Previous Article | Next Article 
Journal of Virology, June 2000, p. 5206-5212, Vol. 74, No. 11
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Influenza A Viruses Lacking Sialidase Activity Can Undergo
Multiple Cycles of Replication in Cell Culture, Eggs, or Mice
Mark T.
Hughes,1,2
Mikhail
Matrosovich,3,4
M. Elizabeth
Rodgers,3
Martha
McGregor,1 and
Yoshihiro
Kawaoka1,*
Department of Pathobiological Sciences,
School of Veterinary Medicine, University of Wisconsin
Madison,
Madison, Wisconsin 537061; Department of
Pathology, University of Tennessee
Memphis, Memphis, Tennessee
381632; Department of Virology and
Molecular Biology, St. Jude Children's Research Hospital, Memphis,
Tennessee 381053; and M. P. Chumakov Institute of Poliomyelitis and Viral Encephalitides, 142 782 Moscow, Russia4
Received 29 November 1999/Accepted 3 March 2000
 |
ABSTRACT |
Influenza A viruses possess both hemagglutinin (HA), which is
responsible for binding to the terminal sialic acid of
sialyloligosaccharides on the cell surface, and neuraminidase (NA),
which contains sialidase activity that removes sialic acid from
sialyloligosaccharides. Interplay between HA receptor-binding and NA
receptor-destroying sialidase activity appears to be important for
replication of the virus. Previous studies by others have shown that
influenza A viruses lacking sialidase activity can undergo multiple
cycles of replication if sialidase activity is
provided exogenously. To investigate the sialidase requirement of
influenza viruses further, we generated a series of sialidase-deficient
mutants. Although their growth was less efficient than that of the
parental NA-dependent virus, these viruses underwent multiple cycles of replication in cell culture, eggs, and mice. To understand the molecular basis of this viral growth adaptation in the absence of
sialidase activity, we investigated changes in the HA receptor-binding affinity of the sialidase-deficient mutants. The results show that
mutations around the HA receptor-binding pocket reduce the virus's
affinity for cellular receptors, compensating for the loss of
sialidase. Thus, sialidase activity is not absolutely required in the
influenza A virus life cycle but appears to be necessary for efficient
virus replication.
 |
INTRODUCTION |
Influenza A viruses contain two
major surface glycoproteins, hemagglutinin (HA) and neuraminidase (NA)
(14). The HA protein, a trimeric type I membrane protein, is
responsible for virus binding to cell surface sialyloligosaccharide
receptors and for mediating fusion between the viral envelope and
cellular membranes. The NA possesses enzymatic activity that cleaves
-ketosidic linkages between the terminal sialic acid and adjacent
sugar residues of cellular glycoconjugates (1). The
sialidase activity of NA removes terminal sialic acid residues from
both the HA and NA proteins, as well as host cell surface
glycoproteins. Since the terminal sialic acid of
sialyloligosaccharides is critical for HA binding, the
receptor-destroying activity of the NA serves to counter the
receptor-binding activity of the HA. In the absence of functional
sialidase, progeny virions aggregate on the cell surface due to HA
receptor-binding activity and fail to be released unless exogenous
sialidase activity is provided (21, 26).
Air and colleagues (15) produced an NA deletion mutant
virus, NWS-MviA, by passaging the reassortant virus
A/NWS/33HA-A/tern/Australia/G70c/75NA (NWS-G70c) in the presence of anti-N9 antibodies and bacterial (Micromonospora viridifaciens) sialidase. The resultant
NWS-MviA virus contains an internal truncation of a large portion of
the NA gene (bases 140 to 1248), so that the coding region generates the cytoplasmic and transmembrane regions of the protein as well as a
small portion of the stalk (33). The virus therefore lacks sialidase activity, resulting in aggregation of NWS-MviA progeny virions at the host cell surface (16). These studies
indicated that influenza virus sialidase activity is not required for
viral attachment, entry, replication, or formation of progeny virions but is necessary in the late stage of infection for the release of
newly formed virions. Although viral sialidase activity was clearly
dispensable for viral replication in this system, it was still
uncertain whether such activity is needed to sustain efficient replication. In the experiments described here, we asked whether influenza virus can adapt to growth conditions lacking any sialidase activity, and if so, what is the molecular basis of such adaptation.
 |
MATERIALS AND METHODS |
Viruses and cells.
The reassortant virus possessing the HA
of A/NWS/33 and the NA of A/tern/Australia/G70c/75 (NWS-G70c) was
obtained from the repository at St. Jude Children's Research
Hospital. Virus stock was grown either in 10-day-old embryonated
chicken eggs or on Madin-Darby canine kidney (MDCK) cells in
minimal essential medium (MEM) supplemented with 0.3% bovine serum
albumin and 0.5 µg of trypsin per ml. For studies of receptor
binding, all of the viruses were grown in MDCK cells and purified first
by removing cellular debris by low-speed centrifugation and then
by pelleting through a 25% sucrose cushion. Purified viruses were
suspended in 50% glycerol-0.1 M Tris buffer (pH 7.3) and stored at
20°C. MDCK cells were maintained in MEM supplemented with 5%
newborn calf serum (Sigma, St. Louis, Mo.).
Production of the NA-expressing cell line 23-1i.
MDCK cells
were transfected with the use of Lipofectamine (Gibco-BRL,
Gaithersburg, Md.) and the pDK775NA plasmid, which encodes the
A/duck/Hong Kong/7/75 (Dk/HK/75, H2N2) NA gene under the control of a
chicken
-actin promoter, together with the puromycin resistance vector pPur (Invitrogen, Carlsbad, Calif.). A stable cell line expressing the Dk/HK/75 NA gene was established by puromycin selection. The resultant cell line, 23-1i, was maintained in MEM supplemented with
5% fetal calf serum (JRH, Lenexa, Kans.) and 7.5 µg of puromycin sulfate (Sigma) per ml.
Generation of NA deletion mutant 23
NA.
