Previous Article | Next Article ![]()
Journal of Virology, June 2000, p. 5032-5039, Vol. 74, No. 11
Le Centre de Recherche en Cancérologie
de l'Université Laval, L'Hôtel-Dieu de Québec,
Département de Biologie Médicale, Faculté de
Médecine, Québec G1R 2J6, Canada
Received 29 November 1999/Accepted 13 March 2000
Orphan nuclear receptor fetoprotein transcription factor (FTF) was
previously identified as a specific regulator of the
Viral hepatitis B is a leading cause
of liver disease and primary hepatocellular carcinoma (HCC) and a
leading cause of cancer deaths in populations in which hepatitis B
virus (HBV) carriage is endemic (3, 7, 24). Vaccination has
proven remarkably effective in preventing HBV infection (and hence HCC)
in some high-risk communities (9), but efforts are also
directed toward pharmacological and other means of controlling the
virus. Molecular biological studies have considerably advanced our
understanding of how the HBV genome operates, providing important new
clues to the natural history of HBV-related diseases and, potentially, new therapeutical avenues. The HBV genome (Fig.
1) consists of
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
The Hepatitis B Virus Core Promoter Is Strongly Activated by
the Liver Nuclear Receptor Fetoprotein Transcription Factor or
by Ectopically Expressed Steroidogenic Factor 1
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
1-fetoprotein gene during early liver development and in
response to hormonal signals (L. Galarneau, J.-F. Paré, D. Allard, D. Hamel, L. Lévesque, J. D. Tugwood, S. Green, and
L. Bélanger, Mol. Cell. Biol. 16:3853-3865, 1996). Here we
report a functional analysis of FTF interactions with the hepatitis B
virus (HBV) nucleocapsid promoter. DNA-protein-binding assays show that
the HBV core promoter contains two high-affinity FTF-binding sites and
a third, lower-affinity site shared with other receptors. Transfections
in HepG2, Hep3B, and PLC/PRF/5 hepatoma cells using chloramphenicol
acetyltransferase reporter genes with the nucleocapsid promoter linked
or not linked to enhancer I indicate that FTF is a potent activator of
the HBV core promoter, more efficient than HNF4
, HNF3
, HNF3
,
or C/EBP
. Steroidogenic factor 1, a close FTF homolog which binds to
the same DNA motif and is expressed ectopically in HepG2 cells, seems
to be an even stronger inducer than FTF. Point mutations of the
FTF-binding sites indicate direct FTF activatory effects on the core
promoter and the use of both high-affinity sites for productive
interaction between the core promoter and enhancer I. Coexpression
assays further indicate that FTF and HNF4
are the most efficient
partners for coactivation of the pregenomic core promoter, which may
largely account for the hepatic tropism and the early amplification of HBV infection. Carboxy terminus-truncated FTF behaves as a dominant negative mutant to compete all three FTF sites and strongly deactivate core promoter interactions with enhancer I; this suggests possible new
ways to interfere with HBV infection.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
3.2 kb of circular DNA
encoding four overlapping reading frames driven by promoter and
enhancer elements which operate in a highly liver-restricted manner.
The HBV nucleocapsid promoter has been especially targeted for detailed
molecular analysis, for its pivotal role in the hepatotropism and early
life cycle of HBV. The nucleocapsid promoter contains a basic core
segment which carries two genetically distinguishable promoters, the
preC and core pregenomic promoters, coordinately activated by an
upstream regulatory domain (devoid of intrinsic promoter activity)
extending from nucleotide (nt) 1636 to nt 1744 (43, 46). The
cumulative data on the nucleocapsid promoter (and other HBV promoter
and enhancer elements as well) clearly indicate that HBV hepatotropism
basically reflects the combined need for several liver-enriched
transcription factors in order for the HBV genome to replicate
efficiently. HBV transgenes are transcribed mostly in the liver
(1, 2, 23), transfected HBV transcribes and replicates
better in well-differentiated hepatocellular lines (8, 19, 36,
38), and some especially virulent strains of HBV contain
mutations that convert nucleocapsid promoter sequences into novel
high-affinity sites for liver-type transcription factors (15, 20,
26, 32); chronic HBV hepatitis culminating in HCC (11)
also implies that HBV makes sustained efficient use of liver
transcription factors.

View larger version (62K):
[in a new window]
FIG. 1.
The HBV core promoter contains two high-affinity binding
sites for nuclear receptor FTF (or its close relative SF1). The upper
diagram displays the main structural and regulatory components of the
HBV genome and a partial nucleotide sequence of the core promoter (Cp);
dots mark nucleotides present in the consensus FTF-binding site. S, S1,
S2, Spl, and Spll, envelope genes and promoters; X/Xp, X gene and
promoter; P, DNA polymerase; C/preC, nucleocapsid gene and upstream
region; ENHI and EII, enhancers I and II; angled arrows, transcription
initiation sites reported for the C (nts 1745, 1751, and 1818 to 1821)
and preC (nts 1785 to 1793) mRNA transcripts (29, 41, 43).
Autoradiograms show EMSAs conducted with 3 µg of total nuclear
proteins from Hep3B or HepG2 cells using a 32P-labeled
HBV-FTF#2 oligonucleotide probe. The value above each lane is the fold
molar excess of the competing unlabeled oligonucleotide. HepG2
reactions used a 50-fold molar excess of competitors. FTF
and FTFm,
native and mutant FTF sites from the AFP gene promoter; HNF4#2 and
mHNF4#2, wild-type and mutant HBV sequence from nt 1757 to nt 1769; C,
no competitor. Lanes
FTF and
SF1 show supershift reactions using
antibodies against FTF or SF1. Note that in the Hep3B reactions,
FTF
completely displaces the specifically retarded complexes toward an
upper band (arrow, lane 9) whereas displacement is negligible with the
HepG2 extract (lane 12) (a faint supershifted band was visible in other
assays). Conversely, specific bandshifts are strongly decreased by
SF1 in the HepG2 extract (lane 13) and not in the Hep3B extract
(lane 10). These assays indicate highly specific occupancy of the FTF#2
nt 1689 to 1707 segment by FTF or SF1 and that FTF#1 has slightly less
affinity for FTF/SF1 than does FTF#2 and HNF4#2 has less affinity than
FTF#1.
