Previous Article | Next Article ![]()
Journal of Virology, June 2000, p. 5091-5100, Vol. 74, No. 11
Department of Human Retrovirology, Academic
Medical Center, University of Amsterdam, 1105 AZ Amsterdam, The
Netherlands,1 and Aaron Diamond AIDS
Research Center, The Rockefeller University, New York, New York
100162
Received 20 December 1999/Accepted 17 February 2000
We have described an oligomeric gp140 envelope glycoprotein from
human immunodeficiency virus type 1 that is stabilized by an
intermolecular disulfide bond between gp120 and the gp41 ectodomain, termed SOS gp140 (J. M. Binley, R. W. Sanders, B. Clas, N. Schuelke, A. Master, Y. Guo, F. Kajumo, D. J. Anselma, P. J. Maddon, W. C. Olson, and J. P. Moore, J. Virol.
74:627-643, 2000). In this protein, the protease cleavage site between
gp120 and gp41 is fully utilized. Here we report the characterization
of gp140 variants that have deletions in the first, second, and/or
third variable loop (V1, V2, and V3 loops). The SOS disulfide bond
formed efficiently in gp140s containing a single loop deletion or a
combination deletion of the V1 and V2 loops. However, deletion of all
three variable loops prevented formation of the SOS disulfide bond.
Some variable-loop-deleted gp140s were not fully processed to their
gp120 and gp41 constituents even when the furin protease was
cotransfected. The exposure of the gp120-gp41 cleavage site is probably
affected in these proteins, even though the disabling change is in a
region of gp120 distal from the cleavage site. Antigenic
characterization of the variable-loop-deleted SOS gp140 proteins
revealed that deletion of the variable loops uncovers cryptic,
conserved neutralization epitopes near the coreceptor-binding site on
gp120. These modified, disulfide-stabilized glycoproteins might be
useful as immunogens.
An immunogen able to induce
effective humoral immune responses would be a valuable component of
combination vaccines against human immunodeficiency virus type 1 (HIV-1). Such vaccines include ones in which cellular immunity is
stimulated by live, recombinant viruses or DNA-based vectors (3,
19, 23, 30, 52). The monomeric HIV-1 gp120 glycoprotein does not
elicit broadly neutralizing antibody responses against representative
primary isolates (3, 14, 49). However, such proteins are
still being included in combination vaccines, for want of anything better.
The HIV-1 envelope glycoprotein complex contains two subunits, the
transmembrane glycoprotein gp41 and the surface glycoprotein gp120. The
latter contributes most of the exposed surface area to the complex and
contains the binding sites for the CD4 receptor and a coreceptor,
either CCR5 or CXCR4 or both (35, 53, 64, 71, 72). The
crystal structures of the core fragments of both gp41 and gp120 have
been described (11, 26, 28, 68, 72). During envelope
glycoprotein synthesis, a peptide bond that links the gp120 and gp41
components of the precursor polyprotein, gp160, is cleaved by proteases
in the Golgi complex (17, 24, 31, 58, 69, 70). The gp120 and
gp41 subunits are then noncovalently but weakly associated (22,
32, 38, 57). On the cell and virion surface, the envelope
glycoproteins are organized in trimers via noncovalent gp41-gp41
interactions (11, 28, 29, 68).
The trimeric envelope glycoprotein complex mediates HIV-1 attachment
and fusion. First, gp120 binds to the CD4 receptor, inducing conformational changes that expose the normally occult coreceptor binding site (64, 71). This involves the movement of the
first, second, and third variable loops (V1, V2, and V3 loops) away
from the coreceptor-binding site (59, 61, 73). Once gp120
interacts with the coreceptor, additional conformational changes expose fusion peptides at the N termini of the gp41 moieties, which then mediate fusion of the viral and cell membranes (11, 13, 25, 45,
68).
The envelope glycoproteins are important targets for the humoral immune
response in that neutralizing antibodies are known that interfere with
virus-cell attachment and fusion (41, 49, 50). To persist as
a chronic infection in the face of a vigorous humoral response, HIV-1
has evolved ways to limit the generation of neutralizing antibodies
and/or to minimize their effect on its life cycle. There is unusually
extensive shielding of the conserved regions of gp120 by nonimmunogenic
carbohydrates (48, 51); the CD4-binding site is recessed
(26, 72); escape mutants can be generated in a relatively
facile way, even to antibodies against the CD4-binding site (26,
72); variable loops hide the coreceptor-binding site until after the
CD4 interaction has occurred, thereby minimizing the time and space
available for antibodies to intervene against this stage of the fusion
process (26, 36, 53, 59, 72).
Another defense mechanism is that the trimeric envelope glycoprotein
spikes are poorly immunogenic compared to their dissociated subunits
(9, 40, 50). Most infection-induced antienvelope antibodies
are raised to uncleaved gp160 precursors, dissociated gp120, or gp41
ectodomains from which gp120 has been shed (39, 40, 50, 56),
as is also the case in respiratory syncytial virus infection
(55). Such "viral debris" does not antigenically mimic
the native trimeric complex, so although the immune response to viral
antigens is strong, that against infectious virus is weak. Viral debris
might not just create an irrelevant immune response All these factors impact upon the design of vaccines for inducing
humoral immunity: The natural mechanisms used by HIV-1 to limit the
immunogenicity of its envelope glycoproteins need to be understood and
overcome. One approach that we and others are pursuing is the
development of antigenic mimics of the native complex (5, 20,
74). We previously described such a protein (SOS gp140) in which
the weak association between gp120 and the gp41 ectodomain is
stabilized by the introduction of an intersubunit disulfide bond
(5). However, it may be necessary to modify this protein to
improve its immunogenicity. Several mutants of HIV-1 and simian
immunodeficiency virus (SIV) gp120s have been made with the intent of
immunogenicity enhancement; these include proteins that lack
glycosylation sites or one or more of the variable loops (6, 10,
30, 51). Variable-loop-deleted gp120s are properly folded
(4); indeed, one such protein from the HxBc2 strain was
successfully crystallized as a ternary complex with soluble CD4 (sCD4)
and the Fab fragment of the human monoclonal antibody (MAb) 17b
(26, 72).
Here, we describe versions of the SOS gp140 protein with deletions of
the V1, V2, and V3 loops. These modifications uncover conserved
neutralization epitopes around the coreceptor-binding site in the
context of a properly folded, fully processed, oligomeric envelope
glycoprotein complex.
Plasmids.
The envelope glycoproteins used in this study were
derived from HIV-1 JR-FL, a subtype B, CCR5-using primary isolate. The pPPI4 plasmid expressing soluble gp140 lacking the transmembrane and
intracytoplasmic domains of gp41 has been described elsewhere (5). Furin was expressed from the plasmid pcDNA3.1-furin
(5, 62).
Construction of mutant envelope glycoproteins.
Plasmids
encoding single-loop-deletion mutants were generated as follows;
restriction sites are underlined. To delete the V1 sequences, two
primers were designed that contain a unique NaeI site:
5JV1-N
(5'-GTCTGAGTCGCCGGCTCCCTTGCAATTTAAAGTAACACAGAG-3') and 3JV1-N
(5'-GTCTGAGTCGGAGCCGGCAACTGCTCTTTCAATATCACC-3').
