Previous Article | Next Article 
Journal of Virology, June 2000, p. 5280-5290, Vol. 74, No. 11
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
J Domain-Independent Regulation of the Rb Family by
Polyomavirus Large T Antigen
Qing
Sheng,
Tara M.
Love, and
Brian
Schaffhausen*
Department of Biochemistry, Tufts University
School of Medicine, Boston, Massachusetts
Received 13 October 1999/Accepted 10 March 2000
 |
ABSTRACT |
The ability of polyomavirus large T antigen (LT) to promote cell
cycling, to immortalize primary cells, and to block differentiation has
been linked to its effects on tumor suppressors of the retinoblastoma susceptibility (Rb) gene family. Our previous studies have shown that
LT requires an intact N-terminal DnaJ domain, in addition to an Rb
binding site, for activation of simple E2F-containing promoters and
stimulation of cell cycle progression. Here we show that some LT
effects dependent on interaction with the Rb family are largely DnaJ
independent. In differentiating C2C12 myoblasts, overexpression of LT
caused apoptosis. Although this activity of LT completely depended on
Rb binding, LTs with mutations in the J domain remained able to kill.
Comparisons of Rb
and J
LTs revealed
additional differences. Wild-type but not Rb
LT activated
the cyclin A promoter under serum starvation conditions. Genetic
analysis of the promoter linked the Rb requirement to an E2F site in
the promoter. LTs with mutations in the J domain were still able to
activate the promoter. Finally, J mutant LTs caused changes in
phosphorylation of both pRb and p130. In the case of p130, Thr-986 was
shown to be a site that is regulated by J mutant LT. Taken together,
these observations reveal that LT regulation of Rb function can be
separated into both DnaJ-dependent and DnaJ-independent pathways.
 |
INTRODUCTION |
Polyomaviruses (Pys) have provided
valuable models because the cellular pathways they use are generally
important for cell function. The multifunctional large T antigens (LTs)
represent one example. Their most obvious role is in DNA replication.
Murine PyLT functions in initiation (21) of viral DNA
synthesis, but it is also responsible for integration (15)
and excision (4) of the viral genome. Biochemical studies on
simian virus 40 (SV40) LT have provided important clues about basic
cellular processes such as DNA replication (9, 78). LT's
broad effects on the host cell led to the discovery of p53 (40,
46) and to considerable insight into the Rb tumor suppressor and
E2F transcription factor families (47).
The effects of murine PyLT on the host cell can be viewed from a
biological or a mechanistic perspective. LT induces cellular DNA
synthesis (24, 66) and can immortalize primary cells
(3, 58). LT can also block the differentiation of either
myoblasts (51) or preadipocytes (14). It has the
ability to promote apoptosis (20). Finally, LT is a
transactivator of cellular genes (39, 54, 55).
Much of what LT does to cells depends upon its interactions with the Rb
tumor suppressor family through an LXCXE motif starting at residue 141 (17, 32). Immortalization (22, 34, 41), induction
of cell DNA synthesis (70), overcoming p53-induced cell
cycle arrest (16), and prevention of differentiation
(52) can all depend on Rb family binding. Transactivation of
the thymidine kinase, polymerase
, PCNA, dihydrofolate reductase,
and thymidylate synthase genes (54) as well as regulation of
interferon-inducible gene expression (80) also requires an
intact pRb/p107 binding site on LT and is mediated via the cellular
transcription factor E2F.
A major shift in the perception of how LT regulates Rb family function
began with the realization that the highly conserved N terminus
(56) of all the Py T antigens looks like a DnaJ domain (12, 38). DnaJs bind to and stimulate the activity of DnaK proteins (44, 53). Subsequent biochemical studies (61,
72) and genetic domain swapping experiments (10, 37)
confirmed the T antigen/J domain connection. J domains make multiple
contributions to LT function. For SV40 they contribute, for example, to
DNA replication (10). However, the most striking aspect of
their function was that mutation of the J domain prevented its
interaction with hsc70, a DnaK, thereby blocking LT functions related
to Rb family member binding (27, 70, 72, 86). Since many of the effects of the Rb family are mediated through interactions with the
E2F family, these results have been interpreted in terms of effects on
protein complexes containing Rb and E2F family members.
The Rb family is, however, clearly multifunctional and can work
independently of E2F. Studies of transgenic mice point to additional
roles in development (76). A mutant pRb that does not bind
to E2F or oncoproteins can still induce a flat-cell phenotype in Saos-2
cells and retains the ability to collaborate with MyoD in the
differentiation of myoblasts (68). The minimal growth suppression domain of pRb contains at least three independent protein-binding functions (79). In addition to the A/B
"pocket" domain and the E2F binding site, Rb has a C pocket domain
required for interaction with MDM2 and c-Abl (82, 83) that
is not found in p130 or p107. An N-terminally truncated pRb fails to
rescue pRb
/
mice from embryonic lethality, indicating
that the N-terminal sequences of pRb may also be important for pRb
function (60).
The work presented here extends our analysis of the interaction between
PyLT and the Rb family. Our previous work demonstrated that DnaJ was
required for LT to affect Rb functions related to cell cycle
progression or activation of promoters containing E2F sites. This work
characterizes LT effects on the Rb family related to apoptosis and
release of promoter repression that are largely independent of a
functional DnaJ domain.
 |
MATERIALS AND METHODS |
Cell lines.
NIH 3T3 cells originally obtained from the
American Type Culture Collection were provided by Bruce Cohen. Cells
were grown in Dulbecco's modified Eagle's medium (DMEM; Gibco)
supplemented with 10% calf serum (Hyclone). C33A, a human cervical
carcinoma cell line, was from Amy Yee and was maintained in DMEM
containing 10% calf serum. Murine C2C12 myoblasts, an in vitro model
for muscle differentiation (5, 84), were also a gift from
Amy Yee and were grown in DMEM supplemented with 20% fetal calf serum. C42 cells, a pRb
/
myoblast cell line, were obtained
from Ken Walsh and cultured the same way as the C2C12s.
Plasmids and mutagenesis.
pCMV-LT (62) and
pCMV-Rb
-LT, which contains two point mutations in the
L-X-C-X-E motif of PyLT (32), have been described previously. The J domain mutants H42Q and P43S were also described earlier (70). Both mutants were used in each assay with
similar results. The pCMV-neoBAM vector lacking an LT insert was used as a control (CON) plasmid. Rous sarcoma virus (RSV)
-galactosidase (
-Gal) (2, 18) and EMSV MyoD were also provided by Amy
Yee. CMV-HA-Rb (31), pcDNA1-HA-p130 (77), and
CMV-p107-HA (88) were obtained from Jim DeCaprio.
CMV-RbT821A was made using primers 5'TCAGAAGGTCTGCCAGCACCAACAAAAATGACTC3' and
5'GAGTCATTTTTGTTGGTGCTGGCAGACCTTCTGA3'. pcDNA1-HA-p130 T986A
was made using primers 5'AGCAGTGCTCCTCCCGCACCTACTCGCCTCAC3' and 5'GTGAGGCGAGTAGGTGCGGGAGGAGCACTGCT3'. The
89/+11
cyclin A-luc construct (73) was a gift from Antonio
Giordano. The
37/
33 cyclin A E2F substitution mutant was made using
primers 5'ATTGGTCCATTTCAATAGAGCTTGGATACTTGAACTGCAAG3' and
5'CTTGCAGTTCAAGTATCCAAGCTCTATTGAAATGGACCAAT3'. Mutations
were introduced using standard PCR techniques based on PfuI
polymerase (Stratagene). All the mutants were verified by sequencing
(65).
Protein analysis.
After washing and collection in
PBS+ (phosphate-buffered saline [PBS] with 1 mM
CaCl2 and 0.5 mM MgCl), cells were extracted in T
extraction buffer (137 mM NaCl, 10 mM Tris-Cl [pH 8.0], 1 mM
MgCl2, 1 mM CaCl2, 10% [vol/vol] glycerol,
1% [vol/vol] Nonidet P-40) for 20 min at 4°C. Cleared extracts
were incubated with antibody and protein A or protein G-Sepharose
(Pharmacia) for 1 h. After washing in PBS+,
immunoprecipitates were boiled for 2 min in dissociation buffer (62.5 mM Tris-Cl [pH 6.8], 5% [wt/vol] sodium dodecyl sulfate [SDS],
25% [vol/vol] glycerol, 0.0075% [wt/vol] bromophenol blue, 50 µl of
-mercaptoethanol per ml) and subjected to SDS-polyacrylamide gel electrophoresis (PAGE). After electrophoresis, samples were blotted
onto nitrocellulose and analyzed by immunoblotting (75). Antibodies used in blotting included mouse monoclonal antibody PN116
(32) or anti-LT polyclonal rabbit serum to detect LT and HA11 or 12CA5 to detect hemagglutinin (HA)-tagged Rb, p130, or p107.
For hydroxylamine digestion, p130 was immunoprecipitated and labeled in
vitro. Afterwards, samples of p130 were separated on 7.5% cylindrical
gels. Then the gel was pushed out of the cylinder and soaked with 7.5%
acetic acid-5% methanol (vol/vol) for 1 h at room temperature.
The gel was then treated with 0.2 M K2CO3, pH
9.0, for an additional hour at room temperature and with hydroxylamine solution (4 M hydroxylamine in 0.4 M K2CO3 [pH
9.0]) for another 3 h at 45°C. Afterwards, the gel was washed
with 100 ml of 0.125 M Tris-HCl (pH 6.8)-1% SDS-0.1%
2-mercaptoethanol-0.03% bromophenol blue for 1.5 h with one
change of wash solution. The gel was placed on top of a 13% acrylamide
gel, sealed with chemical agarose (1% agarose, 0.125 M Tris-HCl [pH
6.8], 2% SDS, 1%
-mercaptoethanol), and electrophoresed
overnight. Finally the gel was dried and used to expose Kodak XAR5 film
with an intensifying screen.
Transient transfections and reporter assays.
Transient
transfections using BES
(N,N-bis[2-hydroxyethyl]-2-aminoethanesulfonic
acid)-buffered saline were done with both C33A cells and NIH 3T3 cells
(13). For luciferase assays, 1 µg of reporter together
with 3 µg of different DNA constructs were added to a 60-mm-diameter
plate of cells. For some experiments, at 24 h after transfection,
cells were starved for another 24 h in DMEM with 0.2% calf serum.
At 48 h after transfection, cells were harvested by
freeze-thawing, and 5 µl from a 100-µl extract was used for
measurement of luciferase activity.
In the case of C2C12 cells and C42s, HEPES-buffered saline solutions
were used for transfection (
25,
64). HEPES-buffered
saline
was obtained from 5'

