Previous Article | Next Article 
Journal of Virology, June 2000, p. 4988-4998, Vol. 74, No. 11
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Synergistic Action of GA-Binding Protein and
Glucocorticoid Receptor in Transcription from the Mouse Mammary Tumor
Virus Promoter
Koldo
Aurrekoetxea-Hernández and
Elena
Buetti*
Institute of Microbiology, University of
Lausanne, CH-1011 Lausanne, Switzerland
Received 15 July 1999/Accepted 25 February 2000
 |
ABSTRACT |
B lymphocytes are among the first cells to be infected by mouse
mammary tumor virus (MMTV), and they play a crucial role in its life
cycle. To study transcriptional regulation of MMTV in B cells, we have
analyzed two areas of the long terminal repeat (LTR) next to the
glucocorticoid receptor binding site, fp1 (at position
139 to
146
from the cap site) and fp2 (at
157 to
164). Both showed
B-cell-specific protection in DNase I in vitro footprinting assays and
contain binding sites for Ets transcription factors, a large family of
proteins involved in cell proliferation and differentiation and
oncogenic transformation. In gel retardation assays, fp1 and fp2 bound
the heterodimeric Ets factor GA-binding protein (GABP) present in
B-cell nuclear extracts, which was identified by various criteria:
formation of dimers and tetramers, sensitivity to pro-oxidant
conditions, inhibition of binding by specific antisera, and comigration
of complexes with those formed by recombinant GABP. Mutations which
prevented complex formation in vitro abolished glucocorticoid-stimulated transcription from an MMTV LTR linked to a
reporter gene in transiently transfected B-cell lines, whereas they did
not affect the basal level. Exogenously expressed GABP resulted in an
increased level of hormone response of the LTR reporter plasmid and
produced a synergistic effect with the coexpressed glucocorticoid
receptor, indicating cooperation between the two. This is the first
example of GABP cooperation with a steroid receptor, providing the
opportunity for studying the integration of their intracellular
signaling pathways.
 |
INTRODUCTION |
Mouse mammary tumor virus (MMTV) is
a type B retrovirus which causes carcinomas of the mammary gland in
females of susceptible mouse strains (8, 13). The
carcinogenic transformation results from transcriptional activation of
a particular class of cellular oncogenes (int genes;
reviewed in reference 59). The mammary gland
specificity of the oncogenic property of MMTV depends on the high viral
replication rate and consequent high reinfection rate in the mammary
epithelial cells, which are stimulated by pregnancy-related hormones.
This hormonal stimulation has made the MMTV promoter the best-studied
model for investigating the regulation of gene expression by steroid
hormones (for a review, see references 7 and
51). Glucocorticoids, progesterone, and androgens
(but not estrogens) strongly stimulate the rate of MMTV transcription
through the binding of hormone-receptor complexes in the hormone
regulatory element (HRE) (see Fig. 1) region of the proviral DNA,
located upstream of the promoter in the long terminal repeat (LTR).
Binding sites for additional transcription factors have been
characterized, in particular for CTF (also called nuclear factor 1 [NF-1]) and Oct-1 in the HRE, and for mammary gland-specific factors
further upstream in the LTR (reviewed in reference
31).
During primary infection, MMTV is transmitted in the milk from the
mother to the newborn and is taken up in the intestine, where it
infects local lymphocytes (reviewed in reference
43). Infected B cells express a 3'-LTR-encoded
superantigen (Sag) on their surfaces that interacts with the V
domain of the T-cell receptor on specific T-cell subsets (reviewed in
reference 1). This immune reaction results in a
preferential clonal expansion of infected B cells, thus facilitating
the persistence of the virus in the organism until the target mammary
tissue develops. The biology of the latency phase of the viral life
cycle is still largely unknown. Lymphocytes are required for virus
transportation to the mammary gland, where the hormonal stimulation is
the most important factor for virus production and tumorigenicity.