PCR amplification with primer pair 5'Kpn1env
(5'-GTCTATTATGGGGTACCTGTGTGGAAAGAAGC-3', which contains a unique KpnI site) and 5JV1-N and with
primer pair 3JV1-N and 3'BstB1env
(5'-GTCTGAGTCTTCGAATTAATAACCACAGCCATTTTG-3', which contains a unique BstBI site) produced two
fragments without the V1 sequences that contained the NaeI
site. Cloning of these fragments into pPPI4 using the KpnI,
NaeI, and BstBI sites produced the plasmid
lacking the V1 sequences. Plasmids lacking the V2 or V3 sequence were
constructed in an analogous manner. The primer pairs used to create
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Variable-Loop-Deleted Variants of the Human Immunodeficiency
Virus Type 1 Envelope Glycoprotein Can Be Stabilized by an
Intermolecular Disulfide Bond between the gp120 and gp41
Subunits
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
it may even
actively decoy antibody production away from the functionally important
forms of the envelope glycoproteins (40, 50, 55).
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
V2-env were 5'Kpn1env and 5JV2-B
(5'-GTCTGAGTCGGATCCGGCACCAGAGCAGTTTTTTATTTCTCC-3'') and 3'BstB1env and 3JV2-B
(5'-GTCTGAGTCGGATCCTGTGACACCTCAGTCATTACACAG-3'). Primers 5JV2-B and 3JV2-B both contain a unique BamHI
site. The fragments were cloned into pPPI4 using the KpnI,
BamHI, and BstBI sites. The primers used to
create the
V3 env gene were 5'Kpn1env and 5JV3-N
(5' - GTCTGAGTCGGAGCCGGCGATATAAGACAAGCACATTGTAAC - 3')
and 3'BstB1env and 3JV3-N
(5'-GTCTGAGTCGCCGGCTCCATTGTTGTTGGGTCTTGTACAATTAATTTC-3'). Primers 5JV3-N and 3JV3-N both contain a unique NaeI
site. The fragments were cloned into pPPI4 using the KpnI,
NaeI, and BstBI sites. In the encoded
glycoproteins, amino acids 133 to 155 (
V1), 159 to 194 (
V2), or
303 to 324 (
V3) were replaced by a glycine-alanine-glycine linker
(GAG) (Fig. 1). The numbering of amino
acids was based on the HxBc2 sequence, with the initiator methionine
designated residue 1.

View larger version (34K):
[in a new window]
FIG. 1.
Schematic representation of the V1, V2, and V3 regions
of JR-FL gp120 and the deletions made in the various mutants. The
structures and residue numbering scheme are based on the representation
of JR-FL gp120 in reference 5, which is in turn
based on the gp120 secondary structure described by Leonard et al.
(27).
V1V2' (Fig. 1). A gp140 protein without the V1, V2, and V3
loops was created in a similar way but using a DNA fragment generated
by PCR on a
V3 template with primers 3JV2-B and J140-BB. This was
cloned into the
V1V2' plasmid by using BamHI and
BstBI. The resulting env sequences were named
V1V2'V3. Another, more extensively deleted form of
V1V2, termed
V1V2*, was also constructed (Fig. 1). Here, PCR amplification was
performed with primers 3'
V1V2STU1
(5'-GGCTCAAAGGATATCT TTGGACAGGCCTG TGTAATGACTGAGG TGTCACATCCTGCACCACAGAG TGGGG TTAATTTTACACATGGC-3', containing an StuI site) and 5'Kpn1env. The resulting
fragment was digested with StuI and KpnI and
cloned into a pPPI4 gp140 vector using the internal StuI
site. The resulting
V1V2* gp140 protein had amino acids 127 to 195 replaced by the GAG linker (Fig. 1). The
V1V2*V3 protein was
constructed in an analogous manner to
V1V2'V3. Amino acid
substitutions were made with the Quickchange site-directed mutagenesis
kit (Stratagene Inc.) using appropriate primers. The fidelity of all
mutations was confirmed by sequencing. The absence of variable-loop
epitopes from the loop-deleted proteins was confirmed by enzyme-linked
immunosorbent assay (ELISA) with appropriate antibodies (4, 37,
39, 41, 42).
Transfection, labeling, and immunoprecipitation. Adherent 293T cells were grown in Dulbecco's modified Eagle's medium (DMEM; Gibco) supplemented with 10% fetal calf serum, penicillin, streptomycin, and L-glutamine. Transient transfection of 293T cells was performed by calcium phosphate precipitation. The plasmids based on pPPI4 gp140 were transfected with and without the furin expression vector pcDNA3.1-furin, each at 10 µg per 10-cm2 plate. One day post-transfection, the medium was changed to DMEM supplemented with 0.2% bovine serum albumin, penicillin, streptomycin, and L-glutamine. For radioimmunoprecipitation analysis (RIPA), [35S]cysteine and [35S]methionine (200 µCi per plate; Amersham International PLC) were added for 24 h in DMEM lacking cysteine and methionine as described previously (5). The culture supernatants were cleared of debris by low-speed centrifugation before addition of concentrated RIPA buffer to adjust the composition to 50 mM Tris-HCl, 150 mM NaCl, and 1 mM EDTA (pH 7.2). Envelope glycoproteins were immunoprecipitated with biotin-labeled or unlabeled MAbs in a 1-ml volume for 10 min at room temperature, followed by incubation overnight at 4°C with either streptavidin-coated agarose beads (Vector Labs) or protein G-coated agarose beads (Pierce Inc.), as appropriate. The beads were washed three times with RIPA buffer containing 1% NP-40 detergent. Proteins were eluted by heating the beads at 100°C for 5 min in 60 µl of polyacrylamide gel electrophoresis (PAGE) buffer supplemented with 2% sodium dodecyl sulfate (SDS) and, when indicated, 100 mM dithiothreitol (DTT). The immunoprecipitates were fractionated by electrophoresis on SDS-8% PAGE gels at 200 V for 1 h. The gels were dried and exposed to a phosphor screen, and the positions of the radiolabeled proteins were determined using a PhosphorImager with ImageQuant software (Molecular Dynamics Inc.).
MAbs to HIV-1 envelope glycoprotein epitopes and sCD4. The epitopes and immunochemical properties of all the anti-gp120 and anti-gp41 MAbs used in this study have been described previously, as have their donors (5). Additional information on these MAbs has also been published (4, 7, 8, 18, 37, 39, 41-43, 46, 47, 53, 61, 65, 66, 72, 73). The tetrameric CD4-immunoglobulin G2 (CD4-IgG2) and monomeric sCD4 molecules, from Progenics Pharmaceuticals Inc., have also been described elsewhere (2).
Quantitation and characterization of gp120 and gp140 proteins by ELISA. To measure the secretion of gp120 and gp140 proteins from transfected 293T cells, we used a gp120 antigen capture ELISA based on a previously described assay (4, 37, 39). Briefly, envelope glycoproteins in the culture supernatants were denatured and reduced by boiling with 1% SDS and 50 mM DTT. Purified, monomeric JR-FL gp120 treated in the same way was used as a reference standard for gp120 expression (5, 64). The denatured proteins were captured onto plastic via sheep antibody D7324, which was raised against the continuous sequence APTKAKRRVVQREKR at the C terminus of gp120. Bound envelope glycoproteins were detected using a mixture of MAbs B12 and B13 against continuous epitopes exposed on denatured gp120 (1, 39). This assay allows the efficient detection of both gp120 and any gp140 molecules in which the peptide bond between gp120 and the gp140 ectodomain is still intact (5, 64). Nondenatured envelope glycoproteins were detected using the QC256 pool of sera from HIV-1-infected individuals (37, 38).
| |
RESULTS |
|---|
|
|
|---|
Generation of variable-loop-deleted versions of the wild-type and
SOS gp140 proteins.