3'. For a 60-mm-diameter plate of
cells, a total
of 15 µg of DNA was added. Five hours after the
addition of
precipitate, the cells were rinsed twice with PBS
and incubated in PBS
containing 20% glycerol for 2 to 3 min at
room temperature. The cells
were then washed twice with PBS and
incubated with fresh
medium.
Apoptosis.
For LT-induced apoptosis, 90 to 100% confluent
30-mm-diameter dishes of murine C2C12 myoblasts were cotransfected in
duplicate with different pCMV-LT constructs, pCMV-MyoD, and RSV
-Gal
reporter plasmid. One set of transfections was fixed at 24 h
posttransfection. For this, cells were washed with PBS and fixed with
0.5% glutaraldehyde in PBS for 10 min at room temperature. The other
half of the experiments were incubated with differentiation medium
(DMEM with 2% horse serum) for an additional 24 h before
fixation. To identify
-Gal enzyme activity in the fixed cells,
dishes were stained with X-Gal (5-bromo-4-chloro-3-indolyl-
-D-galactosidase) solution
[0.5% X-Gal, 3 mM K3Fe(CN)6,
K4Fe(CN)6 · 3H2O, 1 mM
MgCl2, 10 mM KCl, 0.01% Triton X-100] in PBS at 37°C
for 12 to 24 h. Apoptosis was calculated as the decrease in the
number of normal, nonapoptotic blue cells between dishes stained at
24 h after transfection and those allowed to differentiate for
another 24 h.
Apoptosis was assessed using terminal transferase in the form of the
Apoptag Kit (Oncor). C2C12 cells grown on coverslips
were transfected
with RSV

-Gal, MyoD, and wild-type LT in DMEM
containing 20% fetal
calf serum. At 24 h after transfection, cells
were supplemented
with DMEM containing 2% horse serum for another
24 h. Coverslips
were then fixed with 2% paraformaldehyde and
assayed as described by
the manufacturer
(Oncor).
 |
RESULTS |
PyLT induced apoptosis in differentiating C2C12 cells in a
transient assay.
C2C12 cells are myoblasts that undergo terminal
differentiation upon serum withdrawal. PyLT interferes with in vitro
terminal differentiation of myoblasts (52). Comparisons of
established cell lines showed that this activity of LT requires pRb
binding (52). Recently, it was also shown that myoblast cell
lines expressing PyLT underwent apoptosis upon serum withdrawal
(20). Apoptosis induced by PyLT was further enhanced by
factors that induce differentiation (20). To explore this
activity of PyLT, a collection of LT mutants and effector proteins were
tested in the differentiating C2C12 system. Transient assays were used
so that a large number of mutant LTs and effector proteins could be
tested. Full differentiation of C2C12 cells normally occurs within a
week after serum withdrawal. For a transient assay, full
differentiation should occur within 48 to 72 h. To shorten the
time required for C2C12 differentiation, MyoD, which has been shown to
induce myoblast differentiation (reviewed by Weintraub
[81]), was used in our transient assays. RSV
-Gal
was cotransfected together with different constructs as a transfection
marker. Staining of terminal differentiation markers, such as myosin
heavy chain (MHC), revealed that in the presence of MyoD, over 90% of
the transfected cells were differentiated within 72 h (not shown).
Similar to the cell line result reported earlier, expression of PyLT in
this transient assay blocked C2C12 differentiation in over 95% of the
cells; a difference from isolated cell lines was that in these
transient assays, even LT mutant in Rb binding blocked MHC expression
(not shown).
Apoptosis was next assayed in this transient C2C12 system. Cells were
cotransfected with wild-type LT together with MyoD and
RSV

-Gal. At
24 h after transfection, half of the experiment
was stained for

-Gal activity, while the other half was incubated
in DMEM with 2%
horse serum for an additional 24 h before staining.
At 24 h,
the number of

-Gal-positive cells in LT-transfected
plates was
comparable to that in the control plate (Fig.
1). With
an additional 24-h incubation in
low serum, most of the

-Gal-positive
cells disappeared from the
LT-transfected plates, whereas approximately
80% of transfected cells
remained on the control plates (Fig.
1A). The loss of

-Gal-positive
cells in LT-transfected plates
is a result of apoptosis. Terminal
deoxynucleotidyltransferase-mediated
dUTP-biotin nick end labeling
(TUNEL) assays (Fig.
1B) were positive
in LT-expressing cells. In
addition, cotransfected antiapoptotic
factor Bcl2 completely blocked
PyLT-induced cell death (Fig.
1C).
Both results support the conclusion
that LT induced apoptosis
in this transient system.

View larger version (63K):
[in this window]
[in a new window]
|
FIG. 1.
LT-induced apoptosis in differentiating C2C12 cells. (A)
Expression of wild-type LT induced loss of C2C12 cells. Two sets of
identical plates were transfected with 2.5 µg of RSV -Gal, 2.5 µg of MyoD, and 5 µg of either a control vector (CON) or wild-type
(WT) LT. One set of plates were fixed and stained for -Gal activity
24 h after transfection. A second set of plates were incubated in
DMEM with 2% horse serum for an additional 24 h before staining
for -Gal activity. (B) PyLT-expressing cells were positive for
Apop-tag staining. C2C12s were transfected with 5 µg of wild-type LT,
2.5 µg of MyoD, and 2.5 µg of RSV -Gal. At 24 h after
transfection, cells were starved in DMEM with 2% horse serum for
another 14 h before being fixed and stained with tetramethyl
rhodamine isocyanate (TRITC) anti- -Gal antibody. The cells were then
incubated with terminal digoxigenin transferase to have its free 3'OH
overhang conjugated with digoxigenin. Lastly, these cells were labeled
with fluorescein isothiocyanate (FITC) antidigoxigenin and Hoechst dye.
Fluorescence was observed on a Nikon microscope with appropriate
filters. Arrows indicate stained transfected cells. (C) LT-induced
apoptosis can be rescued by Bcl2 expression. Two identical sets of
C2C12s were transfected with 2 µg of RSV -Gal, 2 µg of MyoD, and
5 µg of control vector (CON) or wild-type LT in the presence or
absence of 1 µg of Bcl2 and treated as described for panel A. The
-Gal-positive cells in all the plates were counted, and data are
expressed as [(number of -Gal-positive cells at 48 h)/(no. of
-Gal-positive cells at 24 h)] × 100 to get percent survival
values.
|
|
pRb is one of the downstream targets for PyLT-induced
apoptosis.
Since it is already known that pRb family binding is
part of LT's effect on myoblasts (52), a pRb binding mutant
of LT was assayed for the ability to induce apoptosis using the
-Gal
staining assay. As shown in Fig. 2A and
D,
cells transfected with
Rb
LT survived as well as the control cells when
incubated in low serum for 24 h. In some cases, better survival
was observed in Rb
LT-transfected plates than in controls
(not shown). Two kinds of experiments were performed to test the role
of Rb family members. To try to determine whether pRb was specifically
involved, RB
/
myoblasts (C42 cells) were examined. C42s
treated with a control vector showed significant cell death when
treated in the same manner as the C2C12s (not shown). This is
consistent with the suggestion that pRb plays an important role in
protection from apoptosis during differentiation. When wild-type LT was
introduced into C42 cells, the percentage of cell death upon serum
starvation was comparable to that of controls (not shown). In other
words, LT had no additional proapoptotic effect of its own. This result indicates that LT kills by interaction with pRb. A different, opposite
kind of experiment involved overexpressing Rb family members to try to
protect against LT-mediated killing. As shown in Fig. 2B, Rb and p130
but not p107 could reduce the amount of killing caused by LT.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 2.
Rb binding but not J function is necessary for LT to
induce apoptosis. (A) Rb LT did not induce apoptosis in
C2C12s. Two sets of identical plates were transfected with 2.5 µg of
RSV -Gal, 2.5 µg of MyoD, and 5 µg of Rb LT.
Plates were fixed and stained as described in the legend to Fig. 1A.
(B) Overexpression of pRb partially protects C2C12s from LT-induced
apoptosis. C2C12s were cotransfected with 2.5 µg of RSV -Gal, 2.5 µg of MyoD, and either 2.5 µg of control vector (CON), 2.5 µg of
wild-type LT, or 2.5 µg of Rb LT in the presence or
absence of 2.5 µg of HA-Rb, HA-130, and HA-107. Cells were stained
and counted as described above. (C) H42Q-induced apoptosis in C2C12s.
Two sets of identical plates were transfected with 2.5 µg of RSV
-Gal, 2.5 µg of MyoD, and 5 µg of H42Q LT. Plates were fixed and
stained as described in the legend to Fig. 1A. (D) Wild-type and H42Q
but not Rb LT can induce apoptosis in C2C12s. C2C12s were
transfected with 2.5 µg of RSV -Gal, 2.5 µg of MyoD, 5 µg of
control vector (CON), wild-type LT, Rb LT, or H42Q LT.
Cells were stained for -Gal and counted as described above. (E) H42Q
was incapable of promoting cellular DNA replication in C2C12 cells.
C2C12 cells were transfected with the indicated DNAs. Transfected cells
incubated in 2% horse serum for approximately 36 h were labeled
with 100 µM bromodeoxyuridine (BrdU) for an additional 14 h.
After staining for LT with rabbit polyclonal antibody-FITC
anti-rabbit Ig and BrdU with the monoclonal antibody BU-1-TRITC
anti-mouse Ig (Amersham), nuclear fluorescence was scored with a
Zeiss microscope. Values represent counts of more than 300 T-positive
cells in each case.
|
|
A functional J domain is not required for PyLT to induce
apoptosis.
Previous work showed that LT required both an intact
pRb binding site and a functional J domain to activate E2F
(70). However, a critical question is whether a requirement
for J function is universal or if it is limited to certain pRb
functions such as E2F regulation. J mutants were therefore tested to
determine if J domain function is necessary for LT's ability to induce apoptosis.
As shown in Fig.
2C, cells transfected with H42Q had an intermediate
phenotype. After 24 h in low-serum medium, the number
of positive
surviving cells in the H42Q-transfected plates as
scored by