NWS-G70c virus was
passaged 17 times on 23-1i cells in the presence of rabbit anti-N9
antiserum. The virus was then plaque purified (three successive rounds
on 23-1i cells), and the resultant clone was designated
NWS-G70c/23
NA (23
NA).
Production of sialidase-independent virus CK2-29.
The NA
deletion mutant 23
NA was passaged in liquid culture on MDCK cells in
decreasing concentrations of exogenously added Clostridium
perfringens sialidase (starting concentration, 30 mU/ml; Sigma).
For each consecutive passage, the amount of added bacterial sialidase
was reduced stepwise by approximately 0.5-log concentrations to a final
concentration of 0.03 mU/ml by passage 12. Sixteen additional passages
on MDCK cells were performed in the absence of any added bacterial
sialidase. The resultant virus isolate was designated NWS-G70c/CK2-29
(CK2-29).
Passage of CK2-29 virus in embryonated chicken eggs.
Undiluted CK-29 was serially passaged five times in 10-day-old
embryonated chicken eggs (1 ml of undiluted virus per egg, five
replicate samples) and incubated for 2 days at 35°C. Passages 6 and 7 were performed with 100 µl of undiluted allantoic fluid per egg,
while passages 8 to 17 were performed with 100 µl of diluted
allantoic fluid (1:100) per egg. Virus growth was monitored by
hemagglutination of turkey erythrocytes and quantified on MDCK cells.
Two independent egg-adapted viruses from separate replicates were
biologically cloned in eggs by limiting dilution and are referred to as
NWS-G70c/E17A (E17A) and NWS-G70c/E17E (E17E).
Passage of CK2-29 in BALB/c mice.
BALB/c mice (6-week-old
female) were intranasally infected with the CK2-29 virus concentrated
by ultracentrifugation (3.3 × 105 PFU/mouse). Mice
were sacrificed on day 3 postinfection, and the lungs and nasal
turbinates were harvested and homogenized in 1 ml of phosphate-buffered
saline (PBS) containing antibiotics (1,000 U of penicillin and 10 µg
of streptomycin per ml). For subsequent passage, 100 µl of the
mixture of lung and nasal turbinate homogenates was used to infect two
mice intranasally. In each passage, homogenates were grown on MDCK
cells to determine the amount of virus present. After 18 passages,
viral stock was prepared from mouse lung homogenates after a single
passage on MDCK cells. This stock was designated NWS-G70c/M18B (M18B).
Sialidase activity assay.
Viral sialidase activity was
measured in virus suspensions containing 2 × 104 PFU
and
2'-(4-methylumbelliferyl)-
-D-N-acetylneuraminic
acid (Sigma) used as a substrate, as described previously
(13). All reactions were done in triplicate.
Hemagglutination assay.
Hemagglutinating activity was
determined in a microtiter plate format with 0.5% chicken red blood
cells (RBCs) and PBS as a diluent. To avoid possible destruction of the
sialyloligosaccharide receptors on chicken RBCs by the NA of parent
virus, we included the neuraminidase inhibitor zanamivir (kindly
provided by R. Bethell, Glaxo Wellcome, Hertfordshire, United Kingdom)
(2 µM) in the reaction buffer. The hemagglutination reactions were
performed in parallel on ice (0°C) and at 37°C.
Standardization of virus concentrations by ELISA for a
receptor-binding affinity assay.
The stock viruses in PBS (50 µl
of serial twofold dilutions) were adsorbed in the wells of 96-well
assay plates (Costar, Cambridge, Mass.) at 4°C overnight. The plates
were washed with 0.1% Tween 80 solution in PBS. For detection by
enzyme-linked immunosorbent assay (ELISA), 50 µl of anti-WSN virus
rabbit antiserum, diluted 1/1,000 in reaction buffer (RB; 0.2% bovine
serum albumin, 0.02% Tween 80 in PBS), was incubated in the wells for
1 h at 4°C. After washing, 50 µl of peroxidase-labeled goat
anti-rabbit immunoglobulin G (IgG; Sigma), diluted 1/5,000 in RB, was
incubated in the wells for 1 h at 4°C. The plates were washed
again, and bound peroxidase was visualized by incubation with 100 µl
of standard o-phenylenediamine substrate solution for 30 min. The reaction was stopped by adding 50 µl of 5% sulfuric acid
and quantified by measuring absorbancy at 490 nm. The dilutions of the
viruses that produced an absorbancy of 0.4 were determined and served
as a measure of virus concentrations in the stock solutions (see Table
2).
Binding of fetuin-peroxidase conjugate.
The viruses were
adsorbed in the wells of 96-well assay plates (Costar) at 4°C, and
the binding of horseradish peroxidase-labeled fetuin to the
solid-phase-adsorbed viruses was determined as previously described
(9). To standardize the amounts of virus adsorbed onto the
plates, the binding of anti-WSN antibodies to virus-adsorbed plates on
a replicate plate was assayed as described above.
Sequence analysis of NA and HA genes.
Total viral RNA was
obtained by digesting virus samples (250 µl each) with 100 µg of
proteinase K in 10 mM Tris-Cl (pH 7.5)-5 mM EDTA-0.5% sodium dodecyl
sulfate-100 mM NaCl. For cDNA production, the oligonucleotide Uni-12,
complementary to the conserved 12 viral RNA 3'-terminal nucleotides of
influenza A virus gene segments, was used as a primer for the avian
myeloblastosis virus reverse transcriptase (Promega, Madison, Wis.)
reaction. The NA gene cDNA was specifically amplified during 30 rounds of PCR with the NA gene-specific primers N9KspUni12 (5' cRNA
sense primer; CTCTTCGAGCAAAAGCAGGGTCAAGATG) and
N9T3Uni13 (3' cRNA antisense primer;
TTATTAACCCTCACTAAAAGTAGATACAAGGGTCTTTTTTC) and 10 U of
Taq DNA polymerase (Promega). The resulting PCR product was
separated by electrophoresis on 1% low-melting-temperature agarose
(Gibco-BRL) and purified via Ultra-free-MC filtration (Millipore,
Bedford, Mass.) per the manufacturer's instructions. The resultant
purified PCR product was then subcloned into the vector pCR2.1
(Invitrogen) and used as a template for automated fluorescent
sequencing. The HA genes were cloned in a similar fashion using the HA
gene-specific primers WSN-HA-Up (5' cRNA sense primer;
GGATCGATAGCAAAGCAGGGGAAAATAAAAACAACCAAAATGAAGGC) and
WSN-HA-Xho (3' cRNA antisense primer;
CCTCGAGAGTAGAAACAAGGGTGTTTTTCC). At least three independent
cDNA clones were sequenced for each virus. When one of the three cDNA
clones contained a different nucleotide at a given position, it was
taken as evidence that an error had been introduced by the polymerase
during PCR amplification.
 |
RESULTS |
Generation of a cell line expressing influenza virus NA.