Throughout the text, we refer to proteins that
contain gp120 and the gp41 ectodomain (gp41ECTO) as
wild-type (WT) gp140 proteins. The variants with cysteine substitutions
that form an intermolecular disulfide bond between residues 501 of
gp120 and 605 of gp41 are designated SOS gp140 proteins. Versions of
these proteins without additional mutations are sometimes referred to
as full-length to distinguish them from proteins from which one or more
variable loops have been deleted; the latter are described as
V1,
V1 SOS, etc. For convenience, we refer to the variable-loop-deleted mutants as gp120s or gp140s irrespective of their actual size, the
gp140s possessing the gp41 ectodomain in each case.
V1 (amino acids
133 to 155 replaced by the GAG tripeptide),
V2 (amino acids 159 to
194 replaced by GAG),
V3 (amino acids 303 to 324 replaced by GAG),
V1V2' (amino acids 133 to 155 and 159 to 194 replaced by GAG), and
V1V2* (amino acids 127 to 195 replaced by GAG). Two proteins with
multiple loop deletions were also made,
V1V2'V3 and
V1V2*V3.
Unlike the
V1V2* and
V1V2*V3 proteins, the
V1V2' and
V1V2'V3 proteins still contained natural sequences between the V1
and V2 loops, including the glycosylation site at position 156 and the
cysteines at positions 131 and 157 that form an intramolecular
disulfide bond (Fig. 1). The designs of these various mutants were
based on the results from previous studies with loop-deleted versions
of gp120 monomers (4, 72, 73). To create
disulfide-stabilized versions of the variable-loop-deleted gp140
proteins (loop-deleted SOS gp140 proteins), we substituted residues
alanine-501 of gp120 and threonine-605 of gp41 with cysteines, as
previously described for the full-length gp140 protein (5).
To investigate whether variable-loop-deleted gp140 proteins were
properly folded and cleaved and whether they formed the SOS disulfide
bond, they were expressed in the presence and absence of cotransfected
furin and then immunoprecipitated with MAb 2G12. This recognizes a
neutralizing, glycan-dependent epitope in the C3 and V4 regions of
gp120 (similar results were obtained using anti-gp41 MAb 2F5; data not
shown). The precipitated proteins were incubated with or without DTT
prior to SDS-PAGE analysis to determine whether there was an uncleaved
peptide bond or a reducible disulfide bond between gp120 and
gp41ECTO (Fig. 2). The full-length gp140 proteins were
also analyzed for comparison (Fig. 2A). Because of variations in the
expression of the different gp140 variants and in their
immunoprecipitation efficiencies, the intensities of different bands in
Fig. 2 cannot be precisely compared. However, the various envelope
proteins appeared to be secreted with different efficiencies. For
example,
V1 SOS gp140 (Fig. 2B, lane 5) and
V2 gp140 (Fig. 2C,
lane 1) were expressed relatively poorly, whereas
V3 SOS gp140 was
expressed with significantly greater efficiency than the others (Fig.
2D, lane 5). Measurements of protein expression by ELISA were
consistent with the RIPA analyses (data not shown).
|
V2 and
V1V2' gp140
proteins were efficiently cleaved, in that no gp140 band was now
visible (Fig. 2C and E, lanes 3 and 4), whereas some residual uncleaved
gp140 was produced from the
V1 and
V1V2* gp140 constructs, even
in the presence of furin (Fig. 2B and F, lanes 3 and 4).
An intermolecular disulfide bond forms successfully in the SOS versions
of the
V1,
V2,
V3,
V1V2', and
V1V2* proteins (Fig. 2B to
F, lanes 5 and 6). These are generally processed efficiently in the
presence of furin, although some uncleaved gp140 protein is still
present with
V1V2* SOS gp140 (Fig. 2F, lane 6). This apparently
DTT-resistant gp140 is probably derived from high-molecular-weight aggregates that are disrupted by boiling with DTT (5). Such aggregates are produced from transient transfections with gp140- or SOS
gp140-expressing plasmids but not from CHO cells stably expressing the
SOS gp140 protein and furin (5) (data not shown).
Although the majority of the variable-loop deletants behaved like their
full-length counterparts, some did not. The most notable differences
were the absence of a gp140 band derived from the
V1V2*V3 SOS gp140
construct (Fig. 2H, lane 5) and the absence of gp120 bands derived from
the
V3 gp140 and
V1V2'V3 SOS gp140 constructs even in the
presence of furin and/or DTT (Fig. 2D, lanes 1 to 4, and Fig. 2G, lanes
5 and 6).
SOS bond does not form in
V1V2*V3 gp140.
No gp140 band was
expressed from the
V1V2*V3 SOS gp140 construct (Fig. 2H, lane 5).
However, when
V1V2*V3 SOS gp140 was treated with DTT, a faint
DTT-insensitive gp140 band was visible (Fig. 2H, lane 6), derived from
the DTT disruption of uncleaved gp140 aggregates. That the
V1V2*V3
SOS gp140 construct does not yield a gp140 protein while producing a
gp120 could have one of two explanations. Either the 2G12 MAb does not
bind the gp140 form of this protein because of structural perturbations
introduced by the triple loop deletion that limit 2G12 epitope
exposure, or the disulfide bond between cysteine residues 501 of gp120
and 605 of gp41 does not form in the context of this
triple-loop-deleted protein.
V1V2*V3 SOS gp140 transfection. In
contrast, every MAb, including 2G12, was able to precipitate an
uncleaved
V1V2*V3 WT gp140 protein (data not shown). Hence, the
deletion of all three variable loops does not cause a major structural
perturbation to the gp120 core and its conserved epitopes.
The most likely explanation of the failure of multiple MAbs to detect
the
V1V2*V3 SOS gp140 protein is that the protein is simply not
secreted. Hence, when the V1, V2, and V3 loops are all deleted, the
intermolecular disulfide bond cannot form between gp120 and gp41, so
that no stable gp140 is produced. This is not the case when only the V1
and V2 loops are deleted or when only the V3 loop is removed (Fig. 2D
to F, lane 5). Presumably, the triple-loop-deleted gp140 protein folds
in such a way that the cysteine residues at positions 501 and 605 are
not close enough to form a disulfide bond. On this assumption, we tried
moving the gp120 cysteine from residue 501 to residue 500 or 502, but this did not restore the formation of the intermolecular disulfide bond
(data not shown).
Some gp140 mutants are incompletely processed to gp120 and
gp41ECTO.
The most likely explanation for the absence
of gp120 bands from the
V3 gp140 (Fig. 2D, lanes 1 to 4) and
V1V2'V3 SOS gp140 preparations (Fig. 2G, lanes 5 and 6), even in the
presence of furin, is due to inefficient cleavage of gp140 into gp120
and gp41ECTO subunits. In contrast to the extremely limited
cleavage of the WT
V3 gp140 protein (Fig. 2D, lanes 1 to 4), the
V3 SOS gp140 protein was fully cleaved (Fig. 2D, lanes 5 and 6). It
appears, then, that the deletion of the V3 loop modifies the
conformation of the WT gp140 protein in such a way that its cleavage
into gp120 and gp41ECTO subunits becomes inefficient.