-Gal
staining was much reduced. However, the extent
of cell death was not as
severe as that of wild-type LT-transfected
plates. Figure
2D is a
summary of the LT constructs used in the

-Gal staining assay. It is
clear that H42Q did not have wild-type
activity in inducing cell death.
About 20% of H42Q-transfected
cells survived, compared to less than
5% cell survival of wild-type-LT-transfected
cells. Nevertheless, H42Q
was still very effective in inducing
apoptosis (over 70% of the cells
survived in the control sample).
The killing induced by H42Q cannot be
the result of leakiness,
because a deletion mutant lacking the J domain
(

2-79) also completely
induced cell
death.
Apoptosis is often associated with inappropriate growth signals.
Although we have shown previously that H42Q was defective
in promoting
S phase in NIH 3T3s, the differences between wild-type
and
J

LT could be imagined to result from signals for cell
cycle progression
in C2C12s. The ability of H42Q to promote cell cycle
progression
was compared to that of wild-type LT in C2C12s (Fig.
2E).
Since
LT induced apoptosis in these cells under low-serum conditions,
the number of LT-positive cells that survived after serum withdrawal
was low (10%). It was nonetheless feasible to score over 300 LT-positive
cells for DNA replication. The results, shown in Fig.
2E,
demonstrate
that J

mutants were as defective in
stimulating DNA synthesis in C2C12s
as in 3T3s. This result indicates
that apoptosis induced by LT
is not simply a result of inducing S phase
under inappropriate
conditions.
After serum withdrawal, LT activation of the cyclin A promoter,
like induction of apoptosis, requires an intact Rb binding site but not
J function.
In considering possible J-independent targets for LT,
the cyclin A promoter was an attractive candidate for several reasons. First, it has been reported that LT affects cyclin A levels in myoblasts (20). Second, cell cycle regulation of the human
cyclin A gene promoter is mediated by a variant E2F site at
37 to
33 (67). While a mutation at that site abolished the
increased promoter activity resulting from serum stimulation, it also
gave rise to a higher basal activity, suggesting a role for the E2F site in restricting activity of the promoter. In addition, repression of the promoter by p130 and histone deacetylase HDAC1 was observed (73). These findings raised the possibility that LT's
effect on such a promoter might differ from that observed in a simple E2F model promoter.
The

89/+11 fragment of cyclin promoter A (Fig.
3A), which contains the serum-responsive
E2F site and which was the smallest
construct displaying the cell cycle
regulation profile of the
full-length promoter (
29,
67), was
used in these studies.
Even in growing cells it was obvious that LT
regulates the cyclin
A promoter differently than the simple
E2F-containing promoters
described previously. Mutant LT that is
defective in Rb binding
still retained substantial ability to activate
the cyclin A promoter
(8-fold) (Fig.
3B) compared to a value of 36-fold
for the wild
type. A J mutant (H42Q) of LT was also active in the
cyclin A-luciferase
assay, inducing the promoter 21-fold. Therefore, in
growing cells,
LT's effect on the cyclin A promoter, which has an E2F
site, is
only partially dependent on Rb binding and J domain function.
By comparison, previous work on simple E2F-containing promoters
showed
that LT activation is almost completely Rb and J dependent
(
70).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 3.
Regulation of cyclin A promoter by PyLT. (A) Diagram of
the cyclin A promoter. The 89 to +11 sequence of the cyclin A
promoter was fused to the luciferase reporter (67). One ATF
site, two NF1 sites, one CHR site, and an E2F site ( 37/ 33) have
been noted in this promoter. The 37/ 33 site that was mutated is
involved in serum responsiveness. (B) LT activation of the cyclin A
promoter in growing NIH 3T3 cells. Cells incubated in 10% calf serum
were transfected with 3 µg of the indicated plasmids together with 1 µg of the cyclin A-luc reporter. The luciferase activity was measured
at 48 h after transfection. All values are fold activation
compared to the control samples. (C) Effects of LT and its mutants on
the cyclin A promoter in serum-starved NIH 3T3 cells. NIH 3T3 cells
cultured with 10% calf serum were transfected with 3 µg of either a
control vector (CON), wild-type LT, Rb LT, or H42Q LT
together with 1 µg of reporter DNA. At 24 h after transfection,
cells were washed and incubated in DMEM with 0.2% calf serum for
another 24 h. (D) LT regulation of the 37/ 33 E2F mutant cyclin
A promoter in serum-starved NIH 3T3 cells. This experiment was done
similarly to that shown in Fig. 4B except the mutant cyclin A (MUT CYC
A) promoter was used instead of the wild-type cyclin A promoter.
|
|
Even more striking results were obtained when transfected cells were
placed in low serum in the same manner as in the apoptosis
assay.
J

LT (H42Q) and Rb

LT behaved very
differently towards the cyclin A promoter (Fig.
3C). NIH 3T3 cells were
transfected in 10% calf serum, changed
to 0.2% calf serum 24 h
after transfection, and harvested at 48
h. In 19 experiments
wild-type LT always caused strong expression
from the cyclin A
promoter. While activation of as much as 100-fold
has been observed, an
average value of 32-fold was seen. This
activation was strikingly
dependent on its pRb binding, as the
Rb

LT had almost no
activity. The J domain mutant of LT, although
not as active as
wild-type LT, induced a 7.9-fold activation.
Therefore, in
serum-starved NIH 3T3 cells, Rb binding but not
J function was
necessary for LT to activate the cyclin A promoter
fully.
The requirement for Rb binding for LT activity in starved cells
prompted us to examine the involvement of the

37/

33 E2F
site
responsible for serum responsiveness (
67) in LT activation
of the cyclin A promoter. Mutation of the E2F site had a small
effect
on activation (18-fold) of the cyclin A promoter by wild-type
LT in
starved cells (Fig.
3D). Therefore, there must be targets
other than
the E2F site for LT activation of the cyclin A promoter.
These could be
one of the upstream sites (ATF or NF1). Alternatively,
it could be the
basal transcription factor machinery. SV40 LT
is clearly capable of
affecting TATA binding elements (
59).
More importantly, the
genetics of LT activation were very different.
The J mutant acted
towards the mutant promoter as it did with
the wild-type promoter, that
is, somewhat less than wild-type
LT (11-fold). In contrast to the
wild-type promoter, Rb