Like that of the HBV genome, expression of the albumin-related genes is
highly restricted to hepatocytes. Among its close relatives of this
four-member family (5), the
1-fetoprotein (AFP) gene is also differentially regulated in response to
developmental and hormonal signals (4, 6, 13). In our
analysis of AFP-specific gene regulation, we have pinpointed a critical
promoter element that is absent from the other albumin genes and
activated by the fetoprotein transcription factor (FTF) (The FTF
designation has been approved by the Genome Database Nomenclature
Committee [GDB accession no. 9837397]. In a recently proposed
nomenclature, FTF corresponds to NR5A2 [Nuclear Receptors Nomenclature
Committee, Letter, Cell 97:161-163, 1999].) (6, 13,
14), a nuclear receptor expressed selectively in the liver,
pancreas, and intestine (13, 34). FTF is a novel member of
the Drosophila fushi tarazu F1 family of orphan receptors
and a close homolog of steroidogenic factor 1 (SF1), which is expressed
in steroidogenic cell lineages (17). FTF is part of a
transcriptional liver differentiation cascade that involves hepatocyte
nuclear factor 3
(HNF3
) (34), HNF4
, and HNF1
(J.-F. Paré, S. Roy, and L. Bélanger, Abstr. 8th Biennial
Int. Congr. Liver Dev. Gene Regul. Dis., abstr. 10, p. 10), and FTF
emerges as the key rate-limiting factor for AFP gene activation in
response to liver growth and metabolic signals.
In our initial survey of potential FTF gene targets (13), we noted that the HBV nucleocapsid promoter contains two apparent high-affinity FTF-binding sites (FTF#1 and FTF#2 in Fig. 1). This seemed of particular interest to us regarding FTF reactivity to developmental signals in a different promoter context and also because HBV functions might, perhaps, be down-regulated using FTF-directed strategies. The results presented here indicate that FTF is, indeed, a potent activator of the HBV pregenomic core promoter. Furthermore, molecular hindrance at the FTF-binding sites strongly interferes with HBV promoter-enhancer functions, suggesting possible new opportunities to antagonize HBV replication.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
EMSAs.
Electrophoretic mobility shift assays (EMSAs) were
conducted as described previously (6, 13), using total
nuclear protein extracts and 32P-labeled oligonucleotide
HBV-FTF#2
(1689CGACCGACCTTGAGGCCTA1707; with
EcoRI overhangs) as a probe. Unlabeled oligonucleotides (with EcoRI overhangs) HBV-FTF#2 and HBV-FTF#1
(1638TCCTGCCCAAGGTCTTACAT1657),
the AFP promoter FTF-binding sequence TGTTCAAGGACA (FTF
)
or the nonbinding mutant sequence TGTTCAATGAAA (FTFm)
(13), and the HBV-HNF4#2 sequence
1757AGGTTAAAGGTCT1769 or the mutant
sequence AAATTAAAAATCT were used as competitors in EMSA
reactions. Supershift assays (13) used human FTF (hFTF) (14) antiserum raised in rabbits against the hFTF
extra-DNA-binding domain C-terminal domain (hFTF-glutathione
S-transferase fusion protein; Pharmacia pGEX-4T3); anti-SF1
antibodies were obtained from Upstate Biotech Inc.
Gene constructs.
HBV DNA segments from luciferase vectors
ABluc and ABluc
e (29) (kindly provided by Aleem Siddiqui)
were transferred into pBluescriptSK+ chloramphenicol acetyltransferase
(CAT) expression vector SKCAT (Stratagene; CAT insert at
HinDIII/BamHI). The 522-nt AvaI
fragment (blunted) of ABluc
e (containing the HBV core
promoter) was inserted at the HinDIII site (blunted) of
SKCAT, to yield HBV promoter-CAT construct HP. The 343-nt HBV enhancer
I DNA segment of ABluc was amplified by PCR, fitted with 5'
KpnI and 3' SalI sites, and cloned into vector HP
digested with KpnI and SalI to generate HBV
enhancer-promoter-CAT construct HEP.
), leaving out the FTF#1 and HNF4#2 sequences and the major
initiation sites for the C (nt 1818 to 1821) and preC (nt 1785 to 1793)
mRNA transcripts (41, 43) but keeping two upstream C
promoter initiation sites mapped by Siddiqui's group (29)
(Fig. 1). Synthetic oligonucleotides overlapping within the targeted
DNA region were annealed, filled with Klenow, fitted with
5'-SalI and 3'-HinDIII ends, and cloned into
SalI/HinDIII-digested SKCAT. Vector HP
m2,
carrying FTF#2 mutation m2 (described above), was obtained by the same strategy.
To obtain human expression vector pClhFTF, full-length human FTF cDNA
(3.8 kb) was retrieved from a UniZAP-XR library (Stratagene) (14), released from the cloning vector by digestion with
EcoRI and XhoI, and transferred into
EcoRI/SalI-digested vector pCl from Promega.
Carboxy-terminally truncated FTF vectors pClmFTF
AF2 and
pClrFTF
LBD are mouse FTF/LRH-1 and rat FTF constructs pf
2 and
pf
3 in reference 13.
Transfections.