However, the introduction of the intermolecular disulfide bond into the
SOS version of the
V3 gp140 protein restores the protein's
conformation and permits cleavage to occur.
V3 gp140, the WT
V1V2'V3 gp140 protein was
cleaved efficiently to gp120 in the presence of furin (Fig. 2G, lanes 3 and 4). Moreover, while the cleavage deficiency of the WT
V3 gp140
was rescued by introduction of an SOS bond, the
V1V2'V3 SOS gp140
expressed uncleaved gp140 (Fig. 2G, lanes 5 and 6). The diffuseness of
the band and its low mobility compared with its WT gp140 counterpart
(this is more easily discernable on gels that were run further; data
not shown) suggests that the
V1V2'V3 SOS gp140 is a misfolded
protein (5, 16) (Fig. 2G, compare lanes 5 and 1). Hence, the
cysteine residues at positions 501 and 605 must inhibit the processing
of the triple-loop-deleted SOS gp140 protein.
The processing efficiencies of the various loop-deleted WT and SOS
gp140 proteins are summarized in Table 1.
|
Exposure of gp120 C5 and gp41 epitopes on loop-deleted SOS gp140 proteins. We have shown that full-length uncleaved gp140 proteins differ in their antigenic structure from the SOS gp140 protein (5). Nonneutralizing epitopes in the C1 and C5 domains of gp120 and all gp41 epitopes except the neutralizing 2F5 epitope are obscured in the SOS gp140 protein, whereas they are exposed on the uncleaved gp140 proteins. In this respect, the SOS gp140 protein has antigenic properties similar to those of the native, virion-associated envelope glycoprotein complex, in which the C1 and C5 domains and much of the gp41 surface are involved in intersubunit interactions (5, 39, 56).
To study the antigenic structures of loop-deleted SOS gp140 proteins, we first performed immunoprecipitations with MAb 23A, directed to the gp120 C5 domain, and to several regions of gp41 (MAb 7B2 to cluster I, MAb 25C2 to the cluster II/fusion domain, and MAb 2F5 to neutralization epitope ELDKWAS). The SOS gp140 forms of the full-length,
V3, and
V1V2* proteins (Fig. 3, even-numbered lanes) were compared with the WT versions of the same proteins, which
produce gp120 and uncleaved gp140 (Fig. 3, odd-numbered lanes).
|
V1V2* SOS, and
V3 SOS gp140 proteins, but it
bound to the uncleaved gp140 version of each of these proteins. The
recognition by MAb 23A of the gp120 bands derived from the SOS gp140
transfections indicates that its epitope was not destroyed by the
nearby cysteine substitution in the C5 domain (Fig. 3, compare lane 2 with lane 1). The nonneutralizing anti-gp41 MAbs 25C2 and 7B2 also did
not bind to the full-length SOS,
V1V2* SOS, and
V3 SOS gp140
proteins, but they reacted efficiently with the corresponding uncleaved
WT gp140 proteins (Fig. 3, compare lanes 4 and 6 with lanes 3 and 5).
Similar results were obtained with several other nonneutralizing MAbs
to various gp41 epitopes, such as 4D4, T15G1, and 2.2B (data not shown).
In contrast to what was found with the nonneutralizing MAbs, the
neutralizing MAb 2F5 bound much more efficiently to the full-length and
V3 SOS gp140 proteins than to the uncleaved WT gp140 proteins (Fig.
3, compare lane 8 with lane 7). Taking into account the slightly
reduced expression of the
V1V2* SOS gp140 protein compared with the
WT
V1V2* gp140 protein (Fig. 3C, lanes 1 and 2), 2F5 reactivity was
also greater with the SOS gp140 version (Fig. 3C, lanes 7 and 8). A
similar pattern of data on 2F5 reactivity was obtained with other
variable-loop-deleted gp140 and SOS gp140 proteins (data not shown).
Taken together, these experiments confirm that the
V1V2* SOS and
V3 SOS gp140 proteins are processed properly and that they retain
the fundamental antigenic properties of the full-length SOS gp140 protein.
Exposure of CD4-binding site and CD4-induced epitopes on
loop-deleted SOS gp140 proteins.
To assess whether the
receptor-binding sites were preserved on the
V2 SOS,
V3 SOS, and
V1V2* SOS gp140 proteins, we first performed immunoprecipitations
with the tetrameric CD4-IgG2 molecule (Fig.
4A). Like the full-length SOS gp140
protein, the variable-loop-deleted SOS gp140 proteins could be
efficiently precipitated with CD4-IgG2, confirming that the CD4-binding
site was retained on these proteins (Fig. 4A). Similar results were
obtained using MAbs IgG1b12 and F91 to epitopes which overlapped the
CD4BS (data not shown). There was, however, reduced reactivity of
IgG1b12 with SOS gp140 proteins lacking the V2 loop, consistent with
the known influence of the V2 loop structure on the epitope for this
MAb (8, 34, 54, 73).
|
V2,
V3, and
V1V2* SOS gp140 proteins were
immunoprecipitated with MAb 17b in the presence and absence of sCD4
(Fig. 4B). Similar results were obtained with MAb 48d and also with MAb
A32 to a separate CD4i epitope (data not shown). Without sCD4, the 17b
epitope was almost completely obscured on the full-length SOS gp140
protein, but it was strongly induced by sCD4 binding (Fig. 4B, compare
lanes 1 and 5). In the absence of sCD4, the 17b epitope was partially
exposed on the
V2 SOS and
V3 SOS gp140 proteins and well exposed
on the
V1V2* SOS gp140 protein (Fig. 4B, compare lanes 2 to 4 with
lanes 6 to 8). The binding of sCD4 strongly induced the 17b epitope on
the
V3 SOS gp140 (Fig. 4B, lanes 3 and 7) but had little or no
effect on the binding of 17b to the
V2 SOS and the
V1V2* SOS
gp140 proteins (Fig. 4B, compare lanes 2 and 4 with lanes 6 and 8).
These results confirm that the CD4i epitopes are present on the
variable-loop-deleted SOS gp140 proteins. They are also consistent with
the known involvement of the V1-V2 loop structure in shielding the CD4i
epitopes (4, 73); the CD4i epitopes can be exposed either by
removal of the variable loops or by sCD4 binding. Although both
mechanisms can operate, once the CD4i epitopes are well exposed (as on
the
V1V2* SOS gp140 protein), they can be further uncovered to only
a limited extent by sCD4 binding.