LT activated the mutant cyclin A
promoter similarly to the wild
type (Fig.
3D). In other words, the E2F
site in the cyclin A promoter
conferred Rb dependence for LT activation
in serum-starved cells
but was not needed for promoter activity in the
presence of LT.
This means that the principal function of this E2F site
is repression.
Rb binding is necessary for LT to release that
repression so it
can activate at other sites. The ability of
Rb

and J

LTs to transactivate the E2F
mutant promoter suggests that LT
has transactivation functions that do
not require these particular
LT
functions.
J mutant LTs induced hyperphosphorylation of Rb and p130.
The
data on the cyclin A promoter indicate that the effect of LT is
restricted by the E2F site unless it binds Rb. Further, because J
mutants are active in serum-withdrawn cells, binding of Rb family
members by LT is sufficient for significant activity. The Rb effect is
mediated by the E2F site in the cyclin A promoter. This raised the
question of what effect the J mutant has on Rb family members that
could be acting through the E2F site. Previous work showed a mobility
shift in p130 when J
PyLT was present compared to when
wild-type LT was present (70). A similar difference for p130
was also observed by the DeCaprio group for SV40 LT (74).
A decrease in the mobility of HA-p130 compared to either p130 alone or
cotransfected with wild-type LT was observed in growing
C33As (Fig.
4A). Mutation in the H, P, or D residue
in the J domain
enabled the mutant to supershift HA-p130. This mobility
shift
of p130 was dependent on pRb binding of LT, because LT mutants
that are defective in both pRb binding and J function were unable
to
change the mobility of HA-tagged p130. The same supershift
was observed
in serum withdrawal protocols such as those used
for the cyclin A
promoter and apoptosis experiments (e.g., see
Fig.
6). It also did not
matter which cells (3T3, Rb

C33As, or wild-type RB
C2C12s) were used.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 4.
J mutant LT modifies the phosphorylation of p130. (A)
J LT-induced p130 mobility shift in C33A cells. C33A
cells were transfected with 6 µg of HA-p130 and 3 µg of the
indicated different LT constructs. At 48 h after transfection,
cells were harvested and extracted. Cell extracts were run on
SDS-7.5% PAGE and blotted for HA-p130 with 12CA5. Arrowheads indicate
p130 with different mobilities. (B) Phosphatase treatment of HA-p130
reverses the mobility shift induced by J LT. C33A cells
were transfected with either wild-type (WT) LT or P43S together with
HA-p130. At 48 h after transfection, cells were extracted and
extracts were immunoprecipitated with anti-HA-antibody 12CA5 bound to
SAS beads. The immunoprecipitates were then separated into two sets.
One set was treated with 20 U of phosphatase per sample for 1 h at 37°C, and the other set was incubated under the same conditions
without phosphatase. Finally, these immunoprecipitates were subjected
to SDS-7.5% PAGE and blotted for HA-p130 with 12CA5. Arrows indicate
differently phosphorylated states of p130. (C) Hydroxylamine treatment
of HA-p130. The left panel shows hydroxylamine mapping of p130, and the
right panel displays a diagram of p130 with the two large potential
hydroxylamine fragments shown and the CDK2 binding site marked. The
asterisk in the right panel represents Thr-986. C33A cells were
transfected with either wild-type (WT) LT or H42Q together with
HA-p130. At 48 h after transfection, cells were lysed and cell
lysates were immunoprecipitated with 12CA5 bound on SAS beads. The
immunoprecipitates were then in vitro labeled with 32P as
described in Materials and Methods. The labeled precipitates were then
subjected to electrophoresis. After electrophoresis, the area
corresponding to the p130 position was cut and treated with
hydroxylamine and then subjected to a second round of electrophoresis.
Arrow 1 indicates the N-terminal fragment of p130. Arrow 2 indicates
the C-terminal fragment.
|
|
The mobility change in HA-p130 was due to phosphorylation of p130.
After cotransfection of H42Q and HA-p130, immunoprecipitated
HA-130 was
treated with lambda phosphatase and run on SDS-PAGE.
HA-p130 was then
detected by 12CA5 on a Western blot. As shown
in Fig.
4B, the
slow-moving p130 shifted to the control level
upon phosphatase
treatment. Although the mobility of p130 was
changed by cotransfection
of LT J mutants,
32P labeling data indicated that there was
only minimal change in
the overall phosphorylation (not shown).
Therefore, it seems that
the mobility shift seen in the J

LT complexes results from specific phosphorylation of p130 rather
than
a global change in the p130 phosphorylation
state.
To localize this phosphorylation on the p130 molecule, hydroxylamine
mapping was carried out. To obtain labeled material,
immunoprecipitates
were labeled with [
32P]ATP in vitro. This labeling simply
marks the molecule, since
the mobility shift observed by Western blot
is retained after
this treatment (not shown). After the protein was
subjected to
SDS-7.5% PAGE, the portion of the gel containing p130
was treated
with hydroxylamine. The fragments were then resolved on a
second
SDS-13% acrylamide gel. p130 has two hydroxylamine sites (NG),
dividing p130 into three fragments: residues 1 to 739, 739 to
754, and
754 to 1139. The second piece is too small to be observed
on the gel,
and therefore, only two labeled fragments were seen
(Fig.
4C, left
panel). In the presence of H42Q, only the carboxy-terminal
fragment
showed a mobility change compared to the corresponding
fragment in the
presence of wild-type LT (Fig.
4C, right
panel).
In addition to p130, we also examined the phosphorylation patterns of
Rb and p107 in the presence of J domain mutant LT in
3T3s using the
24-h low-serum treatment. The results were more
complicated. Control
cells still showed slower-migrating phosphorylated
forms of Rb. Cells
coexpressing wild-type LT or Rb

LT showed predominantly a
rapidly migrating Rb band. Compared
to this band, the Rb band seen when
J