Transient-transfection assays were conducted
with human hepatoma cell lines HepG2, Hep3B, and PLC/PRF/5 or HeLa
cells (all lines were obtained from the American Type Culture
Collection) using the calcium phosphate procedure previously described
(6, 13). Cells (1.5 × 106 to 2.5 × 106 in 10-cm-diameter petri dishes) were maintained at
37°C with 5% CO2 in low-glucose Dulbecco's modified
Eagle's medium (GIBCO) containing 10% fetal bovine serum (Wisent) and
1% penicillin-streptomycin. Cells were cotransfected with 5 µg of an
HBV-CAT reporter construct, 10 µg of transcription factor expression
vector, and 2.5 µg of pRSVlacZ to control for transfection efficiency
(under our assay conditions, titrations with 0.1 to 30 µg of
transcription factor expression vectors have shown that maximal
activatory effects are generally obtained with 5 to 10 µg of vector).
Cells were washed with 10 mM HEPES 16 h after transfection. CAT
activities were measured by thin-layer chromatography and
phosphorimaging (Storm 860 Molecular Dynamics system equipped with
Imagequant software) 48 h (HepG2, Hep3B, and HeLa cells) or
72 h (PLC/PRF/5 cells) after transfection. Expression vectors for
transcription factors used viral enhancer-promoter elements from murine
sarcoma virus (C/EBP
), Rous sarcoma virus (HNF1
), and
cytomegalovirus (FTF, FTF
AF2, FTF
LBD, HNF4
, HNF3
, HNF3
,
SP1, and SF1).
| |
RESULTS |
|---|
|
|
|---|
The HBV core promoter contains two high-affinity FTF-binding
sites.
A computer search for FTF recognition sequences in the HBV
genome (using the GCG Wordsearch software) retrieved only the two candidate sequences we had noted (13) in the upstream
regulatory region of the basic core promoter, one matching the FTF
consensus binding site, T/CCAAGGTCA/G (HBV-FTF#2), and the other with
one mismatch, CCAAGGTCt (HBV-FTF#1) (Fig. 1). To test these sequences for FTF binding in vitro, EMSAs were done with an oligonucleotide probe
encompassing HBV-FTF#2 and total nuclear protein extract from Hep3B
cells. Retarded protein-DNA complexes formed as expected for human FTF
variants (13), and they were efficiently displaced with a
20-fold molar excess of unlabeled oligonucleotide HBV-FTF#1, HBV-FTF#2,
or AFP-FTF (FTF
) (Fig. 1, lanes 3, 5, and 7) but not by a 100-fold
excess of mutant AFP-FTF oligonucleotide FTFm (Fig. 1, lane 8).
Furthermore, the specific bands were supershifted by anti-FTF
antibodies, with no effect by antibodies against the closely related
SF1 protein (Fig. 1, lanes 9 and 10). These results confirmed that the
HBV core promoter contains two high-affinity FTF-binding sequences in
the close vicinity of binding sites for other liver-enriched
transcription factors (C/EBP, HNF3, and HNF4) (Fig. 1). The HBV-FTF#2
site displayed greater affinity for FTF than the HBV-FTF#1 site or even
the strong AFP-FTF site (Kd
0.3 nM)
(13), as shown in Fig. 1 by bandshift displacements at a low
excess of competitor (lanes 2, 4, and 6). Similar EMSA results were
obtained using nuclear protein extracts from PLC/PRF/5 cells (data not
shown). EMSA analysis of HepG2 cells, however, revealed that HepG2
cells contain relatively little FTF and, instead, ectopically express
abundant amounts of SF1. This was shown in reactions using specific
anti-FTF or anti-SF1 antibodies (Fig. 1, lanes 12 and 13; see also Fig.
9A in reference 13) and confirmed by reverse transcription-PCR analyses (our unpublished results). As expected from
their identical DNA-binding protein domains (13), FTF and SF1 were similar in specificity and affinity for HBV-FTF#1 or HBV-FTF#2.
FTF (or SF1) strongly activates the nucleocapsid promoter.
The
putative FTF regulatory effect on HBV core promoter activity was
assessed by transient-transfection assays with HepG2, Hep3B, and
PLC/PRF/5 hepatoma cells, three human lines known to support
transcription of the HBV genome (8, 19, 21, 36). We first
tested the nucleocapsid promoter in a natural 0.5-kb context of
contiguous DNA, without enhancer I sequences (reporter construct HP;
Fig. 2). In all three hepatoma lines,
cotransfection of HP with the FTF expression vector resulted in marked
stimulation of HP activity (4.5- to 6.5-fold; Fig. 2, lane 8).
Transfection of SF1 resulted in even stronger induction (Fig. 2, lane
9), especially in HepG2 cells (16-fold), where ectopic SF1 is already
abundant (Fig. 1). Other transcription factors were then tested for
coregulatory effects with FTF. Transcription factor HNF4
produced
fourfold enhancement of HP reporter activity in Hep3B or HepG2 cells,
which is consistent with previous studies (16, 33), and in
both lines, activation by FTF and HNF4
was additive (Fig. 2, lanes 7, 8, and 10). In PLC/PRF/5 cells (less differentiated than Hep3B or
HepG2 cells), the HP construct reacted poorly to HNF4
or to FTF plus
HNF4
(Fig. 2, lanes 7 and 10), and in HeLa cells, only marginal
stimulatory effects were observed with FTF and/or HNF4
(Fig. 2,
lanes 7, 8, and 10). A well-differentiated hepatocytic environment
therefore seems to be needed for efficient use of FTF and HNF4
.
Factors C/EBP
, HNF1
, and HNF3
were tested in HepG2 and Hep3B
cells, and factors HNF3
and SP1 were tested in Hep3B cells.
C/EBP
, HNF3
, and HNF3
had some stimulatory effects (twofold;
Fig. 2, lanes 2, 5, and 6), but none of the tested factors added
significantly to the activation effect of FTF or HNF4
(Fig. 2, lane
11; data not shown); instead, they generally resulted in lower
activation by FTF and/or HNF4
(Fig. 2, lane 12; data not shown).
Thus, FTF and HNF4
were clearly the most efficient partners in
coactivating the nucleocapsid promoter, which suggests productive
co-occupation of their tandem binding sites (Fig. 1).
|
FTF directly activates the core promoter.
