl acetate, and then examined with a Phillips 210 microscope.
Statistical analyses.
Differences in CD4+,
CD8+, and
/
lymphocyte percentages were analyzed by
independent t test using a two-tailed P value,
and a P value <0.05 was the criterion for statistical significance.
 |
RESULTS |
DEX-induced BHV-1 reactivation.
DEX induces reactivation of
latent BHV-1 in cattle when multiple doses are administered by the
intramuscular or intravenous route (15, 31, 32). A single
intravenous dose will synchronously induce reactivation of latent BHV-1
in rabbits (23). We tested whether a single dose of DEX (0.4 mg/kg) administered intravenously induced reactivation in latently
infected calves. All five latently infected calves had specific serum
neutralizing antibody titers (1:32 to 1:64) against BHV-1. Virus was
not recovered from nasal or ocular swabs and viral sequences were not
amplified from swabs prior to DEX injection (Table
1). Thus, by standard criteria that are
clinically used to define latency, these calves were latently infected.
Reactivated virus was recovered from ocular and nasal swabs in 100% of
the animals at 5 days posttreatment (Table 1). PCR results from swabs
confirmed the virus isolation results. The BHV-1 genome was amplified
at 5 and 7 days postreactivation in 100% of the swab specimens (Table
1). PCR-positive results were obtained at 9 days posttreatment for some
samples and at 12 and 30 days posttreatment in nasal swabs from one
calf (Table 1). Thus, a single dose of DEX was sufficient to
consistently induce reactivation in latently infected calves.
Detection of viral nucleic acid in tonsils of latently infected
calves and after DEX-induced reactivation.
To determine if BHV-1
persists and can be reactivated in tonsillar tissue, six latently
infected calves (60 dpi) and six mock-infected calves were injected
with a single intravenous dose of DEX (0.4 mg/kg). A previous finding
demonstrated that BHV-1 infects CD4+ cells in the tonsillar
epithelia during acute infection of cattle (37), suggesting
that this could be a site for persistence or latency. Mock-infected or
latently infected calves were euthanized 6, 24, and 48 h after DEX
treatment (two calves for each time), and TG and tonsils were
collected. Two other latently infected calves were not treated with
DEX. Consistent with the results in Table 1, infectious virus was not
detected in nasal and ocular swabs from any latently infected calf
prior to DEX treatment. Following enzymatic digestion of tonsils with
collagenase and cocultivation with bovine kidney cells (MDBK) on
collagen-treated plates, infectious BHV-1 was isolated from latently
infected calves 48 h after DEX treatment.
PCR was performed with RR gene-specific primers to determine if viral
DNA was present in tonsils of latently infected calves.
The expected
product of 150 bp in tonsils from latently infected
calves (Fig.
1,
lane 7) and from latently infected calves
that
were treated with DEX for 6, 24, and 48 h was amplified (Fig.
1, lanes 8 to 10, respectively). No PCR product from the no-template
control (lane 2), from mock-infected MDBK cells (lane 3), and
from
tonsillar tissue of a mock-infected calf (lane 5) was amplified.
The
two positive controls, MDBK cells infected for 18 h with BHV-1
(lane 4) and a tonsil from a BHV-1-infected calf at 7 dpi (lane
6),
contained the 150-bp PCR product. Seven out of eight latently
infected
calves were positive for BHV-1 DNA by PCR, demonstrating
that BHV-1 DNA
was consistently detected in the tonsils of latently
infected calves.

View larger version (68K):
[in this window]
[in a new window]
|
FIG. 1.
Detection of BHV-1 DNA in tonsils. Tonsils were
collected from euthanized calves. DNA extraction and PCR conditions are
described in Materials and Methods. Lanes: 1 and 11, molecular weight
marker (100-bp DNA ladder); 2, no-template control; 3, mock-infected
MDBK cells; 4, MDBK cells infected with BHV-1 for 18 h; 5, tonsil
from a mock-infected calf; 6, tonsil from a BHV-1-infected calf (7 dpi); 7, tonsil from a latently infected calf (60 dpi); 8 to 10, tonsil
from latently infected calves at 6, 24, and 48 h after DEX
treatment, respectively. One microgram of DNA was used for each PCR
except for the positive controls. The results are representative of
three different infected calves at each time point.
|
|
Viral gene expression in tonsillar tissue of latently infected calves
was compared to that in tonsillar tissue of calves that
were treated
with DEX to initiate reactivation. RT-PCR was performed
with primers
that detect IE (bICP0), E (RR), and L (gC) transcripts.
Viral gene
expression in three calves was examined at each time
point after
DEX-induced reactivation, and Fig.
2
shows representative
data for two calves at each time point. bICP0 cDNA
in the tonsil
of one calf at 6 h was amplified (Fig.
2A, lane 10),
as was that
in all three calves at 24 (Fig.
2A, lanes 14 and 16) and
48 h
(Fig.
2A, lanes 18 and 20) after treatment. RR transcripts
were
detected in the tonsil after DEX treatment in two out of three
calves at 24 h (Fig.
2B, lanes 14 and 16) and in three out of
three calves at 48 h (Fig.
2B, lanes 18 and 20). gC RNA was
detected
in only one calf at 48 h after DEX treatment (Fig.
2C,
lane 20).
bICP0, RR, and gC transcripts were not detected in
mock-infected
(Fig.
2, lanes 2) or
latently infected calves (Fig.
2, lanes 6
and 8). As expected, all
three viral transcripts were detected
in tonsil prepared from a calf
infected with BHV-1 for 7 days
(Fig.
2, lanes 4). When reverse
transcriptase was omitted from
RT reaction mixtures, amplified products
were not detected in
any positive sample (Fig.
2). Thus, bICP0 and RR
expression were
consistently detected in the tonsil at 24 and 48 h
after DEX treatment
but not in latently infected calves.