However, lower levels of virus expression are also detected in a
specific set of organs, in particular in lymphoid tissues. Tight
control of viral gene expression is suggested by the observations that (i) the pattern of expressing organs in mice transgenic for a reporter
gene linked to the MMTV LTR is the same as that in an infected mouse
and (ii) the presence of hormone receptors is not sufficient to allow
LTR activation in a nonpermissive organ (reference 52 and references therein). Since B lymphocytes are
essential for virus propagation in the infected animal (33),
we are interested in the regulation of viral expression in these cells.
As this implies the activation of the standard proviral promoter in the LTR for the synthesis of genomic and spliced RNAs, we investigated the
sequence requirements and interacting transcription factors in
B-lymphoma cell lines used as a model.
Both B and T cells have been shown to be infected in the mouse and in
cell culture and to be able to transmit virus to other cells
(21). Earlier studies were focused on pathological
situations, in particular on T-cell lymphomas characterized by an
amplification of integrated proviruses carrying large deletions and
rearrangements in their LTRs (reference 62 and
references therein). Lymphocytes of the B lineage, B-cell lines, and B
lymphomas express endogenous MMTV sequences at detectable levels,
without amplification or rearrangement of the proviral DNA (reviewed in
reference 16). In this study, we analyzed the
activity of the main LTR promoter in mature B-cell lines. We uncovered
two sequences which are required for glucocorticoid stimulation in B
cells and showed that they bind proteins of the Ets family of
transcription factors, namely, the heterodimeric GA-binding protein
(GABP) (10, 37, 38). The DNA-binding component is the
subunit (GABP
) containing the conserved Ets domain, a winged
helix-turn-helix protein motif (6). The
subunit
(GABP
) is bound to GABP
via repeats of the Notch-ankyrin type
(19). On two neighboring sites in the DNA, tetramers are
formed by interaction between the
subunits, and all these
protein-protein interactions greatly stabilize the binding to DNA
(reviewed in reference 28). Both DNA binding and
heterodimerization are regulated by the reduction-oxidation state of
specific cysteine residues (15, 45). We also demonstrated, using transient-transfection assays in B-cell lines with LTR constructs carrying specific mutations, that both Ets sites are important for
glucocorticoid stimulation, whereas they were not involved in the basal
level of transcription. Exogenously expressed GABP increased the
hormone-induced level of transcription, as did exogenously expressed
glucocorticoid receptor, and both required the integrity of the Ets
sites. Coexpressed receptor and GABP resulted in a synergistic
potentiation, suggesting a functional cooperation between GABP and the
glucocorticoid receptor in MMTV transcription in B cells.
 |
MATERIALS AND METHODS |
Cell lines.
The M12.4 mouse B-lymphoma cell line (M12) was
cultured in Dulbecco modified eagle's medium (DMEM) containing 5%
heat-inactivated fetal calf serum (FCS), 50 µM 2-mercaptoethanol, 2 mM L-glutamine, and antibiotics. The A20 mouse B-lymphoma
cell line was grown in RPMI 1640 medium, 10% FCS, antibiotics, and 50 µM 2-mercaptoethanol. Both were from R. Lees, Ludwig Institute for
Cancer Research, Epalinges, Switzerland. Ltk
aprt
cells (mouse fibroblasts) were maintained in DMEM,
10% FCS, and antibiotics. Cultures were kept at 37°C in a humidified
5% CO2 atmosphere.
Reagents and expression plasmids.
The expression plasmids
sRSV-GABP
and sRSV-GABP
1, bacterially expressed recombinant
GABP
and GABP
1, and rabbit polyclonal antibodies against these
proteins (23) were kind gifts of E. Flory. Immunoglobulin Gs
(IgGs) were purified with HiTrap protein G affinity columns
(Pharmacia). pCMV-thioredoxin was a gift of I. Kerblat, the human
glucocorticoid receptor expression plasmid pRSV-hGR
(26)
was a gift of R. Evans, and the mouse glucocorticoid receptor
expression plasmid pSG5mGR (derived from pSV2GRWrec
[18]) was a gift of M. G. Parker.