To
facilitate generation of a sialidase-independent virus, we first
produced a cell line that constitutively expressed an influenza virus
NA capable of providing viral sialidase in trans. MDCK cells
were transfected with pDK775NA, encoding the Dk/HK/75 NA (N2) protein.
The resultant cell line, 23-1i, constitutively expressed Dk/HK/75 viral
NA. All cells of the 23-1i line expressed N2 NA on their surface, as
demonstrated by immunostaining (data not shown). The levels of
sialidase activity expressed on 23-1i and MDCK cells infected with
Dk/HK/75 did not differ appreciably, as determined by a standard method
(31) that used fetuin as a substrate (data not shown).
Generation of NA deletion mutant 23
NA.
To produce a mutant
virus lacking sialidase activity, we passaged the NWS-G70c virus on
23-1i cells in the presence of rabbit anti-N9 antiserum. Following 17 passages, the virus lacked detectable N9 NA expression, as determined
by immunostaining of infected cells, and could no longer be neutralized
by N9-specific antiserum (data not shown). In contrast, the mutant
virus gained sensitivity to neutralization by antibodies specific for
the N2 NA supplied in trans by the 23-1i cell line (data not shown).
NA sequence of 23
NA virus.
To determine the molecular basis
of resistance of 23
NA to the N9 NA antiserum, we sequenced the
23
NA NA gene, discovering a large deletion of the NA open reading
frame (bases 442 to 1170, cRNA orientation) as well as a point
mutation, T110A, that created a stop codon at position 31 of the NA
coding sequence (Fig. 1). These changes
removed a large portion of the NA coding sequence, resulting in the
expression of a small peptide that corresponded to the tail and the
majority of the transmembrane domain of the NA protein (Fig. 1). Thus,
passage of NWS-G70c in the presence of anti-N9 antiserum and N2 NA
supplied in trans yielded a virus similar to the previously
described sialidase-deficient virus NWS-MviA (15).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 1.
Structure of the NA gene of the 23 NA NA deletion
mutant. (A) Schematic diagram of the genomic structure of the 23 NA
NA gene (cRNA orientation). The 23 NA NA gene contains a
728-nucleotide deletion (from bases 442 to 1170) that removes a large
portion of the NA gene coding sequence. This mutant also contains a
mutation at base 110 that forms an in-frame TAG stop codon. (B)
Potential gene products encoded by this gene. The stop codon at bases
109 to 111 results in termination of the NA coding sequence at codon
31. The remaining portion of the open reading frame corresponds to the
six-amino-acid (aa) tail and 24 amino acids of the transmembrane
region. wt, wild type.
|
|
Generation of sialidase-independent virus CK2-29.
To determine
whether sialidase activity (including an exogenously added one) is an
absolute requirement for influenza virus replication, we serially
passaged the NA deletion mutant 23
NA in liquid culture on MDCK cells
in decreasing concentrations of bacterial (C. perfringens)
sialidase, obtaining sialidase-independent mutant virus CK2-29.
Although this virus undergoes multiple rounds of replication in MDCK
cells, even without exogenous sialidase, it grew to a lower titer than
did the parent virus (Table 1) and
produced smaller plaques (less than 1 mm in diameter) in the absence of
bacterial sialidase than in its presence, suggesting that without
sialidase activity, the virus cannot spread efficiently. During
adaptation to growth in the presence of decreasing levels of sialidase
activity, the HA titer of the virus gradually decreased. The CK2-29
virus, even when harvested from tissue culture wells displaying 100%
cytopathic effect, did not hemagglutinate chicken RBCs. However, it
retained this activity with turkey RBCs, which afford a more sensitive
method of detecting influenza viruses. PCR amplification of the NA gene
of the CK2-29 virus indicated that the virus retained the truncated NA
gene. Analysis of the product revealed only two changes from that of
23
NA, a single-base deletion at residue 283 and a point mutation at
residue 111, changing the TAG stop codon to a TAA stop codon.
A sialidase assay with a fluorescent substrate
(4-methylumbelliferyl-

-
D-
N-acetylneuraminic
acid) demonstrated enzymatic activity
by the parent NWS-G70c
virus as well as 23

NA grown in 23-1i cells,
but not by the CK2-29
virus, confirming the lack of functional
sialidase activity in this
mutant (Fig.
2). Predictably, sialidase
activity was present in the 23

NA virus stock, as these virions
contained the N2 NA sialidase provided by 23-1i cells in
trans.
These findings show that sialidase activity is not
essential for
multiple cycles of influenza virus replication in tissue
culture.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 2.
Sialidase activity of the parental NWS-G70c virus,
23 NA, and the sialidase-independent CK2-29 mutant. For each sample,
virus (2 × 104 PFU) was incubated for 1 h at
37°C in the presence of a fluorogenic sialidase substrate
(4-methylumbelliferyl- -D-N-acetylneuraminic
acid) in triplicate. The fluorescence of released
4-methylumbelliferone was determined with a fluorometer (Labsystems
Fluoroskan II), with excitation at 355 nm and emission at 460 nm.
Standard errors for the triplicate samples (at the 95% confidence
interval) for NWS-G70c were too small to present in the graph. The
detectable sialidase activity in the 23 NA NA deletion mutant results
from sialidase activity of the N2 NA supplied in trans from
23-1i cells.
|
|
Growth of sialidase-independent CK2-29 in eggs and mice.