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 2.
Viral gene expression in the tonsil after DEX treatment.
RNA extraction, RT, and PCR were performed as described in Materials
and Methods. cDNAs were PCR amplified with genes for bICP0 (A), RR (B),
and gC (C) and the respective hybridization primers used to detect
specific amplification products as described in Materials and Methods.
Lanes: 1 and 2, tonsil from a mock-infected calf without and with
reverse transcriptase, respectively; 3 and 4, tonsil from a
BHV-1-infected calf (7 dpi) without and with reverse transcriptase,
respectively; 5 and 6, tonsil from a latently infected calf (60 dpi)
without and with reverse transcriptase, respectively; 7 and 8, tonsil
from a latently infected calf (60 dpi) without and with reverse
transcriptase, respectively; 9 and 10, tonsil from a latently infected
calf at 6 h after DEX treatment without and with reverse
transcriptase, respectively; 11 and 12, tonsil from a latently infected
calf at 6 h after DEX treatment without and with reverse
transcriptase, respectively; 13 and 14, tonsil from a latently infected
calf at 24 h after DEX treatment without and with reverse
transcriptase, respectively; 15 and 16, tonsil from a latently infected
calf at 24 h after DEX treatment without and with reverse
transcriptase, respectively; 17 and 18, tonsil from a latently infected
calf at 48 h after DEX treatment without and with reverse
transcriptase, respectively; 19 and 20, tonsil from a latently infected
calf at 48 h after DEX treatment without and with reverse
transcriptase, respectively.
|
|