To establish if FTF
(or SF1) induced the core promoter via sequences FTF#1 and/or FTF#2, we
used mutant reporter constructs HPm1, HPm2, and HPm12. In Hep3B cells,
basal promoter activity of HPm1 or HPm2 was not significantly reduced,
whereas HPm12 was inhibited by 30%. In HepG2 cells, HPm1 was
unaffected while HPm2 was reduced by 50% and HPm12 was reduced by
80%. These results confirmed the use of FTF/SF1 by the core promoter
under basal cell conditions, indicating a more active role for FTF#2
and the use of both FTF#1 and FTF#2 for optimal core promoter function. Mutation of FTF#1 or FTF#2 also reduced HP activation by exogenous FTF
in Hep3B cells, while activation of HPm2 was slightly reduced in HepG2
cells, and double mutation of FTF#1 and FTF#2 inhibited the response to
FTF by 65% in Hep3B cells and 45% in HepG2 cells (Fig. 3, lanes 2 to
4). These results indicated again that the FTF#1 and FTF#2 sites had to
be simultaneously occupied for maximal activation by FTF and also that
FTF induction resulted largely from direct FTF action at its two
promoter-binding sites. With only one FTF site intact, the core
promoter response to exogenous FTF was clearly less affected in HepG2
cells than in Hep3B cells. This might relate to abundant endogenous SF1
in HepG2 cells, allowing greater saturation of a single site and
perhaps more efficient use of SF1 coactivators present in HepG2; as
noted, SF1 induces the core promoter far more efficiently than FTF in
HepG2 cells (compare lanes 8 and 9 in Fig. 2). While the residual basal
activity of HPm12 was easily explained by its composite promoter
activation domain, the residual inducibility of HPm12 by FTF (Fig.
3, lane 4) suggested that FTF might also
act indirectly via other promoter regulators or that vector HP contains
other functional FTF promoter sites. The most likely candidate for the
latter was HNF4#2, a DR1 hormone response element (AGGTCA repeat with a
1-nt spacer); nearly canonical DR1 motifs, such as HNF4#2, form avid
binding sites for HNF4 and several other nuclear receptors (33,
44), but they are also recognized by FTF (EMSA reactions
indicated about 10-fold lower affinity of HNF4#2 for FTF or SF1,
compared to FTF#1; Fig. 1, lane 17). We then tested HP vectors mutated in HNF4#2 (HPm4) or in FTF#1, FTF#2, and HNF4#2 (HPm124). The basal activity of HPm4 was reduced by 40% in Hep3B cells and 85% in
HepG2 cells, and that of HPm124 was reduced by 60% in Hep3B cells and
to an undetectable level in HepG2 cells. Induction of HPm4 by
coexpressed FTF was also reduced by 60% in Hep3B cells (Fig. 3, lane
5), and FTF coexpression had only a negligible effect on HPm124 in
Hep3B cells and no effect in HepG2 cells (Fig. 3, lane 6). We further
tested a minimal (nt 1617 to nt 1755) upstream promoter construct
lacking FTF#1 and HNF4#2 (HP
; Fig. 3). HP
responded to FTF like
construct HPm1 (Fig. 3, lanes 2 and 7); when HP
was further mutated
at the FTF#2 site (HP
m2), all induction by FTF was again essentially
eliminated (Fig. 3, lane 8). These combined results confirmed the
importance of FTF#2 and were consistent with significant use of HNF4#2
by FTF/SF1 when FTF is overexpressed and especially when its
higher-affinity sites are unavailable (HPm12). Under our assay
conditions, it then appeared that all core promoter activation by FTF
could be accounted for by its direct interaction with three FTF-binding
sequences. The exact physiological role of FTF binding to HNF4#2
remains to be seen, given the abundance and higher affinity of
alternate receptors competing for the DR1 motif under steady-state
conditions (33, 44).
|
FTF effect on core promoter interactions with enhancer I.
FTF
effects were also examined in the context of genomic transactions
between the core promoter and its cognate enhancer I domain (19,
35, 37). While the basal activity of construct HEP was about
10-fold higher than that of HP (in HepG2 or Hep3B cells)
(autoradiograms in Fig. 2 and 4), FTF induction of HEP or HP was
essentially the same (five- to sixfold) (Fig.
4, lane 1, versus Fig. 2, lane 8); this
suggested that FTF induction of HEP was entirely due to FTF binding at
the core promoter. Mutations of FTF#1 and/or FTF#2 also reduced HEP
induction by FTF (Fig. 4, lanes 2 to 4), indicating that both FTF#1 and
FTF#2 participated in the interaction between the core promoter and
enhancer I. Contrasting with FTF, coexpression of HNF4
resulted in
three- to fourfold activation of HEP or its FTF site mutants (Fig. 4,
lanes 5 to 8); additive effects of FTF plus HNF4
were also
proportionately maintained with all HEP constructs (Fig. 4, lanes 9 to
12). These results clearly showed that HNF4
induction of the core
promoter can proceed independently from FTF/SF1. The induction by
HNF4
was similar for HEP and HP constructs (Fig. 4, lanes 5 and 9; versus Fig. 2, lanes 7 and 10), also suggesting that HNF4
, like FTF,
has little effect (direct or indirect) on the enhancer I segment. This
is consistent with previous conclusions (33). While
cotransfected FTF plus HNF4
raised HEP activity 2 logs over
basal HP activity, it is noteworthy that double FTF site mutation m12
(reducing basal HP activity by as much as 80%) had little effect on
the basal enhancer-promoter activity of HEP (less than 1.4-fold
decrease). It is apparent that without FTF/SF1, HBV can still mount
highly productive transactions with enhancer I using other core
promoter factors.
|
AF2-truncated FTF deactivates the core promoter.