Increased functional sialidase activity is correlated with efficient
replication of influenza virus in eggs (4). Moreover, adaptation to growth in mice or embryonated eggs results in changes in
the viral genome owing to the selective pressures of these environments
(22, 30). To determine the ability of a
sialidase-independent virus to adapt to other environments, we assessed
the growth of the CK2-29 mutant in both embryonated chicken eggs and mice.
We first determined the 50% egg infective dose (EID
50) of
the CK2-29 stock in ovo. The virus replicated slightly less well
in
this medium than it did in MDCK cells (Table
1). By contrast,
the
NWS-G70c parent grew better in eggs than in MDCK cells, while
the
23

NA virus grew poorly in eggs (Table
1). Thus, the loss
of
functional sialidase by 23

NA severely compromised its replication
in
eggs. However, adaptation to growth in MDCK cells restored
the ability
of the virus to grow in
eggs.
To investigate whether the CK2-29 virus could be adapted to grow better
in eggs, we passaged it 17 times in eggs as described
in Materials and
Methods. The virus titer in allantoic fluid gradually
increased
up to passage 5. Although we passaged the virus 12 additional
times, we
did not observe any further increase in virus titer.
Two independently
adapted clones, E17A and E17E, never reached
the titers attained
by the parental virus (NWS-G70c) in eggs (Table
1), but they still
replicated substantially better than CK2-29.
To assess the ability of CK2-29 to grow in mice, we intranasally
infected 6-week-old BALB/c mice with concentrated virus (3.3
× 10
5 PFU/mouse) in view of its limited growth in this
animal. The
initial infection produced titers approaching 4.6 × 10
4 PFU/g of tissue. After subsequent passage, the virus
titers declined
to approximately 10
3 to 10
4
PFU/g of tissue over 18 serial passages. The titer of the stock
virus
passaged 18 times in mice (M18B) was substantially lower
than the
titers of other viruses (1.8 × 10
3 PFU/ml) (Table
1).
CK2-29 also replicated poorly in eggs (5.9
× 10
2
EID
50/ml) (Table
1). PCR amplification of the NA gene of
both
egg-adapted viruses and the mouse-passaged CK2-29 virus indicated
that all of the viruses maintained the truncated NA gene even
after
extensive passaging. The PCR products produced were indistinguishable
in size from that of CK2-29 by agarose gel electrophoresis (data
not
shown).
These results have demonstrated that viral sialidase activity is
dispensable for multiple cycles of influenza virus replication
in mice,
although the replication is
impaired.
Receptor-binding properties.
To understand the molecular basis
of viral adaptation to different environments in the absence of
sialidase, we compared the receptor-binding properties of the viruses.
Unlike the NA-deficient variants, the parent NWS-G70c virus contained
enzymatically active NA that could affect the receptor-binding activity
of this virus by partial desialylation of the receptors. To block this
effect, we assayed the receptor-binding properties in the presence of the NA inhibitor zanamivir (GG167). Moreover, because the
receptor-binding properties of the viruses can differ depending on the
host-specific glycosylation of the HA (references 5
and 8 and references therein), we grew all viruses
in MDCK cells for the binding studies.
First, we compared the ability of the viruses to agglutinate chicken
RBCs. Virus concentrations in purified virus stock suspensions
were
determined by ELISA with polyclonal anti-WSN serum; specific
hemagglutinating activity was calculated as the ratio of the
hemagglutination
titer at 4°C to the ELISA titer (Table
2, HA
4/ELISA). Thus, the
lower the ratio, the lower the ability of the virus to agglutinate
chicken RBCs. The specific hemagglutinating activity of the
NA-deficient
variant 23

NA was similar to that of the parental
virus, while
that of the CK2-29 variant was about 10-fold lower. An
egg-adapted
variant, E17A, showed a further threefold
decrease in specific
hemagglutination, whereas another egg-adapted
virus, E17E, and
the mouse-passaged M18B variant did not
agglutinate chicken RBCs
at the highest concentrations tested.
The binding affinity of
the virus for chicken RBCs decreased in the
order parent and 23

NA
> CK2-29 > E17A > E17E and
M18B.
In addition to the specific hemagglutinating activity at 4°C, we
determined the ratios of HA titers at two temperatures (Table
2,
HA
37/HA
4). Given that a greater decrease in the
HA titer at
37°C than at 4°C reflects a lower binding affinity of
the virus
(
5), these experiments confirm that the affinity
of the 23

NA
variant is not lower than that of the parent virus. The
CK2-29
mutant bound much less avidly to chicken RBCs than did either
the parental virus or the 23

NA variant. Both egg-adapted variants
and the mouse-adapted virus had even lower affinities than that
of the
CK2-29
virus.
To further characterize the receptor-binding properties of the viruses,
we determined their ability to bind the soluble
sialylglycoprotein
fetuin. After adsorption in the wells of
plastic plates, the viruses
were allowed to bind either
peroxidase-labeled fetuin (Fig.
3A)
or
rabbit anti-WSN antibodies followed by peroxidase-conjugated
anti-rabbit IgG antibodies (Fig.
3B). As shown in Fig.
3B, an
experiment in which antibody binding was used to estimate virus
density, all viruses except 23

NA were present in equal amounts
on
the plates. Therefore, substantial differences in the binding
of
fetuin-horseradish peroxidase conjugate by these viruses cannot
be
explained by their different concentrations on the solid phase
but
rather reflect their different abilities to bind fetuin. That
is,
CK2-29 bound fetuin much less avidly than did the parent virus;
binding
by the variant E17A was only slightly greater than background;
while
E17E and M18B binding failed to be detected with the assay
used. The
density of the 23

NA variant on the solid phase in our
assay was
always lower than that of other viruses, regardless
of the stock
preparation used. The reason for this discrepancy
is not clear.
Nonetheless, there was a clear correlation between
the results of the
hemagglutination (Table
2) and fetuin-binding
(Fig.