View larger version (135K):
[in this window]
[in a new window]
|
FIG. 3.
In situ hybridization of sections from tonsils and TG of
infected calves. The ICP4, RR, and gC probes as well as in situ
hybridization conditions are described in Materials and Methods. Shown
are tonsil sections from a latently infected calf (A) and from latently
infected calves at 6 (B), 24 (C), and 48 h (D) after DEX
treatment; TG from a mock-infected calf (E); TG from a latently
infected calf (60 dpi) (I); TG from latently infected calves at 6 h after DEX treatment (F and J); TG from latently infected calves at
24 h after DEX treatment (G and K); and TG from latently infected
calves at 48 h after DEX treatment (H and L). The tissue sections
were counterstained with methyl green. Arrows, viral nucleic
acid-positive neurons.
|
|
Localization of viral nucleic acid in tonsil and TG by in situ
hybridization.
Digoxigenin-labeled ICP4, RR, and gC gene probes
were used to localize viral nucleic acid in tonsillar tissues.
Double-stranded DNA probes were prepared to detect viral mRNA and DNA
and thus enhance the sensitivity of in situ hybridization. BHV-1
nucleic acid was not detected in tonsils from mock-infected calves at 6, 24, and 48 h after DEX treatment (data not shown). In general, the in situ hybridization signal of latently infected calves was similar to that of mock-infected calves (Fig. 3A). In a few sections, low levels of viral nucleic acid were detected in lymphoid follicles of
latently infected calves. BHV-1 nucleic acid was consistently detected
in lymphoid follicles at 6, 24, and 48 h after DEX treatment (Fig.
3B to D, respectively). The number and intensity of positive cells
increased from 6 to 48 h after DEX injection, which is consistent with viral reactivation.
To compare viral nucleic acid accumulation in tonsil during
reactivation to that in TG, in situ hybridization was performed
with TG
samples at 6, 24, and 48 h after DEX-induced reactivation.
BHV-1
nucleic acid was not detected in mock- and latently infected
TG (Fig.
3E and I, respectively). A positive in situ hybridization
signal was
detected in TG neurons at 6 (F and J), 24 (G and K)
and 48 h (H
and L) after DEX treatment. The intensity of the positive
signal and
the number of positive neurons increased from 6 to
24 h after DEX
treatment. The intensity and number of in situ
hybridization-positive
neurons were roughly equivalent after 24
and 48 h of DEX
treatment. By RT-PCR, bICP0 expression was also
detected in latently
infected calves after DEX treatment (M. T.
Winkler and C. Jones,
unpublished data). Taken together, the experiments
shown in Fig.
2 and
3 demonstrated that DEX treatment of latently
infected calves led to
increased levels of viral nucleic acids
(RNA and DNA) in TG and
tonsil.
LRT is expressed in tonsils during latency.
During latent
infection of neurons, BHV-1 gene expression is restricted to LRT
(reviewed in reference 13). To test whether LRT was
expressed in tonsils of latently infected calves, total RNA was
prepared from tonsils of latently infected calves and DEX-treated
calves and LRT expression was assessed by nested RT-PCR. An 80-bp
fragment was detected in three out of three tonsils from latently
infected calves (Fig. 4, lanes 6 and 8),
two out of three calves 6 h after DEX treatment (lane 10 and 12),
and two out of three calves 24 h after DEX treatment (lanes 14 and
16). No product was amplified in two out of two tonsils 48 h after
DEX treatment (lanes 18 and 20). When reverse transcriptase was omitted
from RT reaction mixtures, amplified products were not detected in the
positive samples. As expected, the LRT-specific band was not detected
in mock-infected calves (lane 2). LRT was detected in total RNA from TG
of a latently infected calf after the first PCR (lane 4). For the
nested PCR, the TG sample was diluted 1:100 and 1 µl was added to the
PCR mixture. LRT was not detected in tonsils unless nested PCR was
performed (data not shown). Except for latently infected calves that
were treated with DEX for 48 h, LRT was consistently detected in
tonsils of latently infected calves.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 4.
Detection of LRT in tonsil of latently infected calves.
Nested PCR was performed to detect LRT. RT-PCR, PCR conditions, and
Southern blot analysis were as described in Materials and Methods.
Lanes 1 and 2, mock-infected calves; lanes 3 and 4, TG of a latently
infected calf (60 dpi); lanes 5 to 8, tonsils of latently infected
animals; lanes 9 to 12, two different latently infected calves that
were treated with DEX for 6 h; lanes 12 to 16, two different
latently infected calves that were treated with DEX for 24 h.
Lanes 17 to 20, two different latently infected calves that were
treated with DEX for 48 h. The odd-numbered lanes were the results
of nested PCR without reverse transcriptase, and the even-numbered
lanes are the results of PCR with reverse transcriptase.
|
|
DEX-induced reactivation induces apoptosis in the tonsil.
To
test whether BHV-1 reactivation led to apoptosis in tonsils, TUNEL
assays were performed with tissue sections. A previous study
demonstrated that BHV-1 induces apoptosis in lymphoid tissues during
acute infection (37). Since DEX can induce apoptosis in
several different cell types, it was reasonable to hypothesize that
DEX-induced reactivation leads to apoptosis in tonsils. Tonsillar tissue contained many TUNEL-positive cells at 24 and 48 h after DEX treatment of latently infected calves (Fig. 5E and
F). TUNEL-positive cells were
predominantly localized to the corticomedullary junction in germinal
centers of lymphoid follicles (Fig. 5E). At 48 h after treatment,
TUNEL-positive cells were detected in the entire lymphoid follicle
(Fig. 5F). Furthermore, TUNEL-positive cells were detected in tonsillar
crypts 48 h after DEX treatment when these crypts were adjacent to
follicles. Only a few TUNEL-positive cells were observed in
mock-infected calves treated with DEX for 6, 24, or 48 h (Fig. 5A
to C, respectively). Latently infected calves treated with DEX for
6 h also contained low levels of TUNEL-positive cells (Fig. 5D).
Prior to DEX treatment, tonsil from latently infected calves contained
little or no TUNEL-positive cells (M. T. Winkler and C. Jones,
unpublished data). Taken together, these data suggested that viral
reactivation and DEX were necessary for extensive apoptosis in tonsil.

View larger version (108K):
[in this window]
[in a new window]
|
FIG. 5.
TUNEL analysis of tonsils from latently infected calves
after DEX treatment. Thin sections were prepared, and TUNEL assays were
performed. (A to C) Tonsils from mock-infected calves at 6, 24, and
48 h after DEX treatment, respectively. (D to F) Tonsils from
calves latently infected with BHV-1 (60 dpi) at 6, 24, and 48 h
after DEX treatment, respectively. Tissue was counterstained with
methyl green. Dark purple, TUNEL-positive cells; arrows, positions of
lymphoid follicles; arrowhead (F), tonsillar crypt that is bound by the
epithelium.
|
|
Electron microscopy was performed with tonsil from latently infected
calves at 48 h after treatment. Cells located in the
lymphoid
follicles contained condensed chromatin and apoptotic
bodies shaped
like kidney beans or half-moons (Fig.
6B to
D),
which are morphological hallmarks of
apoptosis. The size and morphology
of the apoptotic cells suggested
that they were lymphocytes. In
sharp contrast, lymphocytes within a
tonsillar follicle of mock-infected
calves did not contain condensed
chromatin or apoptotic bodies.
Thus, the data in Fig.
5 and
6
demonstrate that apoptosis occurs
in the tonsils of latently infected
calves treated with DEX.