The
carboxy-terminal region of the FTF protein (the activation function 2 domain) contains the hexameric amino acid motif LLIEML that is
found in many other nuclear receptors and is critical for their
activation. Previously, we found that AF2-truncated FTF (FTF
AF2;
diagrammed in Fig. 5) strongly suppresses
AFP promoter activity in transfection assays (presumably by competing
out endogenous FTF with the transcriptionally inert FTF mutant)
(13). FTF
AF2 was tested for similar dominant negative
effects on basal HEP activity. In HepG2, Hep3B, or PLC/PRF/5 cells,
FTF
AF2 strongly inhibited HEP activity, down to less than 10% (Fig.
5A to C). To assess competitive effects of FTF
AF2 at the FTF-binding
sites, further assays were conducted with HEPm1, HEPm2, and HEPm12. At a concentration of FTF
AF2 decreasing HEP activity by 70% in HepG2 cells, double FTF site mutant HEPm12 was repressed only 20% (Fig. 5B);
in Hep3B cells, FTF
AF2 (20 µg) reduced HEP activity more than 90%
whereas HEPm12 activity was reduced less than 30% (Fig. 5B). These
data thus support a competitive mechanism for deactivation of the
nucleocapsid promoter, replacing endogenous SF1/FTF with transcriptionally nonfunctional FTF
AF2 bound to the core promoter. Residual repression of HEPm12 by FTF
AF2 further suggested that FTF
AF2 might also compete out activators from the HNF4#2 site. This
was tested with HepG2 cells and vector HEPm124, which had low (
3%
of that of HEP) but measurable basal activity, and no significant
repression by FTF
AF2 was found (Fig. 5B). Remarkably, deactivation
of HEP by FTF
AF2 appeared to be unsaturated under our assay
conditions (Fig. 5A) and it clearly exceeded the effect expected by
eliminating FTF/SF1 from enhancer-promoter transactions (as noted from
the marginal change in basal levels of HEP versus HEPm12). Our
interpretation is that defective FTF brought onto the core promoter
disrupts alternative interactions of other promoter factors with
enhancer I. Steric hindrance, more than DNA binding per se, seems to be
at play, since a shorter FTF deletion mutant (FTF
LBD) had no
repressive effect and even enhanced HEP activity (Fig. 5C).
|
| |
DISCUSSION |
|---|
|
|
|---|
This study identified nuclear receptor FTF as one component
operating the HBV nucleocapsid promoter, using two high-affinity FTF-binding sites for basal core promoter activity and its productive interaction with enhancer I. This is in line with early findings (46) that basal activation of the core promoter is mainly
provided by the DNA segment including nts 1636 to 1703 (carrying the
two FTF sites) and that removing segments FTF#1 (nt 1648 to 1668 or 1645 to 1656) or FTF#2 (nts 1687 to 1703 or 1679 to 1719) markedly reduces basic core promoter activity (10, 29, 46). Other evidence supporting the use of both the FTF#1 and FTF#2 sites includes
the observation that HBV strain variants seem never to mutate FTF#2,
while FTF#1 is also rarely mutated and the segment including nts 1644 to 1666 (carrying FTF#1) is frequently duplicated (15, 32):
this clearly indicates a selective advantage to keeping or amplifying
the two FTF sites. (It can also be noted that in HCC samples obtained
from populations in which HBV is endemic, the most common gain of
genetic material [
75% of the cases] occurs by amplification of
chromosome 1q [22, 40], carrying the FTF locus
[14, 28]. Maintaining or enhancing FTF gene expression
plausibly provides an advantage to HBV in neoplastic progression.)
Recently, another group found that FTF#2 is footprinted by a
liver-enriched nuclear factor, which led to the independent cloning of
human FTF and to transfection assays concluding that FTF#2 is the sole
element used by FTF to activate the nucleocapsid promoter
(28). These experiments, however, used an HBV reporter
construct from which FTF#1 was deleted and also used HeLa cells, in
which transfected FTF may not make efficient use of its lower-affinity
site (HNF4#2). Independent hFTF expression cloning was also achieved by
yeast one-hybrid screening with the HBV segment including nts 1640 to
1663 (carrying the FTF#1 motif), and transfection assays conducted with
hepatoma cells were also consistent with activation of the nt 1640 to
1663 segment by FTF (18).
Among the other factors tested here, HNF4
was clearly the most
efficient FTF partner for costimulation of the core promoter. These two
single factors, highly expressed together only in hepatocytes, may thus
largely account for the hepatotropism of HBV infection. However, the
core promoter also clearly needs other liver factors, since FTF and
HNF4
were poorly effective in HeLa cells. The other factors tested
had low activatory effects and, in fact, reduced the action of FTF
and/or HNF4
. As suggested by others (29), this may
reflect protein displacement from overlapping chromatin domains and
suboptimal use of the stronger FTF/HNF4 activatory sites. Spacing
between their four high-affinity binding sites would predictably avoid
binding interference between FTF and HNF4 but not that between most of
the other combinations of factors tested (Fig. 1).
FTF action could then be exerted on three functional domains
intertwined in the nt 1630 to 1820 HBV segment, the C and preC promoters and enhancer II (Fig. 2) (30, 38, 42, 45). Ting's group (46) has shown that the DNA region including nts 1636 to 1703 coordinately enhances the synthesis of preC and C transcripts; it therefore seemed likely that FTF would activate both the C and preC
promoters, and this was recently borne out in HBV/FTF cotransfection
experiments conducted with HuH7 cells (18). One functional
difference between the preC and C promoter domains is that the preC
promoter is repressed by HNF4 (presumably because HNF4#2 overlaps the
preC TATA-like sequence) (44). Additive effects of FTF and
HNF4
might thus be taken as FTF being principally involved with
pregenomic core promoter function and playing a particularly important
role in the early life cycle and systemic load of HBV. This would also
be consistent with the apparent lack of FTF recognition sequences in
other HBV regulatory domains and would not preclude the possibility
that the core promoter could use alternate factors at later stages of
infection to avoid excessive squelching of FTF or because new viral
products would favor other factors (10). The enhancer II
issue is also intricate. Although evidence has been produced
(45) for full enhancer II effects using nts 1646 to 1668 and
1704 to 1715 (i.e., bypassing FTF, HNF4, and HNF3 sites), enhancer II
has more generally been defined as carrying one or both of the FTF
recognition sequences (30, 36, 38, 42); furthermore, point
mutations have indicated that HNF3#2 is essential both to core promoter
activity and to enhancer II effects on a heterologous promoter
(27). It thus seemed reasonable to think that FTF might
likewise serve both core promoter and enhancer II functions, and again,
recent differential analyses of HBV transcripts following HBV/FTF
cotransfections indicate that such is the case (18).