LT was coexpressed was hyperphosphorylated and showed a
doublet
(Fig.
5). There was no obvious
change in p107 mobility in the
presence of J mutant LT in any cell
tested (not shown).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 5.
Modification of pRb by J LT.
J LT induced a mobility shift in Rb in serum-starved NIH
3T3 cells. NIH 3T3 cells were transfected with 4 µg of HA-Rb and 4 µg of the indicated different LT constructs. At 24 h after
transfection, cells were fluid changed into 0.2% calf serum medium.
Cells were harvested at 48 h, and cell extracts were separated by
SDS-PAGE and blotted with anti-HA antibody HA-11. Arrowheads indicate
Rb at different mobilities.
|
|
Mutation of threonine 986 on p130 changes its response to
J
mutant LT.
In considering where phosphorylation of
130 must occur when J
LT is expressed, we were struck by
the sequence homology between Thr-986 of p130 and Thr-821 of Rb.
Thr-821 of pRb is known to be phosphorylated in vivo (45).
The sequence surrounding this site, P-T821-P-T-X (where X represents a
basic residue), bears homology to both cdc2 and JNK/p38 phosphorylation
sites, Ser/Thr-Pro (11). This site is conserved in both
human and murine pRb and p130, but not p107. A mutant p130 was
constructed by site-directed mutagenesis in which Thr-986 was converted
to Ala. This mutation caused the protein to migrate slightly slower on
SDS-PAGE. The striking result was that coexpression of J
LT caused little shift of this p130 mutant (Fig.
6) compared to the wild type. This result
indicated that Thr-986 in p130 is one of the phosphorylation sites
responsible for the observed supershift of p130 in the presence of
J
LT. In the case of Rb, it is unclear if Thr-821 is also
targeted by J
LT, since there was no obvious change in
RbT821A in the presence of J
LT compared to wild-type Rb
(Fig. 6).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 6.
Threonine 986 on p130 is a phosphorylation site modified
by J LT. NIH 3T3 cells were transfected with either
wild-type p130 (130), a mutant p130 that has a T986A mutation (130TA),
wild-type Rb (Rb), or mutant RbT821A (RbTA) together with either H42Q
LT or a control vector (CON). At 24 h after transfection, cells
were fluid changed with 0.2% calf serum medium. Cells were harvested
at 48 h, and cell extracts were separated by SDS-PAGE and blotted
with anti-HA antibody HA-11. Arrowheads indicate different mobilities
of p130, Rb, and their mutants.
|
|
 |
DISCUSSION |
PyLT induces apoptosis in differentiating C2C12 cells in a manner
that is completely dependent on Rb family binding. Although cell death
induced by LT was completely dependent on pRb binding, cells
transfected with J domain mutants underwent apoptosis. This function of
J
mutants is strikingly different than that seen in
assays such as DNA synthesis and simple E2F-containing promoter
activation. J
LTs are inactive in those assays.
Distinctions in the ways LTs reach the Rb family, seen here for PyLT,
has recently been noted for SV40 LT in other kinds of assays (23a).
It is not surprising that interactions between LT and Rb family members
affect cell survival. Loss of Rb in Rb
/
fibroblasts
results in apoptosis when cells are placed under conditions that would
promote growth arrest (1, 30, 48). A role in protecting
myoblasts from apoptosis has also been observed in transgenic mouse
experiments (85). In some mouse strains, p130 null
phenotypes have also been associated with apoptosis (43).
The phenotype of LT J domain mutants was intermediate; killing was less
efficient than that of wild-type LT. The difference suggests that two
Rb-dependent pathways lead to apoptosis: one pathway requires J
function, while the other is J function independent. Activation of E2F
family members may be involved in the J-dependent pathway.
Overexpression of E2F-1 in serum-starved cells can cause apoptosis
(57, 69). In our hands, C2C12s were killed by transfection of E2F1 (not shown). Efforts to confirm the role of E2F1 directly by
inhibition of the pathway were not successful. Transfection of dominant
negative forms of E2F-1, DP1, or both did not prevent LT-induced
apoptosis. Since E2F1 has been reported to kill via p53
(57), dominant negative p53 was also tried. Even though reporter assays showed that dominant negative p53 could repress wild-type p53 activity, expression of the dominant negative p53 in
C2C12s failed to prevent apoptosis. In any of these experiments, the
existence of a second pathway might obscure effects from the dominant
negatives. Since heat shock proteins are also known to have
antiapoptotic effects (23, 36), it is also possible that the
J-dependent killing includes sequestering cellular heat shock proteins
by LT via the J domain.
How can the apoptosis caused by J
LT be understood? There
are at least two possible models to explain J independence. The first
is more passive. In such a model, pRb, which is known to have
antiapoptotic function, might bind a cellular target to prevent apoptosis. LT binding to Rb may simply prevent the interaction necessary for its antiapoptotic function. This would be different, for
example, from promoter activation at E2F sites, which is thought to
require release of active E2F from Rb/E2F complexes. There are a number
of potential candidates for antiapoptotic targets. HDAC1, a general
transcriptional repressor that binds to Rb and has the potential to
induce apoptosis through a variety of pathways (6-8, 19, 49,
50), is one attractive possibility. Riz1 is a proapoptotic
protein that binds Rb and could potentially be regulated in such a
manner (28). Rb binding to MDM2 can affect its antiapoptotic
activity (35). Finally, another candidate is HBP-1, a
specific transcriptional regulator that becomes apoptotic when its
LXCXE and IXCXE motifs are mutated to prevent Rb family binding (A. Yee, unpublished data). In models of sequestration, phosphorylation
obviously could affect Rb association with partners. A second model,
perhaps less likely, envisions a more active role for Rb in which a
modified Rb form itself contributes directly to apoptosis. In the case
of J
LT, this might be a phosphorylated form.
What do we know in molecular terms about the differences between
J
and Rb
LTs? There are at least two things
that J
LT can do that Rb
LT does not:
modify the phosphorylation state of Rb and p130 and transactivate
promoters such as cyclin A under serum-starved conditions. These two
functions are not necessarily independent.
We have demonstrated that J
LT affects phosphorylation of
the Rb family members. In the case of p130, J
LT clearly
modifies its C terminus; genetic analysis suggests that T986 is one
significant site. It is possible that this phosphorylation is novel for
the J domain mutants, since the mobility shift is not observed with the
wild type. However, we favor the notion that the wild type induces the
same phosphorylation. For the wild type, the regulation of Rb family
members proceeds with subsequent loss of the phosphorylated species,
whereas the J mutants are stopped at the step requiring the J domain.
Phosphorylation of Rb family members is well known to be involved in
regulation of their function. In cell cycle progression,
phosphorylation is involved in the inactivation of Rb regulation of
E2F; J
LT-induced phosphorylation is clearly insufficient
to affect Rb regulation of E2F, since the J mutants of LT are not
active in E2F transactivation. However, phosphorylations may serve to regulate Rb functions besides E2F regulation. For example,
phosphorylation of Rb family members has been associated with apoptosis
(33), although it is not clear that it is causal. Attempts
to block cell killing with the phosphorylation mutants of p130 or Rb
described here have not been successful so far. Therefore, the
connection between the phosphorylation of Rb family members induced by
J
LT and the ability of J
LT to influence
their function remains an open question.
Regulation of the cyclin A promoter is another function that
differentiates J
from Rb
LT. Under
conditions of low serum, LT transactivation is Rb dependent but only
somewhat J dependent, just like apoptosis. Interestingly, Fimia and
colleagues (20) have shown that LT-expressing myoblasts express higher levels of cyclin A than controls. Since transfection of
vectors expressing cyclin A did not kill, cyclin A itself does not
appear to be responsible for cell death. However, it would be
reasonable to think that other promoters might be regulated the same way.
The cyclin A data suggest a simple explanation for LT promoter
activation that may be Rb dependent but largely J independent (Fig.
7). In contrast to simple E2F promoters
where LT causes activation by generating active E2F from Rb/E2F