View larger version (129K):
[in this window]
[in a new window]
|
FIG. 6.
Electron microscopy of tonsils from mock-infected calves
and calves latently infected with BHV-1 at 48 h after DEX
treatment. Calves were euthanized, and tonsils were collected, fixed in
2% buffered glutaraldehyde, and embedded in Epon araldite. Thin
sections were stained with lead citrate and uranyl acetate and then
examined with a Phillips 210 microscope. (A) Tonsil from a
mock-infected calf. Magnification, ×13,300. (B to D) Tonsils from
calves latently infected with BHV-1 at 48 h after DEX treatment.
Magnification, ×19,000. Arrows, prominent apoptotic bodies and
condensed chromatin in apoptotic lymphocytes.
|
|
A transient decrease in T cells in blood during acute infection of
cattle was observed (
37). In large part, this was due
to
increased apoptosis. Thus, it was of interest to test whether
DEX-induced reactivation led to decreased levels of CD4
+,
CD8
+, and

/

T-lymphocyte populations in blood. After
DEX treatment,
CD4
+ and CD8
+ lymphocyte
populations in PBL were not significantly different
from those in
latently infected calves (
P > 0.05) (Table
2).
A selective depletion of the
T-lymphocyte subpopulation that expresses
the

/

form of the
T-cell receptor was observed at 1 and 2 days
after DEX treatment
(
P < 0.05). The levels of

/

T cells remained
lower than the normal levels even at 30 days posttreatment. A
reduction
in circulating T lymphocytes following DEX treatment
has been observed
in

/

but not in

/

T cells (
7,
21).
In contrast
to results for acute infection, we did not see a transient
decrease in
T cells (CD4
+ and CD8
+) following DEX treatment
of latently infected calves. The significance
of the selective
depletion of