The effect of sCD4 on 17b binding was much greater on the full-length
and
V3 SOS gp140 proteins than on the corresponding gp120 monomers
(compare the effect of sCD4 on the upper and lower bands in Fig. 4B,
lanes 1, 3, 5, and 7). This presumably reflects the additional
involvement of intersubunit interactions as part of the mechanisms that
shield the CD4i epitopes on oligomeric envelope glycoproteins
(5).
| |
DISCUSSION |
|---|
|
|
|---|
We aim to create envelope glycoproteins that are more immunogenic than presently available gp120 monomers or oligomers in which a peptide bond links gp120 with the gp41 ectodomain either by design or because of inefficient processing of the cleavage site. We have described oligomeric gp140 proteins stabilized by an intermolecular disulfide bond between gp120 and gp41ECTO (SOS gp140 proteins). These proteins mimic the antigenic structure of the native, fusion-competent glycoprotein complex found on the surfaces of virions or infected cells (5). The immunogenicity of the SOS gp140 proteins has yet to be evaluated, but we have anticipated the possibility that it might be necessary to alter their structure to improve the presentation of conserved neutralization epitopes.
Here, we describe SOS gp140 proteins from which one or more of the gp120 variable loops have been deleted to better expose underlying, conserved regions around the CD4- and coreceptor-binding sites. Two parameters that required characterization were whether an intermolecular disulfide bond could form between gp120 and gp41ECTO after deletion of variable loops and whether loop-deleted proteins could be properly processed at the gp120-gp41ECTO proteolytic cleavage site.
It was not possible to remove all three of the V1, V2, and V3 loop
structures without adversely affecting the formation of the
intermolecular disulfide bond and/or the proper proteolytic processing
and folding of SOS gp140 proteins. However, each of the individual
loops could be safely deleted, as could the V1 and V2 loops in
combination. When the disulfide bond did form, the cleavage site was
always efficiently utilized in the presence of cotransfected furin.
Thus, we could successfully make the
V1,
V2,
V3,
V1V2', and
V1V2* SOS gp140 proteins.
In the context of the WT gp140 protein, deletion of the V3 loop
prevented cleavage of gp120 from gp41ECTO so that only
uncleaved gp140 proteins were secreted, even when furin was
cotransfected. An unexpected observation was that the formation of the
intermolecular disulfide bond in the
V3 SOS gp140 protein completely
reversed the cleavage deficiency. The removal of the V3 loop from gp120 appears to prevent the
V3 gp140 protein from folding correctly, so
that the proteolytic cleavage site becomes inaccessible. The formation
of the intermolecular disulfide bond presumably rescues the folding
defect at an early stage of the synthesis of the
V3 SOS gp140
protein, so that the cleavage site becomes properly exposed (Table 1).
Introduction of the same intermolecular disulfide bond into the
V1V2'V3 gp140 protein had the opposite effect, however, in that this
protein was efficiently cleaved but the
V1V2'V3 SOS gp140 protein
was not. Conversely, the
V1V2*V3 SOS protein, which lacks the
intramolecular disulfide bond at the base of the V1-V2 loop structure,
was fully cleaved. However, in this protein, the intermolecular
disulfide bond between gp120 and gp41ECTO did not form
(Table 1). Neither triple-loop-deleted SOS gp140 construct gave rise to
a disulfide-stabilized SOS gp140 protein.
Other than the presence or absence of the REKR cleavage site for furin proteases at the gp120 C terminus (24, 31, 44, 58, 69), several factors influence gp160 proteolysis. The cysteine residues at the base of the V3 loop are important for proper gp160 processing, at least in the context of envelope glycoproteins from the T-cell-line-adapted isolate LAI (12, 21, 63, 67). Substitutions within and around the small intramolecular disulfide-bonded loop in the gp41 ectodomain also impair the efficiency of gp160 cleavage (15, 60), especially in primary-isolate envelope glycoproteins (33). This loop is proximal to the gp41 cysteine substitution in the SOS gp140 proteins and is implicated in gp120 binding (5).
Many other cysteine residues in gp120 are also indispensable for proper
processing and folding of the envelope glycoproteins (67).
We therefore made two different
V1V2 proteins, one of which
(
V1V2*) lacked the cysteines at positions 131 and 157 near the base
of the V1-V2 loop structure. This protein was processed efficiently,
indicating that these two cysteines are dispensable for the folding and
cleavage of gp140. Deleting these cysteines is a known not to affect
the folding of monomeric gp120 (72, 73). A Leu-to-Asp
substitution at residue 266 in the third constant region of gp120 also
dramatically impaired gp160 cleavage (70).
Overall, the efficiency of gp160 or gp140 cleavage can be sensitive to changes in multiple regions of the envelope glycoproteins in an unpredictable fashion. It may be that amino acid substitutions, even at distal locations, influence the folding of the envelope glycoprotein complex in a way that affects the exposure of the cleavage site and hence the extent to which it is processed by proteases. The WT gp140 proteins from a variety of HIV-1 and SIV isolates differ significantly in their cleavage efficiency (5) (data not shown). This again indicates the sensitivity of the conserved cleavage site to differences in protein conformation during envelope glycoprotein synthesis. A similar hypothesis could explain the lack of SOS bond formation in the triple-loop deletants.
Notwithstanding what remains to be learned about envelope glycoprotein
processing pathways, we were able to make the
V1,
V2,
V3,
V1V2', and
V1V2* SOS gp140 proteins. Among these, we have
characterized the antigenic structure of the
V3 SOS gp140 and the
V1V2* SOS gp140 proteins in the most detail. These
variable-loop-deleted SOS gp140 proteins retain the desirable features
of their full-length counterpart. Thus, the C5 region of gp120 and all
the gp41 epitopes (except the 2F5 neutralization epitope) are not
exposed on any of the SOS gp140 proteins. In contrast, gp120 epitopes
relevant to virus neutralization are well exposed on the
variable-loop-deleted SOS gp140 proteins; indeed, on the
V1V2* SOS
gp140 protein, the CD4i epitope for MAb 17b is constitutively exposed
without sCD4 addition. The CD4i epitopes are moderately accessible on
the
V3 SOS gp140 protein but are still inducible by sCD4. On the
full-length SOS gp140 protein, MAb reactivity with the CD4i epitopes is
almost entirely dependent upon the presence of sCD4. Of note is that the occlusion of the CD4i epitopes is greater on the full-length, oligomeric SOS gp140 protein than in the corresponding gp120 monomer. This suggests that oligomerization increases the extent to which the
CD4i epitopes, and presumably the proximal coreceptor-binding site, are
shielded prior to CD4 binding.
Further modifications can be made to the SOS gp140 proteins, including
reductions in their carbohydrate content. Deletion of the V1-V2 loop
region removes almost one-third of the gp120 N-linked glycans, but we
have found that other glycosylation sites in the C3 and V4 regions can
be eliminated from the
V1V2* SOS gp140 protein without affecting its
overall conformation. Removing variable loops and glycans from SOS
gp140 proteins might also be useful for structural studies, based on
how the gp120 core was crystallized (26, 72).