complexes (Fig. 7A), on the cyclin A promoter LT affects the ability of
Rb family members to act in repression (Fig. 7B). The basic
considerations are these. Mutation of the E2F site had very little
effect on the activity of the promoter. In other words, LT was not
activating through this site. However, in a wild-type promoter with the
37/
33 E2F site intact, LT needed an Rb binding function to
transactivate. LT transactivation of a cyclin A promoter lacking the
37/
33 E2F site is largely Rb independent because there is no
repression to relieve. Repression at an E2F site occurs when it is
occupied by an Rb family-E2F family complex. Such a complex could
contain additional components, such as HDAC1. It is well known that E2F sites can function as repressors. For example, in myoblasts, such a
site is known to repress activity under differentiating conditions (71). One way that this can occur is via interaction with
histone deacetylase and basal transcription factors such as TFIID
(63). The complex prevents LT from activating through other
sites on the promoter. When LT binds Rb family members, it prevents
formation of the restricting complex, perhaps by preventing entry of
something like HDAC1. This would make LT activity highly dependent on
Rb binding in serum-starved cells. In growing cells, where E2F may occupy the site without an Rb family members, then Rb binding would be
less important, and Rb
LT would have activity. These are
the results observed. Is the cyclin A promoter effect completely
separate from the observed effect on phosphorylation? It need not be;
phosphorylation could be responsible for disrupting complexes between
Rb family members and Rb binding proteins. For cyclin A, p130 has been
reported to inhibit the wild-type promoter (73). It is
certainly possible that phosphorylated p130 or pRb behaves differently
from unphosphorylated p130. Such differences could have a direct effect
on activity through the E2F sites or an indirect effect by changing
access to the rest of the promoter.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 7.
Model for LT regulation of the cyclin A promoter. (A) LT
activates simple E2F-containing promoters by releasing E2F-1 from the
E2F/Rb complex. (B) LT activates a more complicated promoter, such as a
cyclin A promoter, in a manner not dependent on the E2F site. This
activation (indicated by the arrows) could be through either basal (B)
or transcription factor (ATF or NF1) sites. When the E2F site is
occupied by an E2F complex containing Rb and other elements (HDAC-1 or
some other Rb-binding protein X), Rb LT lacks the ability
to transactivate. When LT can bind Rb, even if it is J ,
the complex (Rb/E2F/X or HDAC-1) does not assemble and LT can
transactivate regardless of whether the site is occupied.
|
|
Finally, the data also underscore additional Rb-independent mechanisms
for LT transactivation. The notion that LT might have Rb-independent
functions in transactivation is not novel (34, 42); in SV40
LT, several different targets of transactivation have been demonstrated
(26, 87). In addition to targeting transcription factors, LT
may also target the basal transcriptional machinery, since this appears
to happen for SV40 LT (59). Since the E2F mutant promoter is
fully activated by LT, the non-Rb-dependent transactivation accounts
for the major activity of LT. LT activates promoters like cyclin A
through sites other than E2F.
 |
ACKNOWLEDGMENTS |
This work was supported by NIH grant CA34722.
We thank Jennifer A. Kean for technical assistance.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry, Tufts University School of Medicine, 136 Harrison Ave., Boston, MA 02111. Phone: (617) 636-6876. Fax: (617) 636-2409. E-mail:
bschaffh_pol{at}opal.tufts.edu.
 |
REFERENCES |
| 1.
|
Almasan, A.,
Y. Yin,
R. E. Kelly,
E. Y. Lee,
A. Bradley,
W. Li,
J. Bertino, and G. M. Wahl.
1995.
Deficiency of retinoblastoma protein leads to inappropriate S-phase entry, activation of E2F-responsive genes and apoptosis.
Proc. Natl. Acad. Sci. USA
92:5436-5440[Abstract/Free Full Text].
|
| 2.
|
Antonucci, T. K.,
P. Wen, and W. J. Rutter.
1989.
Eukaryotic promoters drive gene expression in Escherichia coli.
J. Biol. Chem.
264:17656-17659[Abstract/Free Full Text].
|
| 3.
|
Asselin, C., and M. Bastin.
1985.
Sequences from polyomavirus and simian virus 40 large T genes capable of immortalizing primary rat embryo fibroblasts.
J. Virol.
56:958-968[Abstract/Free Full Text].
|
| 4.
|
Basilico, C.,
D. Zouzias,
G. Della Valle,
S. Gattoni,
V. Colantuoni,
R. Fenton, and L. Dailey.
1980.
Integration and excision of polyoma virus genomes.
Cold Spring Harbor Symp. Quant. Biol.
44:611-620.
|
| 5.
|
Blau, H. M.,
G. K. Pavlath,
E. C. Hardeman,
C. P. Chiu,
L. Silberstein,
S. G. Webster,
S. C. Miller, and C. Webster.
1985.
Plasticity of the differentiated state.
Science
230:758-766[Abstract/Free Full Text].
|
| 6.
|
Brehm, A., and T. Kouzarides.
1999.
Retinoblastoma protein meets chromatin.
Trends Biochem. Sci.
24:142-145[CrossRef][Medline].
|
| 7.
|
Brehm, A.,
E. A. Miska,
D. J. McCance,
J. L. Reid,
A. J. Bannister, and T. Kouzarides.
1998.
Retinoblastoma protein recruits histone deacetylase to repress transcription.
Nature
391:597-601[CrossRef][Medline].
|
| 8.
|
Brehm, A.,
S. J. Nielsen,
E. A. Miska,
D. J. McCance,
J. L. Reid,
A. J. Bannister, and T. Kouzarides.
1999.
The E7 oncoprotein associates with Mi2 and histone deacetylase activity to promote cell growth.
EMBO J.
18:2449-2458[CrossRef][Medline].
|
| 9.
|
Bullock, P.
1997.
The initiation of simian virus 40 DNA replication in vitro.
Crit. Rev. Biochem. Mol. Biol.
32:503-568[Medline].
|
| 10.
|
Campbell, K. S.,
K. P. Mullane,
I. A. Aksoy,
H. Stubdal,
J. Zalvide,
J. M. Pipas,
P. A. Silver,
T. M. Roberts,
B. S. Schaffhausen, and J. A. DeCaprio.
1997.
DnaJ/hsp40 chaperone domain of SV40 large T antigen promotes efficient viral DNA replication.
Genes Dev.
11:1098-1110[Abstract/Free Full Text].
|
| 11.
|
Chauhan, D.,
T. Hideshima,
S. Treon,
G. Teoh,
N. Raje,
S. Yoshihimito,
Y. T. Tai,
W. Li,
J. Fan,
J. DeCaprio, and K. C. Anderson.
1999.
Functional interaction between retinoblastoma protein and stress-activated protein kinase in multiple myeloma cells.
Cancer Res.
59:1192-1195[Abstract/Free Full Text].
|
| 12.
|
Cheetham, M. E., and J. P. Brion.
1992.
Human homologues of the bacterial heat-shock protein DnaJ are preferentially expressed in neurons.
Biochem. J.
284:469-476.
|
| 13.
|
Chen, C. A., and H. Okayama.
1988.
Calcium phosphate-mediated gene transfer: a highly efficient transfection system for stably transforming cells with plasmid DNA.
BioTechniques
6:632-637[Medline].
|
| 14.
|
Cherington, V.,
B. Morgan,
M. Spiegelman, and T. M. Roberts.
1986.
Recombinant retroviruses that transduce individual polyoma tumor antigens: effects on growth and differentiation.
Proc. Natl. Acad. Sci. USA
83:4307-4311[Abstract/Free Full Text].
|
| 15.
|
Della Valle, G.,
R. G. Fenton, and C. Basilico.
1981.
Polyoma large T antigen regulates the integration of viral DNA sequences into the genome of transformed cells.
Cell
23:347-355[CrossRef][Medline].
|
| 16.
|
Doherty, J., and R. Freund.
1997.
Polyomavirus large T antigen overcomes p53 dependent growth arrest.
Oncogene
14:1923-1931[CrossRef][Medline].
|
| 17.
|
Dyson, N.,
R. Bernards,
S. H. Friend,
L. R. Gooding,
J. A. Hassell,
E. O. Major,
J. M. Pipas,
T. Vandyke, and E. Harlow.
1990.
Large T antigens of many polyomaviruses are able to form complexes with the retinoblastoma protein.
J. Virol.
64:1353-1356[Abstract/Free Full Text].
|
| 18.
|
Edlund, T.,
M. D. Walker,
P. J. Barr, and W. J. Rutter.
1985.
Cell-specific expression of the rat insulin gene: evidence for role of two distinct 5' flanking elements.
Science
230:912-916[Abstract/Free Full Text].
|
| 19.
|
Ferreira, R.,
L. Magnaghi-Jaulin,
P. Robin,
A. Harel-Bellan, and D. Trouche.
1998.
The three members of the pocket proteins family share the ability to repress E2F activity through recruitment of a histone deacetylase.
Proc. Natl. Acad. Sci. USA
95:10493-10498[Abstract/Free Full Text].
|
| 20.
|
Fimia, G. M.,
V. Gottifredi,
B. Bellei,
M. Ricciardi,
A. Tafuri,
P. Amati, and R. Maione.
1998.
The activity of differentiation factors induces apoptosis in polyomavirus large T-expressing myoblasts.
Mol. Biol. Cell.
9:1449-1463[Abstract/Free Full Text].
|
| 21.
|
Francke, B., and W. Eckhart.
1973.
Polyoma gene function required for viral DNA synthesis.
Virology
55:127-135[Medline].
|
| 22.
|
Freund, R.,
R. T. Bronson, and T. L. Benjamin.
1992.
Separation of immortalization from tumor induction with polyoma large T mutants that fail to bind the retinoblastoma gene product.
Oncogene
7:1979-1987[Medline].
|
| 23.
|
Gabai, V. L.,
A. B. Meriin,
J. A. Yaglom,
V. Z. Volloch, and M. Y. Sherman.