3) assays. Both
yielded the same rank order of viruses based
on their relative affinity
for sialic acid-containing receptors
(Table
3): parental virus and 23

NA > CK2-29 > E17A > E17E and
M18B.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 3.
Fetuin-binding affinity of NWS-G70c and its NA deletion
variants. The viruses were adsorbed in the wells of plastic microplates
and allowed to bind either peroxidase-labeled fetuin (Fet-HRP) (A) or
rabbit anti-WSN antibodies, followed by peroxidase-conjugated
anti-rabbit IgG antibodies (B). Levels of bound fetuin or antibody were
then determined with the horseradish peroxidase substrate
o-phenylenediamine and quantified by measuring absorbance at
490 nm. The binding of antibodies served as a measure of virus density
on the solid phase.
|
|
Mutations in the HAs of sialidase-independent viruses.
Because
the function of the viral NA counters the activity of the HA protein,
one could expect interplay between the HA's sialic acid-binding
activity and the NA's sialidase activity, as has been shown recently
(2, 10, 18, 27). Adaptation to growth in the absence of
sialidase activity resulted in a concomitant decrease in the affinity
of the HA protein for cellular receptors, as described above. To
identify the HA alterations responsible for this decreased affinity, we
sequenced the HA gene of the sialidase-independent mutants. The 23
NA
virus contained two mutations, Ser to Arg at residue 193 (H3 numbering
system according to the H1/H3 alignment of Nobusawa et al.
[20]) and Val to Met at residue 205 (Table 3). Residue
193 is a component of the alpha-helix occupying the top of the
receptor-binding pocket (32), and residue 205 lies on the
far side of the globular HA protein head away from the receptor-binding
site (Fig. 4). With one exception (E17E;
M205V reversion), all NA-deficient variants obtained by passaging the 23
NA virus in different hosts retained these two mutations.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 4.
Locations of HA mutations in NA deletion variants.
Mutated amino acids are represented by the filled residues, modeled on
the A/Aichi/68 H3 HA structure (32). For clarity, only the
head portion of HA1 is displayed. Sialic acid in the receptor-binding
pocket is represented as a black ball-and-stick model. Mutations at
residues 135 and 145, found at the right side of the receptor-binding
site, are common to all viruses with greatly reduced affinity for viral
receptors. This figure was generated with RasMol software
(http://www.umass.edu/microbio/rasmol).
|
|
The HA of the sialidase-independent virus CK2-29 contains these two
mutations as well as three additional ones: Val to Ala
at residue 135, Ser to Asn at residue 145, and Arg to Lys at residue
220. All three
residues are in close proximity to the receptor-binding
pocket of the
HA protein. All adapted variants of CK2-29 had additional
mutations
around the receptor-binding site (Table
3, also Fig.
4), consistent
with their altered receptor-binding
activity.
 |
DISCUSSION |
In this study, we have demonstrated that influenza A viruses can
adapt to growth in tissue culture, embryonated eggs, and mice in the
absence of a functional sialidase. The acquisition of sialidase
independence resulted from mutations in the HA, which led to a decrease
in the affinity of the virus for sialic acid-containing receptors, thus
restoring the balance between cell binding and viral release from
cells. This finding is consistent with previous observations that an
imbalance between NA activity and HA receptor-binding affinity, due to
a deletion in the NA stalk (4) or reassortment between human
and avian viruses (11), impairs the fitness of the virus.
Similarly, resistance to the NA inhibitor zanamivir and related
compounds accompanies changes in both the NA and HA proteins (10,
18, 27). Thus, mutations in the HA and NA appear to be capable of
modulating the balance between HA receptor affinity and NA sialidase
activity, depending on the growth environment. Our
sialidase-independent viruses represent an extreme example of how HA
mutations can shift the normal HA-NA balance of influenza A viruses
when no sialidase activity is present.
The 23
NA virus does not grow on MDCK cells in tissue culture;
however, its adapted variant (CK2-29) showed relatively good replication by the reduction of HA affinity. Interestingly, this tissue
culture-adapted virus did not grow well in eggs and mice, suggesting
that a decrease in the affinity of HA alone is not sufficient for
sialidase-independent growth in eggs or mice. In other words, growth in
these hosts (in vivo) is more dependent on functional NA than growth in
tissue culture. This conclusion is reinforced by changes observed in
the egg-adapted and mouse-adapted viruses; both acquired additional
mutations in the HA and showed decreased affinity of HA by comparison
with the tissue culture-adapted CK2-29 virus.
Adaptation of the sialidase-independent CK2-29 virus to eggs increased
egg infectivity by more than 10-fold. Analysis of the receptor-binding
activity suggested that the receptor affinity of egg-adapted and
mouse-passaged viruses was reduced compared with that of their parent
CK2-29 virus. Thus, for viruses lacking any sialidase activity, a
reduction in HA receptor affinity seems to promote better growth in
eggs. This interpretation agrees with the previous finding that higher
functional sialidase activity is needed for increased virus replication
in eggs (4). That is, to replicate efficiently in ovo, the
virus must be efficiently released from cells through either an
increase in sialidase activity or reduced receptor affinity.
Previously, Liu et al. (16) demonstrated the ability of the
NA deletion mutant NWS-MviA to persist for 28 days in immunocompromised nu/nu mice. Our sialidase-independent CK2-29 virus can
undergo multiple rounds of replication in BALB/c mice and be passaged more than 18 times, resulting in the introduction of two mutations in
the HA which decrease the receptor-binding affinity of M18B virus
compared with the parental CK2-29 virus, suggesting that they can
compensate for the lack of viral sialidase. However, we did not find
any increase in virus titers in mouse lungs during passaging, so that
the role of these mutations in virus replication in mice remains uncertain.
To understand the molecular mechanisms by which sialidase-deficient
viruses decrease their binding affinity during adaptation to distinct
environments, we analyzed the amino acid sequences of their HA proteins
(Table 3). The original NA deletion mutant 23
NA acquired two
mutations, S193R and V205M, by comparison with the parental virus.