In summary, we have now made disulfide-stabilized SOS gp140 proteins with deletions of the V3 or the V1 and V2 loops. These proteins are properly processed and have favorable antigenic properties. The deletion of the variable loops increases the accessibility of the underlying, conserved neutralization epitopes on the gp120 moieties. However, the entire approach of deleting the variable loops depends upon the assumption that any antibodies that are induced to previously cryptic epitopes will be capable of binding back to the same structures on native virions and thereby neutralizing HIV-1 infectivity. The virions that must be countered by a vaccine contain the unmodified envelope glycoproteins on which the conserved epitopes remain shielded. Of note is that the 17b and 48d MAbs to the conserved, CD4i epitopes have little or no ability to neutralize primary isolates (59, 64, 71, 73). The deletion of the V1, V2, and V3 loops from gp120, uncleaved gp140, and gp160 forms of the envelope glycoproteins from the T-cell-line-adapted strain HXB2 either decreased the ability of the proteins to induce autologous neutralizing antibodies or had little effect (30). Whether modifications to the antigenic structure of SOS gp140 glycoproteins by variable-loop deletion translate into improvements in their immunogenicity remains to be determined.
| |
ACKNOWLEDGMENTS |
|---|
We thank Gary Thomas for provision of the pGEMfurin plasmid and James Robinson and Herman Katinger for the gifts of several monoclonal antibodies. We appreciate the use of expression vectors and other reagents from Paul Maddon, Norbert Schuelke, and William Olson at Progenics Pharmaceuticals, as well as their advice and support.
This work was supported by RO1 grants AI 39420 and AI 45463.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Cornell University Weill Medical College, 1300 York Ave., Box 62, New York, NY 10021. Phone: (212) 746-4490. Fax: (212) 748-8587. E-mail for J. P. Moore: jmoore{at}adarc.org. E-mail for J. M. Binley: jbinley{at}adarc.org.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Abacioglu, Y. H., T. R. Fouts, J. D. Laman, E. Claassen, S. H. Pincus, J. P. Moore, C. A. Roby, R. Kamin-Lewis, and G. K. Lewis. 1994. Epitope mapping and topology of baculovirus-expressed HIV-1 gp160 determined with a panel of murine monoclonal antibodies. AIDS Res. Hum. Retroviruses 10:371-381[Medline]. |
| 2. | Allaway, G. P., K. L. Davis-Bruno, G. A. Beaudry, E. B. Garcia, E. L. Wong, A. M. Ryder, K. W. Hasel, M. C. Gauduin, R. A. Koup, J. S. McDougal, and P. J. Maddon. 1995. Expression and characterization of CD4-IgG2, a novel heterotetramer that neutralizes primary HIV type 1 isolates. AIDS Res. Hum. Retroviruses 11:533-539[Medline]. |
| 3. | Barnett, S. W., S. Rajasekar, H. Legg, B. Doe, D. H. Fuller, J. R. Haynes, C. M. Walker, and K. S. Steimer. 1997. Vaccination with HIV-1 gp120 DNA induces immune responses that are boosted by a recombinant gp120 protein subunit. Vaccine 15:869-873[CrossRef][Medline]. |
| 4. | Binley, J. M., R. Wyatt, E. Desjardins, P. D. Kwong, W. Hendrickson, J. P. Moore, and J. Sodroski. 1998. Analysis of the interaction of antibodies with a conserved enzymatically deglycosylated core of the HIV type 1 envelope glycoprotein 120. AIDS Res. Hum. Retroviruses 14:191-198[Medline]. |
| 5. |
Binley, J. M.,
R. W. Sanders,
B. Clas,
N. Schuelke,
A. Master,
Y. Guo,
F. Kajumo,
D. J. Anselma,
P. J. Maddon,
W. C. Olson, and J. P. Moore.
2000.
A recombinant human immunodeficiency virus type 1 envelope glycoprotein complex stabilized by an intermolecular disulfide bond between the gp120 and gp41 subunits is an antigenic mimic of the trimeric virion-associated structure.
J. Virol.
74:627-643 |
| 6. | Bolmstedt, A., S. Sjolander, J. E. Hansen, L. Akerblom, A. Hemming, S. L. Hu, B. Morein, and S. Olofsson. 1996. Influence of N-linked glycans in V4-V5 region of human immunodeficiency virus type 1 glycoprotein gp160 on induction of a virus-neutralizing humoral response. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 12:213-220[Medline]. |
| 7. | Buchacher, A., R. Predl, K. Strutzenberger, W. Steinfellner, A. Trkola, M. Purtscher, G. Gruber, C. Tauer, F. Steindl, A. Jungbauer, and H. Katinger. 1994. Generation of human monoclonal antibodies against HIV-1 proteins: electrofusion and Epstein-Barr virus transformation for peripheral blood lymphocyte immortalization. AIDS Res. Hum. Retroviruses 10:359-369[Medline]. |
| 8. |
Burton, D. R.,
J. Pyati,
R. Koduri,
S. J. Sharp,
G. B. Thornton,
P. W. Parren,
L. S. Sawyer,
R. M. Hendry,
N. Dunlop,
P. L. Nara,
M. Lamacchia,
E. Garratty,
E. R. Stiehm,
Y. J. Bryson,
J. P. Moore,
D. D. Ho, and C. F. Barbas, III.
1994.
Efficient neutralization of primary isolates of HIV-1 by a recombinant human monoclonal antibody.
Science
266:1024-1027 |
| 9. |
Burton, D. R.
1997.
A vaccine for HIV type 1: the antibody perspective.
Proc. Natl. Acad. Sci. USA
94:10018-10023 |
| 10. | Cao, J., N. Sullivan, E. Desjardin, C. Parolin, J. Robinson, R. Wyatt, and J. Sodroski. 1997. Replication and neutralization of human immunodeficiency virus type 1 lacking the V1 and V2 variable loops of the gp120 envelope glycoprotein. J. Virol. 71:9808-9812[Abstract]. |
| 11. | Chan, D. C., D. Fass, J. M. Berger, and P. S. Kim. 1997. Core structure of gp41 from the HIV envelope glycoprotein. Cell 89:263-273[CrossRef][Medline]. |
| 12. | Chiou, S. H., E. O. Freed, A. T. Panganiban, and W. R. Kenealy. 1992. Studies on the role of the V3 loop in human immunodeficiency virus type 1 envelope glycoprotein function. AIDS Res. Hum. Retroviruses 8:1611-1618[Medline]. |
| 13. |
Cladera, J.,
I. Martin,
J. M. Ruysschaert, and P. O'Shea.
1999.
Characterization of the sequence of interactions of the fusion domain of the simian immunodeficiency virus with membranes. Role of the membrane dipole potential.
J. Biol. Chem.
274:29951-29959 |
| 14. |
Connor, R. I.,
B. T. M. Korber,
B. S. Graham,
B. H. Hahn,
D. D. Ho,
B. D. Walker,
A. U. Neumann,
S. H. Vermund,
J. Mestecky,
S. Jackson,
E. Fenamore,
Y. Cao,
F. Gao,
S. Kalams,
K. Kuntsman,
D. McDonald,
N. McWilliams,
A. Trkola,
J. P. Moore, and S. M. Wolinsky.
1998.
Immunological and virological analyses of persons infected by human immunodeficiency virus type 1, while participating in trials of recombinant gp120 subunit vaccines.
J. Virol.
72:1552-1576 |
| 15. |
Dedera, D.,
R. L. Gu, and L. Ratner.
1992.
Conserved cysteine residues in the human immunodeficiency virus type 1 transmembrane envelope protein are essential for precursor envelope cleavage.
J. Virol.
66:1207-1209 |
| 16. | Doms, R. W., R. A. Lamb, J. K. Rose, and A. Helenius. 1993. Folding and assembly of viral membrane proteins. Virology 193:545-562[CrossRef][Medline]. |
| 17. | Dubay, J. W., S. R. Dubay, H. J. Shin, and E. Hunter. 1995. Analysis of the cleavage site of the human immunodeficiency virus type 1 glycoprotein: requirement of precursor cleavage for glycoprotein incorporation. J. Virol. 69:4675-4682[Abstract]. |
| 18. |
Earl, P. L.,
C. C. Broder,
D. Long,
S. A. Lee,
J. Peterson,
S. Chakrabarti,
R. W. Doms, and B. Moss.
1994.