/

T cells after DEX treatment
for viral reactivation
was not clear.
 |
DISCUSSION |
In this study, we demonstrated that a single intravenous injection
of DEX led to reactivation of latent BHV-1 in calves, which is
consistent with the rabbit model for BHV-1 (24). We further demonstrated that viral DNA persists in the tonsil and can be reactivated. Following DEX treatment, extensive apoptosis occurred in
the tonsils of latently infected calves but not uninfected calves. The
ability of BHV-1 to persist and reactivate in tonsil may be important
for virus transmission.
BHV-1 DNA was not detected in TG of latently infected calves by in situ
hybridization, which is consistent with other studies (4, 15, 23,
26). Thus, it was expected that in situ hybridization would not
detect viral DNA in tonsils of latently infected calves. However, BHV-1
DNA was consistently detected in tonsils by PCR at 60 dpi. Because in
situ hybridization localized viral nucleic acid in germinal centers of
tonsil during reactivation (Fig. 3), it is hypothesized that viral DNA
is present in lymphoid cells. This hypothesis is supported by the
recent finding that BHV-1 DNA is detected in peripheral blood cells for
long periods of time after infection (11). Additional
studies will be necessary to determine what cell type BHV-1 DNA is
harbored in and whether the DNA is circular, as in latently infected
neurons. A nonneuronal site of latency has been proposed for tonsil
following infection of swine with PRV. PRV DNA was consistently
detected in some studies (5, 9, 35, 36) but not others
(3, 18). Nonneural sites for latency or persistence have
also been described for HSV-1 (8, 17, 29) and may be
important for ocular disease (17). Thus, nonneural sites of
latency or persistence may be a normal outcome of acute infection by
certain
-herpesviruses.
Although this study demonstrated that LRT was present in tonsils of
latently infected calves, nested PCR was required for detection (Fig.
4). LRT is readily detected in TG of latently infected calves without
the use of nested PCR (10, 12, 25, 30). This suggested that
LRT is not an abundant transcript in tonsils of latently infected
calves or that only a minor population of cells was persistently or
latently infected. It is also possible that other viral transcripts,
but not LRT, are abundantly expressed in tonsils of latently infected
calves. Forty-eight hours after DEX treatment, LRT was not detected in
tonsil (Fig. 5). This is consistent with a previous study that
concluded that the number of LRT-positive trigeminal ganglionic neurons
decreased when latently infected rabbits were injected with DEX
(23). DEX also represses the LRT promoter activity in
transiently transfected bovine cells (14). Thus, repression
of LRT by DEX in tonsils and TG correlates with reactivation. Since LRT
is alternatively spliced in TG (10, 12), it will be
interesting to determine if there are novel species expressed in tonsil
and if other regions of the viral genome are expressed. Detecting LRT
in tonsils of latently infected calves, but not bICP0 and RR, does not
necessarily mean these cells were latently infected because
productively infected cells express LRT (reviewed in reference
13). Furthermore, nested RT-PCR was not used to
detect bICP0 and RR, and thus the assay may not have detected low
levels of these transcripts if they were expressed in only a minor
population of cells.
Following DEX treatment, viral nucleic acid in neurons and tonsils was
readily detectable by in situ hybridization. As soon as 6 h after
DEX treatment, a few viral nucleic acid-containing neurons were
detected. A similar effect was observed in tonsils of latently infected
calves. At 24 and 48 h after DEX treatment, the numbers of
virus-positive cells in TG and tonsils were much higher. In latently
infected rabbits, in situ hybridization detected extensive viral
transcription 15 to 18 h after DEX treatment (23). The
number of hybridizing neurons in reactivating TG appeared to be higher
than that in tonsils. Virus-positive neurons were found in clusters
distributed throughout TG, but hybridizing cells in the tonsil did not
appear to be abundant. However, we could not detect viral transcription
by in situ hybridization or RT-PCR in TG before it was detected in
tonsils during reactivation. Taken together, the data from this study
suggested that DEX induced viral transcription and reactivation of
latent or persistent genomes in tonsil. It is also possible that virus
reactivation in TG contributed to virus infection and gene expression
in the tonsil at late times after reactivation.
This study demonstrated that long-term persistence (chronic infection)
or latency occurred in lymphoid follicles. BHV-1 DNA is also present in
PBL of latently infected calves (11; M. T. Winkler and C. Jones, unpublished results), demonstrating that viral
DNA is retained in lymphoid cells long after acute infection. Although
we cannot completely rule out a chronic or persistent infection, we
favor the possibility that latency occurs in tonsillar lymphoid cells
and probably blood. This hypothesis is supported by several findings.
First, viral nucleic acids were not detected in tonsils by in situ