1998.
Role of Hsp70 in regulation of stress-kinase JNK: implications in apoptosis and aging.
FEBS Lett.
438:1-4[CrossRef][Medline].
|
| 23a.
|
Gjoerup, O.,
H. Chao,
J. A. DeCaprio, and T. M. Roberts.
2000.
pRB-dependent, J domain-independent function of simian virus 40 large T antigen in override of p53 growth suppression.
J. Virol.
74:864-874[Abstract/Free Full Text].
|
| 24.
|
Gjørup, O.,
P. Rose,
P. Holman,
B. Bockus, and B. Schaffhausen.
1994.
Protein domains connect cell cycle stimulation directly to initiation of DNA replication.
Proc. Natl. Acad. Sci. USA
91:12125-12129[Abstract/Free Full Text].
|
| 25.
|
Graham, F. L., and A. J. van der Eb.
1973.
A new technique for the assay of infectivity of human adenovirus 5 DNA.
Virology
52:456[CrossRef][Medline].
|
| 26.
|
Gruda, M. C.,
J. M. Zabolotny,
J. H. Xiao,
I. Davidson, and J. C. Alwine.
1993.
Transcriptional activation by simian virus 40 large T antigen: interactions with multiple components of the transcription complex.
Mol. Cell. Biol.
13:961-969[Abstract/Free Full Text].
|
| 27.
|
Harris, K. F.,
J. B. Christensen,
E. H. Radany, and M. J. Imperiale.
1998.
Novel mechanisms of E2F induction by BK virus large-T antigen: requirement of both the pRb-binding and the J domains.
Mol. Cell. Biol.
18:1746-1756[Abstract/Free Full Text].
|
| 28.
|
He, L.,
J. X. Yu,
L. Liu,
I. M. Buyse,
M. S. Wang,
Q. C. Yang,
A. Nakagawara,
G. M. Brodeur,
Y. E. Shi, and S. Huang.
1998.
RIZ1, but not the alternative RIZ2 product of the same gene, is underexpressed in breast cancer, and forced RIZ1 expression causes G2-M cell cycle arrest and/or apoptosis.
Cancer Res.
58:4238-4244[Abstract/Free Full Text].
|
| 29.
|
Henglein, B.,
X. Chenivesse,
J. Wang,
D. Eick, and C. Brechot.
1994.
Structure and cell cycle-regulated transcription of the human cyclin A gene.
Proc. Natl. Acad. Sci. USA
91:5490-5494[Abstract/Free Full Text].
|
| 30.
|
Herrera, R. E.,
V. P. Sah,
B. O. Williams,
T. P. Makela,
R. A. Weinberg, and T. Jacks.
1996.
Altered cell cycle kinetics, gene expression, and G1 restriction point regulation in Rb-deficient fibroblasts.
Mol. Cell. Biol.
16:2402-2407[Abstract].
|
| 31.
|
Hinds, P. W.,
S. Mittnacht,
V. Dulic,
A. Arnold,
S. I. Reed, and R. A. Weinberg.
1992.
Regulation of retinoblastoma protein functions by ectopic expression of cyclins.
Cell
70:993-1006[CrossRef][Medline].
|
| 32.
|
Holman, P.,
O. Gjoerup,
T. Davin, and B. Schaffhausen.
1994.
Characterization of an immortalizing N-terminal domain of polyomavirus large T antigen.
J. Virol.
68:668-673[Abstract/Free Full Text].
|
| 33.
|
Honma, N.,
Y. Hosono,
T. Kishimoto, and S. Hisanaga.
1997.
Phosphorylation of retinoblastoma protein at apoptotic cell death in rat neuroblastoma B50 cells.
Neurosci. Lett.
235:45-48[CrossRef][Medline].
|
| 34.
|
Howes, S.,
B. Bockus, and B. Schaffhausen.
1996.
Genetic analysis of polyomavirus large T nuclear localization: nuclear localization is required for productive association with pRb family members.
J. Virol.
70:3581-3588[Abstract].
|
| 35.
|
Hsieh, J. K.,
F. S. Chan,
D. J. O'Connor,
S. Mittnacht,
S. Zhong, and X. Lu.
1999.
RB regulates the stability and the apoptotic function of p53 via MDM2.
Mol. Cell
3:181-193[CrossRef][Medline].
|
| 36.
|
Jaattela, M.,
D. Wissing,
K. Kokholm,
Y. Kallunki, and M. Egeblad.
1998.
Hsp70 exerts its anti-apoptotic function downstream of caspase-3-like proteases.
EMBO J.
17:6124-6134[CrossRef][Medline].
|
| 37.
|
Kelley, W. L., and C. Georgopoulos.
1997.
The T/t common exon of simian virus 40, JC, and BK polyomavirus T antigens can functionally replace the J-domain of the Escherichia coli DnaJ molecular chaperone.
Proc. Natl. Acad. Sci. USA
94:3679-3684[Abstract/Free Full Text].
|
| 38.
|
Kelley, W. L., and S. J. Landry.
1994.
Chaperone power in a virus?
Trends Biochem. Sci.
19:277-278[CrossRef][Medline].
|
| 39.
|
Kingston, R. E.,
A. Cowie,
R. I. Morimoto, and K. A. Gwinn.
1986.
Binding of polyomavirus large T antigen to the human hsp70 promoter is not required for trans activation.
Mol. Cell. Biol.
6:3180-3190[Abstract/Free Full Text].
|
| 40.
|
Lane, D. P., and L. Crawford.
1979.
T antigen is bound to a host of protein in SV40-transformed cells.
Nature
278:261-263[CrossRef][Medline].
|
| 41.
|
Larose, A.,
N. Dyson,
M. Sullivan,
E. Harlow, and M. Bastin.
1991.
Polyomavirus large T mutants affected in retinoblastoma protein binding are defective in immortalization.
J. Virol.
65:2308-2313[Abstract/Free Full Text].
|
| 42.
|
Larose, A.,
L. St-Onge, and M. Bastin.
1990.
Mutations in polyomavirus large T affecting immortalization of primary rat embryo fibroblasts.
Virology
176:98-105[CrossRef][Medline].
|
| 43.
|
LeCouter, J. E.,
B. Kablar,
P. F. Whyte,
C. Ying, and M. A. Rudnicki.
1998.
Strain-dependent embryonic lethality in mice lacking the retinoblastoma-related p130 gene.
Development
125:4669-4679[Abstract].
|
| 44.
|
Liberek, K.,
J. Marszalek,
D. Ang,
C. Georgopoulos, and M. Zylicz.
1991.
Escherichia coli DnaJ and GrpE heat shock proteins jointly stimulate ATPase activity of DnaK.
Proc. Natl. Acad. Sci. USA
88:2874-2878[Abstract/Free Full Text].
|
| 45.
|
Lin, B. T., and J. Y. Wang.
1992.
Cell cycle regulation of retinoblastoma protein phosphorylation.
Ciba Found. Symp.
170:227-241[Medline].
|
| 46.
|
Linzer, D. I. H., and A. J. Levine.
1979.
Characterization of a 54K Dalton cellular SV40 tumor antigen present in SV40-transformed cells and uninfected embryonal carcinoma cells.
Cell
17:43-52[CrossRef][Medline].
|
| 47.
|
Livingston, D.
1992.
Functional analysis of the retinoblastoma gene product and of RB-SV40 T antigen complexes.
Cancer Surv.
12:153-160[Medline].
|
| 48.
|
Lukas, J.,
J. Bartkova,
M. Rohde,
M. Strauss, and J. Bartek.
1995.
Cyclin D1 is dispensable for G1 control in retinoblastoma gene-deficient cells independently of cdk4 activity.
Mol. Cell. Biol.
15:2600-2611[Abstract].
|
| 49.
|
Luo, R. X.,
A. A. Postigo, and D. C. Dean.
1998.
Rb interacts with histone deacetylase to repress transcription.
Cell
92:463-473[CrossRef][Medline].
|
| 50.
|
Magnaghi-Jaulin, L.,
R. Groisman,
I. Naguibneva,
P. Robin,
S. Lorain,
J. P. Le Villain,
F. Troalen,
D. Trouche, and A. Harel-Bellan.
1998.
Retinoblastoma protein represses transcription by recruiting a histone deacetylase.
Nature
391:601-605[CrossRef][Medline].
|
| 51.
|
Maione, R.,
G. M. Fimia, and P. Amati.
1992.
Inhibition of in vitro myogenic differentiation by a polyomavirus early function.
Oncogene
7:85-93[Medline].
|
| 52.
|
Maione, R.,
G. M. Fimia,
P. Holman,
B. Schaffhausen, and P. Amati.
1994.
Retinoblastoma antioncogene is involved in the inhibition of myogenesis by polyomavirus large T antigen.
Cell Growth Differ.
5:231-237[Abstract].
|
| 53.
|
McCarty, J. S.,
A. Buchberger,
J. Reinstein, and B. Bukau.
1995.
The role of ATP in the functional cycle of the DnaK chaperone system.
J. Mol. Biol.
249:126-137[CrossRef][Medline].
|
| 54.
|
Mudrak, I.,
E. Ogris,
H. Rotheneder, and E. Wintersberger.
1994.
Coordinated trans activation of DNA synthesis and precursor-producing enzymes by polyomavirus large T antigen through interaction with the retinoblastoma protein.
Mol. Cell. Biol.
14:1886-1892[Abstract/Free Full Text].
|
| 55.
|
Ogris, E.,
H. Rotheneder,
I. Mudrak,
A. Pichler, and E. Wintersberger.
1993.
A binding site for transcription factor E2F is a target for trans activation of murine thymidine kinase by polyomavirus large T antigen and plays an important role in growth regulation of the gene.
J. Virol.
67:1765-1771[Abstract/Free Full Text].
|
| 56.
|
Pipas, J. M.
1992.
Common and unique features of T antigens encoded by the polyomavirus group.
J. Virol.
66:3979-3985[Abstract/Free Full Text].
|
| 57.
|
Qin, X.,
D. Livingston,
W. Kaelin, and P. Adams.
1994.
Deregulated transcription factor E2F-1 expression leads to S-phase entry and p53-mediated apoptosis.
Proc. Natl. Acad. Sci. USA
91:10918-10922[Abstract/Free Full Text].
|
| 58.
|
Rassoulzadegan, M.,
Z. Naghasfar,
A. Cowie,
A. Carr,
M. Grisoni,
R. Kamen, and F. Cuzin.
1983.
Expression of the large T protein of polyoma virus promotes the establishment in culture of "normal" rodent fibroblast cell lines.
Proc. Natl. Acad. Sci. USA
80:4354-4358[Abstract/Free Full Text].
|
| 59.
|
Rice, P., and C. Cole.
1993.
Efficient transcriptional activation of many simple modular promoters by simian virus 40 large T antigen.
J. Virol.
67:6689-6697[Abstract/Free Full Text].
|
| 60.
|
Riely, D. J.,
C. Y. Liu, and W. H. Lee.
1997.
Mutations of N-terminal regions render the retinoblastoma protein insufficient for functions in development and tumor suppression.
Mol. Cell. Biol.
17:7342-7352[Abstract].
|
| 61.
|
Riley, M. I.,
W. Yoo,
N. Y. Mda, and W. R. Folk.
1997.
Tiny T antigen: an autonomous polyomavirus T antigen amino-terminal domain.