Changes at these HA positions were previously implicated in the altered
receptor-binding activity of H3N2 human influenza viruses (6, 28,
29), suggesting that they may have the same effect in the 23
NA virus.
The MDCK-adapted, sialidase-independent isolate CK2-29 has three
mutations (G135A, S145N, and R220K) with respect to its progenitor, 23
NA. The former two substitutions are shared by all
sialidase-independent mutants and therefore appear to be critical for
the reduction in their receptor-binding activity. Amino acid 135 is
located in the polypeptide chain from 134 to 139, which forms the
"right" side of the receptor-binding pocket and is primarily
responsible for interactions with sialic acid (residues 134, 135, 136, and 137 each participate in direct atomic interactions with the sialic acid [25, 32]). Therefore, even subtle changes in this
region of the receptor-binding site may affect the affinity of the
virus for the receptor determinant. Mutations at position 145 were
previously shown to be associated with egg adaptation of H3 influenza
viruses (22) and have also been identified in horse
serum-resistant H3 variants (17). Thus, a mutation at this
position alone could affect the receptor-binding activity of the virus.
However, residues 135 and 145 are in direct contact (Fig. 4), so that
mutations in both sites could act in concert, leading to greater
effects on receptor binding than could be anticipated from a change in either site alone. Amino acid 220 is located on the boundary between the HA monomers in relatively close proximity to the amino acids that
form the bottom left portion of the receptor-binding site, and the
Arg-220 is conserved across all 15 influenza A virus HA subtypes
(12, 20, 23). Mutations at this site (R220G or R220S) were
found in serum-resistant variants of H3N2 human virus (24)
and the H3 virus isolated from seals (3), suggesting that
changes in position 220 may be involved in adaptation of the virus
receptor-binding characteristics to new host environments. However, the
effects of substitutions in position 220 on the receptor-binding properties of the virus have not been unambiguously demonstrated in
either this or previous studies because the mutation was always accompanied by other substitutions in the HA.
The adaptation of CK2-29 to growth in eggs and mice led to a selection
of variants with additional amino acid changes in the HA and a further
decrease in affinity. In the mouse-adapted virus M18B there are two
such substitutions, S140P and H141Q. These amino acids are located on
the peptide loop (140 to 145) that forms the right bottom rim of the
receptor-binding site and can potentially interact with the asialic
part of the receptors. Interestingly, the S140P mutation was also
independently selected in egg-adapted variant E17E. Another
substitution in E17E that likely contributes to its decreased affinity,
T132K, is located in the upper-right rim of the binding pocket.
Finally, the E17A isolate contains a unique mutation, A96T, that
creates a potential glycosylation site, which is also present in H1
avian viruses and in most H1 human viruses. A bulky oligosaccharide
moiety at this location could either sterically hinder the
receptor-binding site or affect the position of polypeptide chain 220 to 228 and/or 134 to 139, which form the sialic acid-binding pocket. It
is evident from these data that each variant contains multiple amino
acid substitutions rather than single mutations, suggesting that NA
deletion viruses are so severely impaired that a single substitution
cannot compensate for the defect.
As with the NWS-MviA virus (33), the CK2-29 virus, after
extensive passage in tissue culture, eggs, or mice, retained a truncated NA gene with the capacity to direct synthesis of the cytoplasmic tail and some (our mutants) or all (NWS-MviA virus [33]) of the transmembrane domain and a short stalk.
These findings suggest that the truncated NA protein may be important
in the virus replication cycle, perhaps in virion morphogenesis and
stability. Alternatively, the truncated NA RNA per se may be the
critical element in events such as virion morphogenesis and
ribonucleoprotein packaging. Recently, workers in our laboratory and
others have established a new reverse-genetics system that allows
influenza viruses to be generated entirely from cloned cDNA (7,
19). Using this system, one could directly address the potential
role of the truncated NA gene, its gene product, or both in influenza virus replication.
 |
ACKNOWLEDGMENTS |
We thank Krisna Wells for excellent technical assistance and John
Gilbert for editing the manuscript.
Support for this work came from National Institute of Allergy and
Infectious Diseases, Public Health Service, research grants.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Pathobiological Sciences, School of Veterinary Medicine, University of Wisconsin
Madison, 2015 Linden Dr. West, Madison, WI 53706. Phone: (608) 265-4925. Fax: (608) 265-5622. E-mail:
kawaokay{at}svm.vetmed.wisc.edu.
 |
REFERENCES |
| 1.
|
Air, G. M., and W. G. Laver.
1989.
The neuraminidase of influenza virus.
Proteins Struct. Funct. Genet.
6:341-356[CrossRef][Medline].
|
| 2.
|
Blick, T. J.,
A. Sahasrabudhe,
M. McDonald,
I. J. Owens,
P. J. Morley,
R. J. Fenton, and J. L. McKimm-Breschkin.
1998.
The interaction of neuraminidase and hemagglutinin mutations in influenza virus resistance to 4-guanidino-Neu5Ac2en.
Virology
246:95-103[CrossRef][Medline].
|
| 3.
|
Callan, R. J.,
G. Early,
H. Kida, and V. S. Hinshaw.
1995.
The appearance of H3 influenza viruses in seals.
J. Gen. Virol.
76:199-203[Abstract/Free Full Text].
|
| 4.
|
Castrucci, M. R., and Y. Kawaoka.
1993.
Biologic importance of neuraminidase stalk length in influenza A virus.
J. Virol.
67:759-764[Abstract/Free Full Text].
|
| 5.
|
Crecelius, D. M.,
C. M. Deom, and I. T. Schulze.
1984.
Biological properties of a hemagglutinin mutant of influenza virus selected by host cells.
Virology
139:164-177[CrossRef][Medline].
|
| 6.
|
Daniels, P. S.,
S. Jeffries,
P. Yates,
G. C. Schild,
G. N. Rogers,
J. C. Paulson,
S. A. Wharton,
A. R. Douglas,
J. J. Skehel, and D. C. Wiley.
1987.