Plasmid construction.
The wild-type MMTV LTR (GR strain;
from the PstI site at position 11 in the LTR to the
PvuII site at its 3' end: pLSwt [36]) and
the mutants LS
175/
166 and 
193/
162 (carrying an octameric HindIII linker inserted between the indicated positions
from the RNA start site [12]) were subcloned as
SalI (filled-in)-BamHI fragments into the firefly
luciferase pGL3-Basic vector (Promega) at the SmaI and
BglII sites. The pGL3 constructs with LTRs truncated at
position
303 were made in the same vector by inserting the fragment
from
303 (filled-in StyI site) to the artificial
BamHI site next to the 3' end of the LTR. The
negative-control plasmid
P (lacking the standard basal promoter) was
made from pGL3/LTRwt by isolating the fragment from the SacI
site in the polylinker upstream of the LTR to the internal
SacI site at position
105 and recloning it into a
SacI-cut pGL3-Basic vector. Mutagenesis of the fp1 and fp2
sites was performed by the method of splicing by overlap extension
(34). Briefly, two internal primers of 56 nucleotides
containing the two mutated areas (in boldface below) corresponding to
the observed footprints fp1 and fp2 and an internal SpeI
restriction site (underlined) created by a single-nucleotide mutation
at position
151 (boldface and underlined) were synthesized: left
(
174 to
119) 5'
T TCT TAAACACCT TCGTGGAGACTAGTGTGGGAAATAGT TGGT T TGGTATCAAATG
3' and right (
131 to
186) 5'
AACCAACTATTTCCCACACTAGTCTCCACGAAGGTGTTTAAGAACAGTTTGTAACC 3'. We also used two external primers: left, (
668) 5'
GAGAGCAGTACAAGGACTAA 3', and right, (+131) 5'
CGCAGTCGGCCGACCTGAGGG 3'. Two PCRs were carried out first: one
with the internal primer right and the external left, and the second
with the internal primer left and the external right. After gel
purification, the products were combined in a third PCR using only the
external primers. The final product was digested with StuI
and BstEII and recloned in pGL3/LTRwt to replace the
corresponding wild-type fragment. A control LTR construct with only the
SpeI site was generated by mutating the A at
151 to a T,
using the technique described above but with internal oligonucleotides
spanning positions
159 to
140 and containing the mutation. The
presence of the mutations was verified by sequencing. Recombination of
LTR (fp1-fp2) with LTR (wild type-SpeI) to obtain singly
mutated LTRs was performed using the SpeI site and the
StuI or BstEII site.
Transfections.
Cell cultures were split the day before
transfection to obtain cultures in the late phase of exponential
growth. The amount of reporter plasmid was chosen to be in the linear
range of expression, determined in preliminary titration experiments.
M12, A20, and Ltk
cells were transfected by the
DEAE-dextran method following different protocols. For M12 cells, after
being washed with a buffer containing 20 mM HEPES (pH 7.2), 137 mM
NaCl, 0.5 mM KCl, and 3 mM glucose, 5 × 106 cells
were incubated at 37°C for 1 h with 0.5 ml of DMEM (without serum) containing DEAE-dextran (200 µg/ml; Amersham Pharmacia), 0.75 pmol (equal to 3 µg for wild-type LTR) of the LTR-pGL3 constructs, and 50 ng of the Renilla luciferase expression vector
pRL-SV40 or pRL-TK (Promega) and were cultured in complete medium
thereafter. The cells were harvested 24 h after transfection.