Native oligomeric human immunodeficiency virus type 1 envelope glycoprotein elicits diverse monoclonal antibody reactivities.
J. Virol.
68:3015-3026 |
| 19. | Excler, J. L., and S. Plotkin. 1997. The prime-boost concept applied to HIV preventive vaccines. AIDS 11(Suppl. A):S127-S137. |
| 20. |
Farzan, M.,
H. Choe,
E. Desjardins,
Y. Sun,
J. Kuhn,
J. Cao,
D. Archambault,
P. Kolchinsky,
M. Koch,
R. Wyatt, and J. Sodroski.
1998.
Stabilization of human immunodeficiency virus type 1 envelope glycoprotein trimers by disulfide bonds introduced into the gp41 glycoprotein ectodomain.
J. Virol.
72:7620-7625 |
| 21. | Freed, E. O., and R. Risser. 1991. Identification of conserved residues in the human immunodeficiency virus type 1 principal neutralizing determinant that are involved in fusion. AIDS Res. Hum. Retroviruses 7:807-811[Medline]. |
| 22. | Gelderblom, H. R., H. Reupke, and G. Pauli. 1985. Loss of envelope antigens of HTLV-III/LAV, a factor in AIDS pathogenesis? Lancet ii:1016-1017. |
| 23. | Hu, S. L., J. Klaniecki, T. Dykers, P. Sridhar, and B. M. Travis. 1991. Neutralizing antibodies against HIV-1 BRU and SF2 isolates generated in mice immunized with recombinant vaccinia virus expressing HIV-1 (BRU) envelope glycoproteins and boosted with homologous gp160. AIDS Res. Hum. Retroviruses 7:615-620[Medline]. |
| 24. |
Inocencio, N. M.,
J. F. Sucic,
J. M. Moehring,
M. J. Spence, and T. J. Moehring.
1997.
Endoprotease activities other than furin and PACE4 with a role in processing of HIV-1 gp160 glycoproteins in CHO-K1 cells.
J. Biol. Chem.
272:1344-1348 |
| 25. |
Jones, P. L.,
T. Korte, and R. Blumenthal.
1998.
Conformational changes in cell surface HIV-1 envelope glycoproteins are triggered by cooperation between cell surface CD4 and co-receptors.
J. Biol. Chem.
273:404-409 |
| 26. | Kwong, P. D., R. Wyatt, J. Robinson, R. W. Sweet, J. Sodroski, and W. A. Hendrickson. 1998. Structure of an HIV gp120 envelope glycoprotein in complex with the CD4 receptor and a neutralizing human antibody. Nature 393:648-659[CrossRef][Medline]. |
| 27. |
Leonard, C. K.,
M. W. Spellman,
L. Riddle,
R. J. Harris,
J. N. Thomas, and T. J. Gregory.
1990.
Assignment of intrachain disulfide bonds and characterization of potential glycosylation sites of the type 1 recombinant human immunodeficiency virus envelope glycoprotein (gp120) expressed in Chinese hamster ovary cells.
J. Biol. Chem.
265:10373-10382 |
| 28. | Lu, M., S. Blackow, and P. Kim. 1995. A trimeric structural domain of the HIV-1 transmembrane glycoprotein. Nat. Struct. Biol. 2:1075-1085[CrossRef][Medline]. |
| 29. |
Lu, M.,
H. Ji, and S. Shen.
1999.
Subdomain folding and biological activity of the core structure from human immunodeficiency virus type 1 gp41: implications for viral membrane fusion.
J. Virol.
73:4433-4438 |
| 30. | Lu, S., R. Wyatt, J. F. Richmond, F. Mustafa, S. Wang, J. Weng, D. C. Montefiori, J. Sodroski, and H. L. Robinson. 1998. Immunogenicity of DNA vaccines expressing human immunodeficiency virus type 1 envelope glycoprotein with and without deletions in the V1/2 and V3 regions. AIDS Res. Hum. Retroviruses 14:151-155[Medline]. |
| 31. | McCune, J. M., L. B. Rabin, M. B. Feinberg, M. Lieberman, J. C. Kosek, G. R. Reyes, and I. L. Weissman. 1988. Endoproteolytic cleavage of gp160 is required for the activation of human immunodeficiency virus. Cell 53:55-67[CrossRef][Medline]. |
| 32. |
McKeating, J. A.,
A. McKnight, and J. P. Moore.
1991.
Differential loss of envelope glycoprotein gp120 from virion of human immunodeficiency virus type 1 isolates: effects on infectivity and neutralization.
J. Virol.
65:852-860 |
| 33. |
Merat, R.,
H. Raoul,
T. Leste-Lasserre,
P. Sonigo, and G. Pancino.
1999.
Variable constraints on the principal immunodominant domain of the transmembrane glycoprotein of human immunodeficiency virus type 1.
J. Virol.
73:5698-5706 |
| 34. | Mo, H., L. Stamatatos, J. E. Ip, C. F. Barbas, P. W. H. I. Parren, D. R. Burton, J. P. Moore, and D. D. Ho. 1997. Human immunodeficiency virus type 1 mutants that escape neutralization by human monoclonal antibody IgG1b12. J. Virol. 71:6869-6874[Abstract]. |
| 35. |
Moore, J. P.
1997.
Co-receptors: implications for HIV pathogenesis and therapy.
Science
276:51-52 |
| 36. | Moore, J. P., and J. Binley. 1998. HIV: envelope's letters boxed into shape. Nature 393:630-631[CrossRef][Medline]. |
| 37. | Moore, J. P., J. A. McKeating, I. M. Jones, P. E. Stephens, G. Clements, S. Thomson, and R. A. Weiss. 1990. Characterization of recombinant gp120 and gp160 from HIV-1: binding to monoclonal antibodies and soluble CD4. AIDS 4:307-315[Medline]. |
| 38. |
Moore, J. P.,
J. A. McKeating,
R. A. Weiss, and Q. J. Sattentau.
1990.
Dissociation of gp120 from HIV-1 virions induced by soluble CD4.
Science
250:1139-1142 |
| 39. |
Moore, J. P.,
Q. J. Sattentau,
R. Wyatt, and J. Sodroski.
1994.
Probing the structure of the human immunodeficiency virus surface glycoprotein gp120 with a panel of monoclonal antibodies.
J. Virol.
68:469-484 |
| 40. | Moore, J. P., and D. D. Ho. 1995. HIV-1 neutralization: the consequences of viral adaptation to growth on transformed T cells. AIDS 9(Suppl. A):S117-S136. |
| 41. | Moore, J. P., and J. Sodroski. 1996. Antibody cross-competition analysis of the human immunodeficiency virus type 1 gp120 exterior envelope glycoprotein. J. Virol. 70:1863-1872[Abstract]. |
| 42. |
Moore, J. P.,
M. Thali,
B. A. Jameson,
F. Vignaux,
G. K. Lewis,
S. W. Poon,
M. Charles,
M. S. Fung,
B. Sun,
P. J. Durda,
L. Akerblom,
B. Wahren,
D. D. Ho,
Q. J. Sattentau, and J. Sodroski.
1993.