The receptor-binding and membrane-fusion properties of influenza virus variants selected using anti-haemagglutinin monoclonal antibodies.
EMBO J.
6:1459-1465[Medline].
|
| 7.
|
Fodor, E.,
L. Devenish,
O. G. Engelhardt,
P. Palese,
G. G. Brownlee, and A. Garcia-Sastre.
1999.
Rescue of influenza virus from recombinant DNA.
J. Virol.
73:9679-9682[Abstract/Free Full Text].
|
| 8.
|
Gambaryan, A. S.,
V. P. Marinina,
A. B. Tuzikov,
N. V. Bovin,
I. A. Rudneva,
B. V. Sinitsyn,
A. A. Shilov, and M. N. Matrosovich.
1998.
Effects of host-dependent glycosylation of hemagglutinin on receptor-binding properties of H1N1 human influenza A virus grown in MDCK cells and in embryonated eggs.
Virology
247:170-177[CrossRef][Medline].
|
| 9.
|
Gambaryan, A. S., and M. N. Matrosovich.
1992.
A solid-phase enzyme-linked assay for influenza virus receptor-binding activity.
J. Virol. Methods
39:111-123[CrossRef][Medline].
|
| 10.
|
Gubareva, L. V.,
R. Bethell,
K. Hart,
K. G. Murti,
R. Penn, and R. G. Webster.
1996.
Characterization of mutants of influenza A virus selected with the neuraminidase inhibitor 4-guanidino-Neu5Ac2en.
J. Virol.
70:1818-1827[Abstract].
|
| 11.
|
Kaverin, N. V.,
I. A. Rudneva,
Y. A. Smirnov, and N. N. Finskaya.
1988.
Human-avian influenza virus reassortants: effect of reassortment pattern on multi-cycle reproduction in MDCK cells.
Arch. Virol.
103:117-126[CrossRef][Medline].
|
| 12.
|
Kawaoka, Y.,
S. Yamnakova,
T. Chambers,
D. K. Lvov, and R. G. Webster.
1990.
Molecular characterization of a new hemagglutinin, subtype H14, of influenza A virus.
Virology
179:759-767[CrossRef][Medline].
|
| 13.
|
Kobasa, D.,
M. E. Rodgers,
K. Wells, and Y. Kawaoka.
1997.
Neuraminidase hemadsorption activity, conserved in avian influenza A viruses, does not influence viral replication in ducks.
J. Virol.
71:6706-6713[Abstract].
|
| 14.
|
Lamb, R. A., and R. M. Krug.
1996.
Orthomyxoviridae: the viruses and their replication, p. 1353-1395.
In
B. Fields, D. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed. Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 15.
|
Liu, C., and G. M. Air.
1993.
Selection and characterization of a neuraminidase-minus mutant of influenza virus and its rescue by cloned neuraminidase genes.
Virology
194:403-407[CrossRef][Medline].
|
| 16.
|
Liu, C.,
M. C. Eichelberger,
R. W. Compans, and G. M. Air.
1995.
Influenza type A virus neuraminidase does not play a role in viral entry, replication, assembly, or budding.
J. Virol.
69:1099-1106[Abstract].
|
| 17.
|
Matrosovich, M.,
P. Gao, and Y. Kawaoka.
1998.
Molecular mechanisms of serum resistance of human influenza H3N2 virus and their involvement in virus adaptation in a new host.
J. Virol.
72:6373-6380[Abstract/Free Full Text].
|
| 18.
|
McKimm-Breschkin, J. L.,
A. Sahasrabudhe,
T. J. Blick,
M. McDonlad,
P. M. Colman,
J. H. Grahm,
R. C. Bethell, and J. N. Varghese.
1998.
Mutations in a conserved residue in the influenza virus neuraminidase active site decreases sensitivity to Neu5Ac2en-derived inhibitors.
J. Virol.
72:2456-2462[Abstract/Free Full Text].
|
| 19.
|
Neumann, G.,
T. Watanabe,
H. Ito,
S. Watanabe,
H. Goto,
P. Gao,
M. Hughes,
D. Perez,
R. Donis,
E. Hoffmann,
G. Hobom, and Y. Kawaoka.
1999.
Generation of influenza A viruses entirely from cloned cDNAs.
Proc. Natl. Acad. Sci. USA
96:9345-9350[Abstract/Free Full Text].
|
| 20.
|
Nobusawa, E.,
T. Aoyama,
H. Kato,
Y. Suzuki,
Y. Tateno, and K. Nakajima.
1991.
Comparison of complete amino acid sequences and receptor-binding properties among 13 serotypes of hemagglutinins of influenza A viruses.
Virology
182:475-485[CrossRef][Medline].
|
| 21.
|
Palese, P.,
K. Tobita,
M. Ueda, and R. W. Compans.
1974.
Characterization of temperature-sensitive influenza virus mutants defective in neuraminidase.
Virology
61:397-410[CrossRef][Medline].
|
| 22.
|
Robertson, J. S.,
C. Nicolson,
D. Major,
E. W. Robertson, and J. M. Wood.
1993.
The role of amniotic passage in the egg-adaptation of human influenza virus is revealed by haemagglutinin sequence analyses.
J. Gen. Virol.
74:2047-2051[Abstract/Free Full Text].
|
| 23.
|
Rohm, C.,
N. Zhou,
J. Suss,
J. Mackenzie, and R. G. Webster.
1996.
Characterization of a novel influenza hemagglutinin, H15: criteria for determination of influenza A subtypes.
Virology
217:508-516[CrossRef][Medline].
|
| 24.
|
Ryan-Poirier, K. A., and Y. Kawaoka.
1991.
Distinct glycotein inhibitors of influenza A virus in different animal sera.
J. Virol.
65:389-395[Abstract/Free Full Text].
|
| 25.
|
Sauter, N. K.,
J. E. Hanson,
G. D. Glick,
J. H. Brown,
R. L. Crowther,
S. J. Park,
J. J. Skehel, and D. C. Wiley.
1992.