hybridization until after DEX-induced reactivation. Since viral nucleic
acid was detected in the tonsil and TG at 6 h after DEX treatment,
it is unlikely that reactivation occurred in TG and then spread to the
tonsil. Second, infectious virus was only detected in tonsils of calves
that were treated with DEX (M. T. Winkler and C. Jones,
unpublished results), making it unlikely that virus is being shed
during latency. Recent studies have demonstrated that spontaneous
reactivation leads to higher levels of HSV-1-neutralizing antibodies in
rabbits (22) and BHV-1-neutralizing antibodies in cattle
after DEX-induced reactivation (15). The animals that were
infected in this study seroconverted, but neutralizing antibody levels
were stable during latency, suggesting that spontaneous shedding was
not occurring. Calves infected with BHV-1 and housed under strict
isolation, as described in this study, are not prone to spontaneous
reactivation unless treated with DEX. Although lymphoid cells and
sensory neurons have very different phenotypes, they are highly
differentiated cells that may lack factors necessary for productive
infection but that have the potential to establish latency. The lack of
permissive transcription factors or the presence of cellular factors
that repress viral transcription is believed to be a significant factor
during establishment of latency (reviewed in reference
13). Developing a better understanding of virus-host
interactions in lymphoid cells will help us understand the mechanism of
viral pathogenesis, immunosuppression, and virus transmission.
 |
ACKNOWLEDGMENTS |
This research was supported by grants from the USDA (9702394 and
9802064) and the Center for Biotechnology, UN-L.
We thank F. Osorio and C. Wood for critically reviewing the manuscript.
We acknowledge K. Arumuganathan (Center for Biotechnology, University
of Nebraska, Lincoln) for assistance with flow cytometry and S. I. Chowdhury (Department of Diagnostic Medicine and Pathobiology, College
of Veterinary Medicine, Kansas State University) for the gC plasmid. We
are grateful to T. Bargar for assistance with electron microscopy, S. Srikumaran for the monoclonal antibody directed against gD, and T. Holt
for technical assistance. We thank J.-H. Sur (Plum Island Animal
Disease Center, African Swine Fever Virus Research Group) for the ISH
protocol. We also thank B. Clowser, M. Klintworth, J. Wilkinson, and T. Green for assistance with cattle experiments. Finally, we thank R. Olmscheid and V. Johns for assistance with histological preparations.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Center for
Biotechnology, Department of Veterinary and Biomedical Sciences,
University of Nebraska, Lincoln, Fair St. at East Campus Loop, Lincoln,
NE 68583-0905. Phone: (402) 472-1890. Fax: (402) 472-9690. E-mail: cj{at}unlinfo.unl.edu.
 |
REFERENCES |
| 1.
|
Anagnostopoulos, I.,
M. Hummel,
C. Kreschel, and H. Stein.
1995.
Morphology, immunophenotype and distribution of latently and/or productively Epstein-Barr virus-infected cells in acute infectious mononucleosis: implications of the interindividual infection route of Epstein-Barr virus.
Blood
85:744-750[Abstract/Free Full Text].
|
| 2.
|
Balasch, M.,
J. Pujols,
J. Segales,
J. Plana-Duran, and M. Pumarola.
1998.
Study of the persistence of Aujeszky's disease (pseudorabies) virus in peripheral blood mononuclear cells and tissues of experimentally infected pigs.
Vet. Microbiol.
62:171-183[CrossRef][Medline].
|
| 3.
|
Brockmeier, S. L.,
K. M. Lager, and W. L. Mengeling.
1993.
Comparison of in vivo reactivation, in vitro reactivation and polymerase chain reaction for detection of latent pseudorabies virus infection in swine.
J. Vet. Diagn. Investig.
5:505-509[Abstract/Free Full Text].
|
| 4.
|
Brown, T. M.,
F. A. Osorio, and D. L. Rock.
1990.
Detection of latent pseudorabies virus in swine using in situ hybridization.
Vet. Microbiol.
24:273-280[CrossRef][Medline].
|
| 5.
|
Brown, T. T.,
K. O. Shin, and F. J. Fuller.
1995.
Detection of pseudorabies viral DNA in tonsillar epithelial cells of latently infected pigs.
Am. J. Vet. Res.
56:587-594[Medline].
|
| 6.
|
Burr, P. D.,
M. E. Campbell,
L. Nicolson, and D. E. Onions.
1996.
Detection of canine herpesvirus 1 in a wide range of tissues using the polymerase chain reaction.
Vet. Microbiol.
53:227-237[CrossRef][Medline].
|
| 7.
|
Burton, J. L., and M. E. Kehrli, Jr.
1996.
Effects of dexamethasone on bovine circulating T lymphocyte populations.
J. Leukoc. Biol.
59:90-99[Abstract].
|
| 8.
|
Cantin, E.,
J. Chen,
L. Gaidulis,
Z. Valo, and E. McLaughlin-Taylor.
1994.
Detection of herpes simplex virus DNA sequences in human blood and bone marrow cells.
J. Med. Virol.
42:279-286[Medline].
|
| 9.
|
Cheung, A. K.
1995.
Investigation of pseudorabies virus DNA and RNA in trigeminal ganglia and tonsil tissues of latently infected swine.
Am. J. Vet. Res.
56:45-50[Medline].
|
| 10.
|
Devireddy, L. R., and C. Jones.
1998.
Alternative splicing of the latency-related transcript of bovine herpesvirus type 1 yields RNAs containing unique open reading frames.
J. Virol.
72:7294-7301[Abstract/Free Full Text].
|
| 11.
|
Fuchs, M.,
P. Hubert,