Immunochemical analysis of the gp120 surface glycoprotein of human immunodeficiency virus type 1: probing the structure of the C4 and V4 domains and the interaction of the C4 domain with the V3 loop.
J. Virol.
67:4785-4796 |
| 43. | Moore, J. P., A. Trkola, B. Korber, L. J. Boots, J. A. Kessler, 2nd, F. E. McCutchan, J. Mascola, D. D. Ho, J. Robinson, and A. J. Conley. 1995. A human monoclonal antibody to a complex epitope in the V3 region of gp120 of human immunodeficiency virus type 1 has broad reactivity within and outside clade B. J. Virol. 69:122-130[Abstract]. |
| 44. |
Morikawa, Y.,
E. Barsov, and I. Jones.
1993.
Legitimate and illegitimate cleavage of human immunodeficiency virus glycoproteins by furin.
J. Virol.
67:3601-3604 |
| 45. |
Munoz-Barroso, I.,
K. Salzwedel,
E. Hunter, and R. Blumenthal.
1999.
Role of the membrane-proximal domain in the initial stages of human immunodeficiency virus type 1 envelope glycoprotein-mediated membrane fusion.
J. Virol.
73:6089-6092 |
| 46. |
Muster, T.,
R. Guinea,
A. Trkola,
M. Purtscher,
A. Klima,
F. Steindl,
P. Palese, and H. Katinger.
1994.
Cross-neutralizing activity against divergent human immunodeficiency virus type 1 isolates induced by the gp41 sequence ELDKWAS.
J. Virol.
68:4031-4034 |
| 47. |
Muster, T.,
F. Steindl,
M. Purtscher,
A. Trkola,
A. Klima,
G. Himmler,
F. Ruker, and H. Katinger.
1993.
A conserved neutralizing epitope on gp41 of human immunodeficiency virus type 1.
J. Virol.
67:6642-6647 |
| 48. |
Olofsson, S., and J. E. Hansen.
1998.
Host cell glycosylation of viral glycoproteins a battlefield for host defence and viral resistance.
Scand. J. Infect. Dis.
30:435-440[CrossRef][Medline].
|
| 49. | Parren, P. W. H. I., J. P. Moore, D. R. Burton, and Q. J. Sattentau. 1999. The neutralizing antibody response to HIV-1: viral evasion and escape from humoral immunity. AIDS 13(Suppl. A):S137-S162. |
| 50. |
Parren, P. W. H. I.,
D. R. Burton, and Q. J. Sattentau.
1997.
HIV-1 antibody debris or virion?
Nat. Med.
3:366-367[Medline].
|
| 51. | Reitter, J. N., R. E. Means, and R. C. Desrosiers. 1998. A role for carbohydrates in immune evasion in AIDS. Nat. Med. 4:679-684[CrossRef][Medline]. |
| 52. |
Richmond, J. F.,
S. Lu,
J. C. Santoro,
J. Weng,
S. L. Hu,
D. C. Montefiori, and H. L. Robinson.
1998.
Studies of the neutralizing activity and avidity of anti-human immunodeficiency virus type 1 Env antibody elicited by DNA priming and protein boosting.
J. Virol.
72:9092-10000 |
| 53. |
Rizzuto, C. D.,
R. Wyatt,
N. Hernandez-Ramos,
Y. Sun,
P. D. Kwong,
W. A. Hendrickson, and J. Sodroski.
1998.
A conserved HIV gp120 glycoprotein structure involved in chemokine receptor binding.
Science
280:1949-1953 |
| 54. |
Roben, P.,
J. P. Moore,
M. Thali,
J. Sodroski,
C. F. Barbas, 3rd, and D. R. Burton.
1994.
Recognition properties of a panel of human recombinant Fab fragments to the CD4 binding site of gp120 that show differing abilities to neutralize human immunodeficiency virus type 1.
J. Virol.
68:4821-4828 |
| 55. |
Sakurai, H.,
R. A. Williamson,
J. E. Crowe,
J. A. Beeler,
P. Poignard,
R. B. Bastidas,
R. M. Chanock, and D. R. Burton.
1999.
Human antibody responses to mature and immature forms of viral envelope in respiratory syncytial virus infection: significance for subunit vaccines.
J. Virol.
73:2956-2962 |
| 56. | Sattentau, Q. J., S. Zolla-Pazner, and P. Poignard. 1995. Epitope exposure on functional, oligomeric HIV-1 gp41 molecules. Virology 206:713-717[CrossRef][Medline]. |
| 57. |
Schneider, J.,
O. Kaaden,
T. D. Copeland,
S. Oroszlan, and G. Hunsmann.
1986.
Shedding and interspecies type sero-reactivity of the envelope glycopolypeptide gp120 of the human immunodeficiency virus.
J. Gen. Virol.
67:2533-2538 |
| 58. |
Stein, B. S., and E. G. Engleman.
1990.
Intracellular processing of the gp160 HIV-1 envelope precursor. Endoproteolytic cleavage occurs in a cis or medial compartment of the Golgi complex.
J. Biol. Chem.
265:2640-2649 |
| 59. |
Sullivan, N.,
Y. Sun,
Q. Sattentau,
M. Thali,
D. Wu,
G. Denisova,
J. Gershoni,
J. Robinson,
J. P. Moore, and J. Sodroski.
1998.
CD4-induced conformational changes in the human immunodeficiency virus type 1 gp120 glycoprotein: consequences for virus entry and neutralization.
J. Virol.
72:4694-4703 |
| 60. |
Syu, W. J.,
W. R. Lee,
B. Du,
Q. C. Yu,
M. Essex, and T. H. Lee.
1991.
Role of conserved gp41 cysteine residues in the processing of human immunodeficiency virus envelope precursor and viral infectivity.
J. Virol.
65:6349-6352 |
| 61. |
Thali, M.,
J. P. Moore,
C. Furman,
M. Charles,
D. D. Ho,
J. Robinson, and J. Sodroski.
1993.
Characterization of conserved human immunodeficiency virus type 1 gp120 neutralization epitopes exposed upon gp120-CD4 binding.
J. Virol.
67:3978-3988 |
| 62. |
Thomas, G.,
B. A. Thorne,
L. Thomas,
R. G. Allen,
D. E. Hruby,
R. Fuller, and J. Thorner.
1988.
Yeast KEX2 endoprotease correctly cleaves a neuroendocrine prohormone in mammalian cells.
Science
241:226-230 |
| 63. | Travis, B. M., T. I. Dykers, D. Hewgill, J. Ledbetter, T. T. Tsu, S. L. Hu, and J. B. Lewis. 1992. Functional roles of the V3 hypervariable region of HIV-1 gp160 in the processing of gp160 and in the formation of syncytia in CD4+ cells. Virology 186:313-317[CrossRef][Medline]. |
| 64. | Trkola, A., T. Dragic, J. Arthos, J. M. Binley, W. C. Olson, G. P. Allaway, C. Cheng-Mayer, J. Robinson, P. J. Maddon, and J. P. Moore. 1996. CD4-dependent, antibody-sensitive interactions between HIV-1 and its co-receptor CCR-5. Nature 384:184-187[CrossRef][Medline]. |