The present work adds to the growing evidence that HBV regulatory
domains can use alternate sets of factors to adapt efficiently to
changing hepatocytic states. It also illustrates some limits of HBV
transfection analyses using hepatoma cells. Here, double FTF site
promoter mutants were only marginally affected in the presence of
enhancer I, which may be quite misleading with regard to the actual
role of FTF with intact functional sites at preneoplastic stages. Also,
a high SF1 level with a low C/EBP
level (12) in HepG2
cells might mimic high pregenomic activity at early viral stages,
whereas a lower FTF-to-C/EBP
ratio in Hep3B cells could rather mimic
viral load conditions favoring alternate core activators or enhancer II
activity. The very finding of SF1 in HepG2 cells also illustrates how
aberrant gene expression in tumor cells may obscure homeostatic
processes occurring in hepatocytes. In spite of these intricacies, the
bulk of current data seems to make a compelling case for a preponderant
role of HNF4 and FTF in tightly controlling the pregenomic core
promoter and, hence, early amplification of HBV infection. In that
regard, aggressive strains of HBV frequently convert HNF4#2 to a
high-affinity HNF1 site (15, 20, 26), also showing the
selective advantage of a genetic element that escapes potential
negative regulators of HNF4#2 (44).
Resolution of whether receptor signalization pathways reaching HNF4 or
FTF can now be effectively manipulated against HBV infection remains a
challenging prospect, considering how HBV could switch activators and
adapt to new liver conditions. Also, while specific signals conveyed by
FTF to the AFP promoter might plausibly be sensed by the HBV core
promoter, certainly not all FTF-dependent AFP functions are reproduced
in the HBV context; glucocorticoids, in particular, inhibit AFP via FTF
(13) but had no discernible FTF-dependent effects on our HBV
constructs. The increasing diversity of FTF-inducible genes
(25, 31, 34; Paré et al., Abstr. 8th Biennial
Int. Congr. Liver Dev. Gene Regul. Dis.) also suggests that FTF may
well respond to different signals to optimize its action at a given
locus, none of which signals, however, may be sufficient to quench FTF
activity if interrupted. The present work also predicts limited success
of antisense or similar strategies simply removing FTF from action. More encouraging results were obtained here with mutant FTF
AF2, causing dramatic inhibition of HBV enhancer-promoter functions. This
effect clearly differs from simply removing FTF/SF1 from action since
no comparable decrease was incurred in basal HEP activity by a mutation
eliminating the two high-affinity FTF-binding sites. Notably, the
shorter FTF
LBD mutant did not repress HBV whereas it totally
suppressed AFP promoter activity (13) (presumably because
FTF at the AFP locus is essential to couple the AFP promoter with its
distal enhancer) (6, 39). Our interpretation favors steric
hindrance whereby the longer FTF mutant occupies the HBV core promoter
as an inert complex that also hinders alternative protein interactions
with the enhancer domain. Dominant negative factors may thus create new
opportunities to tackle functional redundancies of HBV regulatable
functions; liver cells might also be spared from deleterious dominant
negative effects by alternating HBV target sites. Conceivably,
adenovirus or adeno-associated virus vectors could serve to drive
dominant negative effectors into hepatocytes in vivo; a recently
described preclinical murine model of HBV infection (23)
might be particularly useful to address this type of therapeutical strategy.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by a studentship (S.G.) and grant MT-6478 (L.B.) from the Medical Research Council of Canada.
We thank A. Siddiqui, R. Costa, F. Sladek, M. V. Govindan, J. Milbrandt, and A. Anderson for providing expression plasmids; Lise Lévesque and Julie Vézina for collaboration; Manuel Caruso for helpful discussions; and Marie-France Voyer and Denise Rioux for excellent secretarial assistance.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Cancer Research Centre, L'Hôtel-Dieu de Québec, Québec G1R 2J6, Canada. Phone: (418) 691-5543. Fax: (418) 691-5489. E-mail: luc.belanger{at}crhdq.ulaval.ca.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Araki, K.,
J.-I. Miyazaki,
O. Hino,
N. Tomita,
O. Chisaka,
K. Matsubara, and K.-I. Yamamura.
1989.
Expression and replication of hepatitis B virus genome in transgenic mice.
Proc. Natl. Acad. Sci. USA
86:207-211 |
| 2. |
Babinet, C.,
H. Farza,
D. Morello,
M. Hadchouel, and C. Pourcel.
1985.
Specific expression of hepatitis B surface antigen (HBsAg) in transgenic mice.
Science
230:1160-1163 |
| 3. | Beasley, R. P., L. Y. Hwang, C. C. Lin, and C. S. Chien. 1981. Hepatocellular carcinoma and hepatitis B virus. A prospective study of 22,707 men in Taiwan. Lancet ii:1129-1133. |
| 4. |
Bélanger, L.,
D. Hamel,
L. Lachance,
D. Dufour,
M. Tremblay, and P. M. Gagnon.
1975.
Hormonal regulation of 1 foetoprotein.
Nature
256:657-659[CrossRef][Medline].
|
| 5. |
Bélanger, L.,
S. Roy, and D. Allard.
1994.
New albumin gene 3' adjacent to the 1-fetoprotein locus.