J. Detterer, and H.-J. Rzia.
1999.
Detection of bovine herpesvirus type 1 in blood from naturally infected cattle by using a sensitive PCR that discriminates between wild-type virus and virus lacking glycoprotein E.
J. Clin. Microbiol.
37:2498-2507[Abstract/Free Full Text].
|
| 12.
|
Hossain, A.,
L. Schang, and C. Jones.
1995.
Identification of gene products encoded by the latency-related gene of bovine herpesvirus type 1.
J. Virol.
69:5345-5352[Abstract].
|
| 13.
|
Jones, C.
1998.
Alphaherpesvirus latency: its role in disease and survival of the virus in nature.
Adv. Virus Res.
51:81-133[Medline].
|
| 14.
|
Jones, C.,
G. Delhon,
A. Bratanich,
G. Kutish, and D. Rock.
1990.
Analysis of the transcriptional promoter which regulates the latency-related transcript of bovine herpesvirus 1.
J. Virol.
64:1164-1170[Abstract/Free Full Text].
|
| 15.
| Jones, C., T. J. Newby, T. Holt, A. Doster, M. Stone, J. Ciacci-Zanella, C. J. Webster, and M. W. Jackwood. Analysis of latency in cattle after inoculation with a
temperature sensitive mutant of bovine herpesvirus 1 (RLB106). Vaccine,
in press.
|
| 16.
|
Lokensgard, J. R.,
D. G. Thawley, and T. W. Molitor.
1990.
Pseudorabies virus latency: restricted transcription.
Arch. Virol.
110:129-136[CrossRef][Medline].
|
| 17.
|
Maggs, D. J.,
E. Chang,
M. P. Naisse, and W. J. Mitchell.
1998.
Persistence of herpes simplex virus type 1 DNA in chronic conjunctival and eyelid lesions of mice.
J. Virol.
72:9166-9172[Abstract/Free Full Text].
|
| 18.
|
Mengeling, W. L.,
K. M. Lager,
D. M. Voltz, and S. L. Brockmeier.
1992.
Effect of various vaccination procedures on shedding, latency, and reactivation of attenuated and virulent pseudorabies virus in swine.
Am. J. Vet. Res.
53:2164-2173[Medline].
|
| 19.
|
Narita, M.,
S. Inui,
K. Nanba, and Y. Shimizu.
1981.
Recrudescence of infectious bovine rhinotracheitis virus and associated neural changes in calves treated with dexamethasone.
Am. J. Vet. Res.
42:1192-1197[Medline].
|
| 20.
|
Okuda, Y.,
K. Ishida,
A. Hashimoto,
T. Yamaguchi,
H. Fukushi,
K. Hirai, and L. E. Carmichael.
1993.
Virus reactivation in bitches with a medical history of herpesvirus infection.
Am. J. Vet. Res.
54:551-554[Medline].
|
| 21.
|
Oldham, G., and C. J. Howard.
1992.
Suppression of bovine lymphocyte responses to mitogens following in vivo and in vitro treatment with dexamethasone.
Vet. Immunol. Immunopathol.
30:161-177[CrossRef][Medline].
|
| 22.
|
Perng, G. C.,
S. M. Slanina,
A. Yuhkt,
H. Ghiasi,
A. B. Nesburn, and S. L. Wechsler.
1999.
Herpes simplex virus type 1 serum neutralizing antibody titers increase during latency in rabbits latently infected with latency-associated transcript (LAT)-positive but not LAT-negative viruses.
J. Virol.
73:9669-9672[Abstract/Free Full Text].
|
| 23.
|
Rock, D.,
J. Lokensgard,
T. Lewis, and G. Kutish.
1992.
Characterization of dexamethasone-induced reactivation of latent bovine herpesvirus 1.
J. Virol.
66:2484-2490[Abstract/Free Full Text].
|
| 24.
|
Rock, D. L.
1993.
Latent infection with bovine herpesvirus type 1.
Semin. Virol.
5:233-240[CrossRef].
|
| 25.
|
Rock, D. L.,
S. L. Beam, and J. E. Mayfield.
1987.
Mapping bovine herpesvirus type 1 latency-related RNA in trigeminal ganglia of latently infected rabbits.
J. Virol.
61:3827-3831[Abstract/Free Full Text].
|
| 26.
|
Rock, D. L., and D. E. Reed.
1982.
Persistent infection with bovine herpesvirus type 1: rabbit model.
Infect. Immun.
35:371-373[Abstract/Free Full Text].
|
| 27.
|
Rudbeck, L., and J. Dissing.
1998.
Rapid, simple alkaline extraction of human genomic DNA from whole blood, buccal epithelial cells, semen and forensic stains for PCR.
BioTechniques
25:588-592[Medline].
|
| 28.
|
Schuh, J. C. L.,
H. Bielefeldt Ohmann,
L. A. Babiuk, and C. E. Doige.
1992.
Bovine herpesvirus-1-induced pharyngeal tonsil lesions in neonatal and weaning calves.
J. Comp. Pathol.
106:243-253[CrossRef][Medline].
|
| 29.
|
Scriba, M.
1977.
Extraneural localization of herpes simplex virus in latently infected guinea pigs.
Nature
267:529-531[CrossRef][Medline].
|
| 30.
|
Shang, L. M., and C. Jones.
1997.
Analysis of bovine herpesvirus 1 transcripts during a primary infection of trigeminal ganglia of cattle.
J. Virol.
71:6786-6795[Abstract].
|
| 31.
|
Sheffy, B. E., and S. Rodman.
1973.
Activation of latent infectious bovine rhinotracheitis infection.
J. Am. Vet. Med. Assoc.
163:850-851.
|
| 32.
|
Sheffy, B. E., and D. H. Davies.
1972.
Reactivation of a bovine herpesvirus after corticosteroid treatment.
Proc. Soc. Exp. Biol. Med.
140:974-976[CrossRef][Medline].
|
| 33.
|
Spear, A.
1993.
Entry of alphaherpesviruses into cells.
Semin. Virol.
4:167-180.
|
| 34.
|
Stroop, W. G.,
D. L. Rock, and N. W. Fraser.
1984.
Localization of herpes simplex virus in the trigeminal and olfactory systems of the mouse central nervous system during acute and latent infections by in situ hybridization.
Lab. Investig.
51:27-38[Medline].
|
| 35.
|
Wheeler, J. G., and F. A. Osorio.
1991.
Investigation of sites of pseudorabies virus latency, using polymerase chain reaction.
Am. J. Vet. Res.
52:1799-1803[Medline].
|
| 36.
|
White, A. K.,
J. Ciacci-Zanella,
J. Galeota,
S. Ele, and F. A. Osorio.
1996.