J. Virol.
71:6068-6074[Abstract].
|
| 62.
|
Rose, P., and B. Schaffhausen.
1995.
Zinc-binding and protein-protein interaction mediated by the polyomavirus large T zinc finger.
J. Virol.
69:2842-2849[Abstract].
|
| 63.
|
Ross, J. F.,
X. Liu, and B. D. Dynlacht.
1999.
Mechanism of transcriptional repression of E2F by the retinoblastoma tumor suppressor protein.
Mol. Cell
3:195-205[CrossRef][Medline].
|
| 64.
|
Sambrook, J.,
E. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 65.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5468[Abstract/Free Full Text].
|
| 66.
|
Schlegel, R., and T. L. Benjamin.
1978.
Cellular alterations dependent upon the polyoma virus hr-t function: separation of mitogenic from transforming capacities.
Cell
14:587-599[CrossRef][Medline].
|
| 67.
|
Schulze, A.,
K. Zerfass,
D. Spitkovsky,
S. Middendorp,
J. Berges,
K. Helin,
P. Jansen-Durr, and B. Henglein.
1995.
Cell cycle regulation of the cyclin A gene promoter is mediated by a variant E2F site.
Proc. Natl. Acad. Sci. USA
92:11264-11268[Abstract/Free Full Text].
|
| 68.
|
Sellers, W.,
B. Novitch,
S. Miyake,
A. Heith,
G. Otterson,
F. Kaye,
A. Lassar, and W. Kaelin.
1998.
Stable binding to E2F is not required for the retinoblastoma protein to activate transcription, promote differentiation, and suppress tumor cell growth.
Genes Dev.
12:95-106[Abstract/Free Full Text].
|
| 69.
|
Shan, B., and W. H. Lee.
1994.
Deregulated expression of E2F-1 induces S-phase entry and leads to apoptosis.
Mol. Cell. Biol.
14:8166-8173[Abstract/Free Full Text].
|
| 70.
|
Sheng, Q.,
D. Denis,
M. Ratnofsky,
T. M. Roberts,
J. A. DeCaprio, and B. Schaffhausen.
1997.
The DnaJ domain of polyomavirus large T antigen is required to regulate Rb family tumor suppressor function.
J. Virol.
71:9410-9416[Abstract].
|
| 71.
|
Shin, E. K.,
A. Shin,
C. Paulding,
B. Schaffhausen, and A. S. Yee.
1995.
Multiple changes in E2F function and regulation occur upon muscle differentiation.
Mol. Cell. Biol.
15:2252-2262[Abstract].
|
| 72.
|
Srinivasan, A.,
A. J. McClellan,
J. Vartikar,
I. Marks,
P. Cantalupo,
Y. Li,
P. Whyte,
K. Rundell,
J. L. Brodsky, and J. M. Pipas.
1997.
The amino-terminal transforming region of simian virus 40 large T and small t antigens functions as a J domain.
Mol. Cell. Biol.
17:4761-4773[Abstract].
|
| 73.
|
Stiegler, P.,
A. De Luca,
L. Bagella, and A. Giordano.
1998.
The COOH-terminal region of pRb2/p130 binds to histone deacetylase 1 (HDAC1), enhancing transcriptional repression of the E2F-dependent cyclin A promoter.
Cancer Res.
58:5049-5052[Abstract/Free Full Text].
|
| 74.
|
Stubdal, H.,
J. Zalvide, and J. A. DeCaprio.
1996.
Simian virus 40 large T antigen alters the phosphorylation state of the Rb-related proteins p130 and p107.
J. Virol.
70:2781-2788[Abstract].
|
| 75.
|
Towbin, H.,
T. Staehelin, and J. Gordon.
1979.
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. USA
76:4350-4354[Abstract/Free Full Text].
|
| 76.
|
Tsai, K. Y.,
Y. Hu,
K. F. Macleod,
D. Crowley,
L. Yamasaki, and T. Jacks.
1998.
Mutation of E2F-1 suppresses apoptosis and inappropriate S phase entry and extends survival of Rb-deficient mouse embryos.
Mol. Cell
2:293-304[CrossRef][Medline].
|
| 77.
|
Vairo, G.,
D. M. Livingston, and D. Ginsberg.
1995.
Functional interaction between E2F-4 and p130: evidence for distinct mechanisms underlying growth suppression by different retinoblastoma protein family members.
Genes Dev.
9:869-881[Abstract/Free Full Text].
|
| 78.
|
Waga, S., and B. Stillman.
1994.
Anatomy of a DNA replication fork revealed by reconstitution of SV40 DNA replication in vitro.
Nature
369:207-212[CrossRef][Medline].
|
| 79.
|
Wang, J. Y. J.
1997.
Retinoblastoma protein in growth suppression and death.
Curr. Opin. Genet. Dev.
7:39-45[CrossRef][Medline].
|
| 80.
|
Weihua, X.,
S. Ramanujam,
D. Lindner,
R. Kudaravalli,
R. Freund, and D. Kalvakolanu.
1998.
The polyoma virus T antigen interferes with interferon-inducible gene expression.
Proc. Natl. Acad. Sci. USA
95:1085-1090[Abstract/Free Full Text].
|
| 81.
|
Weintraub, H.
1993.
The MyoD family and myogenesis: redundancy, networks, and thresholds.
Cell
75:1241-1244[CrossRef][Medline].
|
| 82.
|
Welch, P. J., and J. Y. J. Wang.
1993.
A C-terminal protein binding domain in RB regulates the nuclear c-AB1 tyrosine kinase in the cell cycle.
Cell
75:775-790.
|
| 83.
|
Xiao, Z. X.,
J. D. Chen,
A. Levine,
N. Modjtahedl,
J. Xing,
W. R. Sellars, and D. M. Livingston.
1995.
Interaction between the retinoblastoma protein and the oncoprotein MDM2.
Nature
375:694-697[CrossRef][Medline].
|
| 84.
|
Yaffe, D., and O. Saxel.
1977.
Serial passaging and differentiation of myogenic cells isolated from dystrophic mouse muscle.
Nature
270:725-727[CrossRef][Medline].
|
| 85.
|
Zacksenhaus, E.,
Z. Jiang,
D. Chung,
J. D. Marth,
R. A. Phillips, and B. L. Gallie.
1996.
pRB controls proliferation, differentiation, and death of skeletal muscle cells and other lineages during embryogenesis.
Genes Dev.
10:3051-3064[Abstract/Free Full Text].
|
| 86.
|
Zalvide, J.,
H. Stubdal, and J. A. DeCaprio.
1998.
The J domain of simian virus 40 large T antigen is required to functionally inactivate RB family proteins.
Mol. Cell. Biol.
18:1408-1415[Abstract/Free Full Text].
|
| 87.
|
Zhu, J. Y.,
P. W. Rice,
M. Chamberlain, and C. N. Cole.
1991.
Mapping the transcriptional transactivation function of simian virus 40 large T antigen.
J. Virol.
65:2778-2790[Abstract/Free Full Text].
|
| 88.
|
Zhu, L.,
S. van den Heuvel,
K. Helin,
A. Fattaey,
M. Ewen,
D. Livingston,
N. Dyson, and E. Harlow.
1993.
Inhibition of cell proliferation by p107, a relative of the retinoblastoma protein.
Genes Dev.
7:1111-1125[Abstract/Free Full Text].
|
Journal of Virology, June 2000, p. 5280-5290, Vol. 74, No. 11
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Whalen, K. A., de Jesus, R., Kean, J. A., Schaffhausen, B. S.
(2005). Genetic Analysis of the Polyomavirus DnaJ Domain. J. Virol.
79: 9982-9990
[Abstract]
[Full Text]
-
Markovics, J. A., Carroll, P. A., Robles, M. T. S., Pope, H., Coopersmith, C. M., Pipas, J. M.
(2005). Intestinal Dysplasia Induced by Simian Virus 40 T Antigen Is Independent of p53. J. Virol.
79: 7492-7502
[Abstract]
[Full Text]
-
Love, T. M., de Jesus, R., Kean, J. A., Sheng, Q., Leger, A., Schaffhausen, B.
(2005). Activation of CREB/ATF Sites by Polyomavirus Large T Antigen. J. Virol.
79: 4180-4190
[Abstract]
[Full Text]
-
Genevaux, P., Lang, F., Schwager, F., Vartikar, J. V., Rundell, K., Pipas, J. M., Georgopoulos, C., Kelley, W. L.
(2003). Simian Virus 40 T Antigens and J Domains: Analysis of Hsp40 Cochaperone Functions in Escherichia coli. J. Virol.
77: 10706-10713
[Abstract]
[Full Text]
-
Cole, S. L., Tevethia, M. J.
(2002). Simian Virus 40 Large T Antigen and Two Independent T-Antigen Segments Sensitize Cells to Apoptosis following Genotoxic Damage. J. Virol.
76: 8420-8432
[Abstract]
[Full Text]
-
Sullivan, C. S., Pipas, J. M.
(2002). T Antigens of Simian Virus 40: Molecular Chaperones for Viral Replication and Tumorigenesis. Microbiol. Mol. Biol. Rev.
66: 179-202
[Abstract]
[Full Text]
-
Beachy, T. M., Cole, S. L., Cavender, J. F., Tevethia, M. J.
(2002). Regions and Activities of Simian Virus 40 T Antigen That Cooperate with an Activated ras Oncogene in Transforming Primary Rat Embryo Fibroblasts. J. Virol.
76: 3145-3157
[Abstract]
[Full Text]
-
Gjoerup, O., Zaveri, D., Roberts, T. M.
(2001). Induction of p53-Independent Apoptosis by Simian Virus 40 Small t Antigen. J. Virol.
75: 9142-9155
[Abstract]
[Full Text]
-
Schuchner, S., Nemethova, M., Belisova, A., Klucky, B., Holnthoner, W., Wintersberger, E.
(2001). Transactivation of Murine Cyclin A by Polyomavirus Large and Small T Antigens. J. Virol.
75: 6498-6507
[Abstract]
[Full Text]
-
Liekens, S., Neyts, J., De Clercq, E., Verbeken, E., Ribatti, D., Presta, M.
(2001). Inhibition of Fibroblast Growth Factor-2-induced Vascular Tumor Formation by the Acyclic Nucleoside Phosphonate Cidofovir. Cancer Res.
61: 5057-5064
[Abstract]
[Full Text]
-
Li, H., Söderbärg, K., Houshmand, H., You, Z.-Y., Magnusson, G.
(2001). Effect on Polyomavirus T-Antigen Function of Mutations in a Conserved Leucine-Rich Segment of the DnaJ Domain. J. Virol.
75: 2253-2261
[Abstract]
[Full Text]
-
Chao, H. H. A., Buchmann, A. M., DeCaprio, J. A.
(2000). Loss of p19ARF Eliminates the Requirement for the pRB-Binding Motif in Simian Virus 40 Large T Antigen-Mediated Transformation. Mol. Cell. Biol.
20: 7624-7633
[Abstract]
[Full Text]
-
Berjanskii, M. V., Riley, M. I., Xie, A., Semenchenko, V., Folk, W. R., Van Doren, S. R.
(2000). NMR Structure of the N-terminal J Domain of Murine Polyomavirus T Antigens. IMPLICATIONS FOR DnaJ-LIKE DOMAINS AND FOR MUTATIONS OF T ANTIGENS. J. Biol. Chem.
275: 36094-36103
[Abstract]
[Full Text]