Binding of influenza virus hemagglutinin to analogs of its cell-surface receptor, sialic acid: analysis by proton nuclear magnetic resonance spectroscopy and X-ray crystallography.
Biochemistry
31:9609-9621[CrossRef][Medline].
|
| 26.
|
Shibata, S.,
F. Yamamoto-Goshima,
K. Maeno,
T. Hanaichi,
Y. Fujita,
K. Nakajima,
M. Imai,
T. Komatsu, and S. Sugiura.
1993.
Characterization of a temperature-sensitive influenza B virus mutant defective in neuraminidase.
J. Virol.
67:3264-3273[Abstract/Free Full Text].
|
| 27.
|
Staschke, K. A.,
J. M. Colacino,
A. J. Baxter,
G. M. Air,
A. Bansal,
W. J. Hornback,
J. E. Munroe, and W. G. Laver.
1995.
Molecular basis for the resistance of influenza viruses to 4-guanidino-Neu5Ac2en.
Virology
214:642-646[CrossRef][Medline].
|
| 28.
|
Suzuki, Y.,
H. Kato,
C. W. Naeve, and R. G. Webster.
1989.
Single-amino-acid substitution in an antigenic site of influenza virus hemagglutinin can alter the specificity of binding to cell membrane-associated gangliosides.
J. Virol.
63:4298-4302[Abstract/Free Full Text].
|
| 29.
|
Underwood, P. A.,
J. J. Skehel, and D. C. Wiley.
1987.
Receptor-binding characteristics of monoclonal antibody-selected antigenic variants of influenza virus.
J. Virol.
61:206-208[Abstract/Free Full Text].
|
| 30.
|
Ward, A. C.
1997.
Virulence of influenza A for the mouse lung.
Virus Genes
14:187-194[CrossRef][Medline].
|
| 31.
|
Warren, L.
1959.
The thiobarbituric acid assay of sialic acids.
J. Biol. Chem.
234:1971-1975[Free Full Text].
|
| 32.
|
Weis, W.,
J. H. Brown,
S. Cusack,
J. C. Paulson,
J. J. Skehel, and D. C. Wiley.
1988.
Structure of the influenza virus haemagglutinin complexed with its receptor, sialic acid.
Nature
333:426-431[CrossRef][Medline].
|
| 33.
|
Yang, P.,
A. Bansal,
C. G. Liu, and G. M. Air.
1997.
Hemagglutinin specificity and neuraminidase coding capacity of neuraminidase-deficient influenza viruses.
Virology
229:155-165[CrossRef][Medline].
|
Journal of Virology, June 2000, p. 5206-5212, Vol. 74, No. 11
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Jackson, S., Van Hoeven, N., Chen, L.-M., Maines, T. R., Cox, N. J., Katz, J. M., Donis, R. O.
(2009). Reassortment between Avian H5N1 and Human H3N2 Influenza Viruses in Ferrets: a Public Health Risk Assessment. J. Virol.
83: 8131-8140
[Abstract]
[Full Text]
-
Winter, C., Schwegmann-Wessels, C., Cavanagh, D., Neumann, U., Herrler, G.
(2006). Sialic acid is a receptor determinant for infection of cells by avian Infectious bronchitis virus.. J. Gen. Virol.
87: 1209-1216
[Abstract]
[Full Text]
-
Landolt, G. A., Karasin, A. I., Schutten, M. M., Olsen, C. W.
(2006). Restricted Infectivity of a Human-Lineage H3N2 Influenza A Virus in Pigs Is Hemagglutinin and Neuraminidase Gene Dependent. J. Clin. Microbiol.
44: 297-301
[Abstract]
[Full Text]
-
Lu, B., Zhou, H., Ye, D., Kemble, G., Jin, H.
(2005). Improvement of Influenza A/Fujian/411/02 (H3N2) Virus Growth in Embryonated Chicken Eggs by Balancing the Hemagglutinin and Neuraminidase Activities, Using Reverse Genetics. J. Virol.
79: 6763-6771
[Abstract]
[Full Text]
-
Shinya, K., Fujii, Y., Ito, H., Ito, T., Kawaoka, Y.
(2004). Characterization of a Neuraminidase-Deficient Influenza A Virus as a Potential Gene Delivery Vector and a Live Vaccine. J. Virol.
78: 3083-3088
[Abstract]
[Full Text]
-
Forsberg, R., Christiansen, F. B.
(2003). A Codon-Based Model of Host-Specific Selection in Parasites, with an Application to the Influenza A Virus. Mol Biol Evol
20: 1252-1259
[Abstract]
[Full Text]
-
Fujii, Y., Goto, H., Watanabe, T., Yoshida, T., Kawaoka, Y.
(2003). Selective incorporation of influenza virus RNA segments into virions. Proc. Natl. Acad. Sci. USA
100: 2002-2007
[Abstract]
[Full Text]
-
Gubareva, L. V., Nedyalkova, M. S., Novikov, D. V., Murti, K. G., Hoffmann, E., Hayden, F. G.
(2002). A release-competent influenza A virus mutant lacking the coding capacity for the neuraminidase active site. J. Gen. Virol.
83: 2683-2692
[Abstract]
[Full Text]
-
Kobasa, D., Wells, K., Kawaoka, Y.
(2001). Amino Acids Responsible for the Absolute Sialidase Activity of the Influenza A Virus Neuraminidase: Relationship to Growth in the Duck Intestine. J. Virol.
75: 11773-11780
[Abstract]
[Full Text]
-
Hughes, M. T., McGregor, M., Suzuki, T., Suzuki, Y., Kawaoka, Y.
(2001). Adaptation of Influenza A Viruses to Cells Expressing Low Levels of Sialic Acid Leads to Loss of Neuraminidase Activity. J. Virol.
75: 3766-3770
[Abstract]
[Full Text]
-
Krempl, C., Herrler, G.
(2001). Sialic Acid Binding Activity of Transmissible Gastroenteritis Coronavirus Affects Sedimentation Behavior of Virions and Solubilized Glycoproteins. J. Virol.
75: 844-849
[Abstract]
[Full Text]