J. Biol. Chem.
269:5481-5484 |
| 6. |
Bernier, D.,
H. Thomassin,
D. Allard,
M. Guertin,
D. Hamel,
M. Blaquière,
M. Beauchemin,
H. LaRue,
M. Estable-Puig, and L. Bélanger.
1993.
Functional analysis of developmentally regulated chromatin-hypersensitive domains carrying the 1-fetoprotein gene promoter and the albumin/ 1-fetoprotein intergenic enhancer.
Mol. Cell. Biol.
13:1619-1633 |
| 7. | Blumberg, B. S. 1997. The current state of the prevention of HBV infection, the carrier state and hepatocellular carcinoma. Res. Virol. 148:91-94[CrossRef][Medline]. |
| 8. | Chang, C., K.-S. Jeng, C.-P. Hu, S. J. Lo, T.-S. Su, L.-P. Ting, C.-K. Chou, S.-H. Han, E. Pfaff, J. Salfeld, and H. Schaller. 1987. Production of hepatitis B virus in vitro by transient expression of cloned HBV DNA in a hepatoma cell line. EMBO J. 6:675-680[Medline]. |
| 9. |
Chang, M. H.,
C. J. Chen,
M. S. Lai,
H. M. Hsu,
T. C. Wu,
M. S. Kong,
D. C. Liang,
W. Y. Shau, and D. S. Chen.
1997.
Universal hepatitis B vaccination in Taiwan and the incidence of hepatocellular carcinoma in children. Taiwan childhood hepatoma study group.
N. Engl. J. Med.
336:1855-1859 |
| 10. |
Choi, B. H.,
G. T. Park, and H. M. Rho.
1999.
Interaction of hepatitis B viral X protein and CCAAT/enhancer-binding protein synergistically activates the hepatitis B viral enhancer II/pregenomic promoter.
J. Biol. Chem.
274:2858-2865 |
| 11. |
Dunsford, H. A.,
S. Sell, and F. V. Chisari.
1990.
Hepatocarcinogenesis due to chronic liver cell injury in hepatitis B virus transgenic mice.
Cancer Res.
50:3400-3407 |
| 12. |
Friedman, A. D.,
W. H. Landschulz, and S. L. McKnight.
1989.
CCAAT/enhancer binding protein activates the promoter of the serum albumin gene in cultured hepatoma cells.
Genes Dev.
3:1314-1322 |
| 13. |
Galarneau, L.,
J.-F. Paré,
D. Allard,
D. Hamel,
L. Lévesque,
J. D. Tugwood,
S. Green, and L. Bélanger.
1996.
The 1-fetoprotein locus is activated by a nuclear receptor of the Drosophila FTZ-F1 family.
Mol. Cell. Biol.
16:3853-3865[Abstract].
|
| 14. | Galarneau, L., R. Drouin, and L. Bélanger. 1998. Assignment of the fetoprotein transcription factor gene (FTF) to human chromosome band 1q32.11 by in situ hybridization. Cytogenet. Cell Genet. 82:269-270[CrossRef][Medline]. |
| 15. | Günther, S., N. Piwon, A. Iwanska, R. Schilling, H. Meisel, and H. Will. 1996. Type, prevalence, and significance of the core promoter/enhancer II mutations in hepatitis B viruses from immunosuppressed patients with severe liver disease. J. Virol. 70:8318-8331[Abstract]. |
| 16. |
Guo, W.,
M. Chen,
T. S. B. Yen, and J.-H. Ou.
1993.
Hepatocyte-specific expression of the hepatitis B virus core promoter depends on both positive and negative regulation.
Mol. Cell. Biol.
13:443-448 |
| 17. |
Ikeda, Y.,
D. S. Lala,
X. Luo,
E. Kim,
M.-P. Moisan, and K. L. Parker.
1993.
Characterization of the mouse FTZ-F1 gene, which encodes a key regulator of steroid hydroxylase gene expression.
Mol. Endocrinol.
7:852-860 |
| 18. |
Ishida, H.,
K. Ueda,
K. Ohkawa,
Y. Kanazawa,
A. Hosui,
F. Nakanishi,
E. Mita,
A. Kasahara,
Y. Sasaki,
M. Hori, and N. Hayashi.
2000.
Identification of multiple transcription factors, HLF, FTF, and E4BP4, controlling hepatitis B virus enhancer II.
J. Virol.
74:1241-1251 |
| 19. |
Jameel, S., and A. Siddiqui.
1986.
The human hepatitis B virus enhancer requires trans-acting cellular factor(s) for activity.
Mol. Cell. Biol.
6:710-715 |
| 20. | Kidd-Ljunggren, K., M. Öberg, and A. H. Kidd. 1997. Hepatitis B virus X gene 1751 to 1764 mutations: implications for HBeAg status and disease. J. Gen. Virol. 78:1469-1478[Abstract]. |
| 21. |
Knowles, B. B.,
C. C. Howe, and D. P. Aden.
1980.
Human hepatocellular carcinoma cell lines secrete the major plasma proteins and hepatitis B surface antigen.
Science
209:497-499 |
| 22. | Kusano, N., K. Shiraishi, K. Kubo, A. Oga, K. Okita, and K. Sasaki. 1999. Genetic aberrations detected by comparative genomic hybridization in hepatocellular carcinomas: their relationship to clinicopathological features. Hepatology 29:1858-1862[CrossRef][Medline]. |
| 23. | Larkin, J., M. Clayton, B. Sun, C. E. Perchonock, J. L. Morgan, L. D. Siracusa, F. H. Michaels, and M. A. Feitelson. 1999. Hepatitis B virus transgenic mouse model of chronic liver disease. Nat. Med. 5:907-912[CrossRef][Medline]. |
| 24. |
Lee, W. M.
1997.
Hepatitis B virus infection.
N. Engl. J. Med.
337:1733-1745 |
| 25. |
Lee, Y.-K.,
K. L. Parker,
H.-S. Choi, and D. D. Moore.