Comparison of the abilities of serologic tests to detect pseudorabies-infected pigs during the latent phase of infection.
Am. J. Vet. Res.
57:608-611[Medline].
|
| 37.
|
Winkler, M. T. C.,
A. Doster, and C. Jones.
1999.
Bovine herpesvirus 1 can infect CD4+ T lymphocytes and induce programmed cell death during acute infection of cattle.
J. Virol.
73:8657-8668[Abstract/Free Full Text].
|
| 38.
|
Wyler, R.,
M. Engels, and M. Schwyzer.
1989.
Infectious bovine rhinotracheitis/vulvovaginitis (BHV-1), p. 172.
In
G. Witman (ed.), Herpesviruses diseases of cattle, horses, and pigs, developments in veterinary medicine. Kluver Academic Publishers, Boston, Mass.
|
Journal of Virology, June 2000, p. 5337-5346, Vol. 74, No. 11
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Tryland, M., Das Neves, C. G., Sunde, M., Mork, T.
(2009). Cervid Herpesvirus 2, the Primary Agent in an Outbreak of Infectious Keratoconjunctivitis in Semidomesticated Reindeer. J. Clin. Microbiol.
47: 3707-3713
[Abstract]
[Full Text]
-
Workman, A., Perez, S., Doster, A., Jones, C.
(2009). Dexamethasone Treatment of Calves Latently Infected with Bovine Herpesvirus 1 Leads to Activation of the bICP0 Early Promoter, in Part by the Cellular Transcription Factor C/EBP-Alpha. J. Virol.
83: 8800-8809
[Abstract]
[Full Text]
-
Saira, K., Chowdhury, S., Gaudreault, N., da Silva, L., Henderson, G., Doster, A., Jones, C.
(2008). The Zinc RING Finger of Bovine Herpesvirus 1-Encoded bICP0 Protein Is Crucial for Viral Replication and Virulence. J. Virol.
82: 12060-12068
[Abstract]
[Full Text]
-
Perez, S., Meyer, F., Saira, K., Doster, A., Jones, C.
(2008). Premature expression of the latency-related RNA encoded by bovine herpesvirus type 1 correlates with higher levels of beta interferon RNA expression in productively infected cells. J. Gen. Virol.
89: 1338-1345
[Abstract]
[Full Text]
-
Brower, A., Homb, K. M., Bochsler, P., Porter, R., Woods, K., Ubl, S., Krueger, D., Cigel, F., Toohey-Kurth, K.
(2008). Encephalitis in aborted bovine fetuses associated with Bovine herpesvirus 1 infection. jvdi
20: 297-303
[Abstract]
[Full Text]
-
Geiser, V., Zhang, Y., Jones, C.
(2005). Analysis of a bovine herpesvirus 1 recombinant virus that does not express the bICP0 protein. J. Gen. Virol.
86: 1987-1996
[Abstract]
[Full Text]
-
Perez, S., Inman, M., Doster, A., Jones, C.
(2005). Latency-Related Gene Encoded by Bovine Herpesvirus 1 Promotes Virus Growth and Reactivation from Latency in Tonsils of Infected Calves. J. Clin. Microbiol.
43: 393-401
[Abstract]
[Full Text]
-
Inman, M., Zhou, J., Webb, H., Jones, C.
(2004). Identification of a Novel Bovine Herpesvirus 1 Transcript Containing a Small Open Reading Frame That Is Expressed in Trigeminal Ganglia of Latently Infected Cattle. J. Virol.
78: 5438-5447
[Abstract]
[Full Text]
-
Schynts, F., Meurens, F., Detry, B., Vanderplasschen, A., Thiry, E.
(2003). Rise and Survival of Bovine Herpesvirus 1 Recombinants after Primary Infection and Reactivation from Latency. J. Virol.
77: 12535-12542
[Abstract]
[Full Text]
-
Vogel, F. S. F., Caron, L., Flores, E. F., Weiblen, R., Winkelmann, E. R., Mayer, S. V., Bastos, R. G.
(2003). Distribution of Bovine Herpesvirus Type 5 DNA in the Central Nervous Systems of Latently, Experimentally Infected Calves. J. Clin. Microbiol.
41: 4512-4520
[Abstract]
[Full Text]
-
Lovato, L., Inman, M., Henderson, G., Doster, A., Jones, C.
(2003). Infection of Cattle with a Bovine Herpesvirus 1 Strain That Contains a Mutation in the Latency-Related Gene Leads to Increased Apoptosis in Trigeminal Ganglia during the Transition from Acute Infection to Latency. J. Virol.
77: 4848-4857
[Abstract]
[Full Text]
-
Jones, C.
(2003). Herpes Simplex Virus Type 1 and Bovine Herpesvirus 1 Latency. Clin. Microbiol. Rev.
16: 79-95
[Abstract]
[Full Text]
-
Geiser, V., Inman, M., Zhang, Y., Jones, C.
(2002). The latency-related gene of bovine herpesvirus-1 can inhibit the ability of bICP0 to activate productive infection. J. Gen. Virol.
83: 2965-2971
[Abstract]
[Full Text]
-
Inman, M., Lovato, L., Doster, A., Jones, C.
(2002). A Mutation in the Latency-Related Gene of Bovine Herpesvirus 1 Disrupts the Latency Reactivation Cycle in Calves. J. Virol.
76: 6771-6779
[Abstract]
[Full Text]
-
Inman, M., Lovato, L., Doster, A., Jones, C.
(2001). A Mutation in the Latency-Related Gene of Bovine Herpesvirus 1 Leads to Impaired Ocular Shedding in Acutely Infected Calves. J. Virol.
75: 8507-8515
[Abstract]
[Full Text]
-
Donofrio, G., van Santen, V. L.
(2001). A bovine macrophage cell line supports bovine herpesvirus-4 persistent infection. J. Gen. Virol.
82: 1181-1185
[Abstract]
[Full Text]
-
Winkler, M. T., Schang, L. S., Doster, A., Holt, T., Jones, C.
(2000). Analysis of cyclins in trigeminal ganglia of calves infected with bovine herpesvirus-1. J. Gen. Virol.
81: 2993-2998
[Abstract]
[Full Text]
-
Lemaire, M., Meyer, G., Baranowski, E., Schynts, F., Wellemans, G., Kerkhofs, P., Thiry, E.
(2000). Production of Bovine Herpesvirus Type 1-Seronegative Latent Carriers by Administration of a Live-Attenuated Vaccine in Passively Immunized Calves. J. Clin. Microbiol.
38: 4233-4238
[Abstract]
[Full Text]
-
(2000). . Vet Pathol
37: 696-696
[Full Text]