1999.
Activation of the promoter of the orphan receptor SHP by orphan receptors that bind DNA as monomers.
J. Biol. Chem.
274:20869-20873 |
| 26. |
Li, J.,
V. E. Buckwold,
M.-W. Hon, and J.-H. Ou.
1999.
Mechanism of suppression of hepatitis B virus precore RNA transcription by a frequent double mutation.
J. Virol.
73:1239-1244 |
| 27. | Li, M., Y. Xie, X. Wu, Y. Kong, and Y. Wang. 1995. HNF3 binds and activates the second enhancer, ENII, of hepatitis B virus. Virology 214:371-378[CrossRef][Medline]. |
| 28. |
Li, M.,
Y.-H. Xie,
Y.-Y. Kong,
X. Wu,
L. Zhu, and Y. Wang.
1998.
Cloning and characterization of a novel human hepatocyte transcription factor, hB1F, which binds and activates enhancer II of hepatitis B virus.
J. Biol. Chem.
273:29022-29031 |
| 29. |
López-Cabrera, M.,
J. Letovsky,
K.-Q. Hu, and A. Siddiqui.
1990.
Multiple liver-specific factors bind to the hepatitis B virus core/pregenomic promoter: trans-activation and repression by CCAAT/enhancer binding protein.
Proc. Natl. Acad. Sci. USA
87:5069-5073 |
| 30. | López-Cabrera, M., J. Letovsky, K.-Q. Hu, and A. Siddiqui. 1991. Transcriptional factor C/EBP binds to and transactivates the enhancer element II of the hepatitis B virus. Virology 183:825-829[CrossRef][Medline]. |
| 31. |
Nitta, M.,
S. Ku,
C. Brown,
A. Y. Okamoto, and B. Shan.
1999.
CPF: an orphan nuclear receptor that regulates liver-specific expression of the human cholesterol 7 -hydroxylase gene.
Proc. Natl. Acad. Sci. USA
96:6660-6665 |
| 32. | Pult, I., T. Chouard, S. Wieland, R. Klemenz, M. Yaniv, and H. E. Blum. 1997. A hepatitis B virus mutant with a new hepatocyte nuclear factor 1 binding site emerging in transplant-transmitted fulminant hepatitis B. Hepatology 25:1507-1515[CrossRef][Medline]. |
| 33. | Raney, A. K., J. L. Johnson, C. N. A. Palmer, and A. McLachlan. 1997. Members of the nuclear receptor superfamily regulate transcription from the hepatitis B virus nucleocapsid promoter. J. Virol. 71:1058-1071[Abstract]. |
| 34. |
Rausa, F.,
L. Galarneau,
L. Bélanger, and R. Costa.
1999.
The nuclear receptor fetoprotein transcription factor is coexpressed with its target gene HNF-3 in the developing murine liver intestine and pancreas.
Mech. Dev.
89:185-188[CrossRef][Medline].
|
| 35. | Shaul, Y., W. J. Rutter, and O. Laub. 1985. A human hepatitis B viral enhancer element. EMBO J. 4:427-430[Medline]. |
| 36. |
Su, H., and J.-K. Yee.
1992.
Regulation of hepatitis B virus gene expression by its two enhancers.
Proc. Natl. Acad. Sci. USA
89:2708-2712 |
| 37. |
Tognoni, A.,
R. Cattaneo,
E. Serfling, and W. Schaffner.
1985.
A novel expression selection approach allows precise mapping of the hepatitis B virus enhancer.
Nucleic Acids Res.
13:7457-7472 |
| 38. |
Wang, Y.,
P. Chen,
X. Wu,
A.-L. Sun,
H. Wang,
Y.-A. Zhu, and Z.-P. Li.
1990.
A new enhancer element, ENII, identified in the X gene of hepatitis B virus.
J. Virol.
64:3977-3981 |
| 39. |
Wen, P.,
N. Crawford, and J. Locker.
1993.
A promoter-linked coupling region required for stimulation of -fetoprotein transcription by distant enhancers.
Nucleic Acids Res.
21:1911-1918 |
| 40. |
Wong, N.,
P. Lai,
S.-W. Lee,
S. Fan,
E. Pang,
C.-T. Liew,
Z. Sheng,
J. W.-Y. Lau, and P. J. Johnson.
1999.
Assessment of genetic changes in hepatocellular carcinoma by comparative genomic hybridization analysis. Relationship to disease stage, tumor size, and cirrhosis.
Am. J. Pathol.
154:37-43 |
| 41. |
Yaginuma, K.,
Y. Shirakata,
M. Kobayashi, and K. Koike.
1987.
Hepatitis B virus (HBV) particles are produced in a cell culture system by transient expression of transfected HBV DNA.
Proc. Natl. Acad. Sci. USA
84:2678-2682 |
| 42. |
Yee, J. K.
1989.
A liver-specific enhancer in the core promoter region of human hepatitis B virus.
Science
246:658-661 |
| 43. | Yu, X., and J. E. Mertz. 1996. Promoters for synthesis of the pre-C and pregenomic mRNAs of human hepatitis B virus are genetically distinct and differentially regulated. J. Virol. 70:8719-8726[Abstract]. |
| 44. | Yu, X., and J. E. Mertz. 1997. Differential regulation of the pre-C and pregenomic promoters of human hepatitis B virus by members of the nuclear receptor superfamily. J. Virol. 71:9366-9374[Abstract]. |
| 45. |
Yuh, C.-H., and L.-P. Ting.
1991.
C/EBP-like proteins binding to the functional box- and box- of the second enhancer of hepatitis B virus.
Mol. Cell. Biol.
11:5044-5052 |
| 46. |
Yuh, C.-H.,
Y.-L. Chang, and L.-P. Ting.
1992.
Transcriptional regulation of precore and pregenomic RNAs of hepatitis B virus.
J. Virol.
66:4073-4084 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»