Transfection experiments with A20 cells were carried out following a
different DEAE-dextran protocol (29). Briefly,
107 cells in 1.5 ml of Tris-saline buffer-DEAE-dextran
(500 µg/ml), 0.75 pmol of LTR constructs, and 50 ng of pRL-SV40 were
incubated for 20 min at room temperature followed by the addition of 10 ml of RPMI-0.1 mM chloroquine and further incubation for 1 h at 37°C. Finally, the cells were cultured in complete medium and harvested 48 h later. Ltk
cells were transfected by
the protocol described previously (11) with 0.75 pmol of LTR
constructs and 50 ng of pRL-SV40. When required, the synthetic steroid
hormone dexamethasone was added in all three cell lines 3 to 5 h
before harvesting. Luciferase assays were performed with the Dual
luciferase assay kit (Promega), and measurements were done in a
Berthold Lumat luminometer. The results were expressed as the ratio of
firefly luciferase activity to Renilla luciferase activity
or, in some cases, when cotransfected transcription factors affected
the level of Renilla luciferase, as firefly luciferase activity per constant amount of protein (determined by the
bicinchoninic acid assay [Pierce]). The reproducibility of the
transfection conditions was verified beforehand. In experimental
series, the standard deviation between independently transfected
samples was <5%.
Nuclear extracts.
Extracts were made from logarithmically
growing A20 or M12 B cells (20) with modifications
(9). The cells were homogenized in hypotonic buffer, and the
nuclei were recovered by centrifugation at 30,000 × g
for 30 s. The nuclei were extracted in buffer C (20 mM HEPES [pH
7.9], 0.2 mM EDTA, 0.2 mM EGTA, 2 mM dithiothreitol [DTT], 20%
glycerol, 0.15 mM spermine, 0.75 mM spermidine, 1 mM phenylmethylsulfonyl fluoride, 0.4 M NaCl, and a cocktail of protease inhibitors [Complete and Mini; Roche Molecular Biochemicals]). The
extracts were recovered by centrifugation at 300,000 × g for 45 min and precipitated with ammonium sulfate [0.3 g of
solid (NH4)2SO4 per ml of
supernatant]. Resuspension, dialysis, and determination of protein
concentration by optical density were performed by the method of Gorski
et al. (27). For the preparation of extracts of A20 cells
treated with the oxidant diethyl maleate (DEM [45]), 1 mM DEM (Sigma) was added to the culture medium 2 h before
harvesting. Nuclear extracts of Ltk
cells were prepared
as described previously (11).
DNase I footprinting.
DNase I footprinting assays were
performed by the following modifications (41, 47) of the
original method (24). An asymmetrically radiolabeled DNA
probe was prepared from a plasmid with a truncation at position
303
of pLSwt (12), obtained by religating an
EcoRI-StyI-cut pLSwt after filling in with Klenow
polymerase. The resulting pLSwt (
303) plasmid was digested at the
(reconstituted) EcoRI site, end labeled with
[
-32P]ATP and polynucleotide kinase, and digested with
BamHI. The 0.45-kb fragment was purified from agarose gels,
and an aliquot was used for the purine sequencing reaction
(46). The labeled fragment (10 fmol), 1 µg of
double-stranded poly[d(I-C)] competitor, and nuclear extracts in a
20-µl binding reaction were incubated on ice for 30 min
(11) and digested with DNase I (Roche Molecular Biochemicals) for 5 min at 0°C. Samples without nuclear extracts received a 20-fold dilution of DNase I for 2 or 5 min. After proteinase K digestion, extraction, and precipitation (11), the DNA was separated by electrophoresis on 6% denaturing polyacrylamide gels (46), fixed, and dried prior to autoradiography at
80°C
with intensifying screens.
Gel mobility shift assay.
Double-stranded probes were made
by annealing a 5'-end-labeled oligonucleotide with its unlabeled
complementary strand. Their sequences were as follows: for fp1 (
154
to
133), 5' GACAAGTGGTTTCCTGAGTTGG 3' and 5'
CCAACTCAGGAAACCACTTGTC 3'; for fp2 (
175 to
152), 5' ggaCTTAAAACAAGGATGTGAGAC 3' and 5' GTCTCACATCCTTGTTTTAAGtcc
3' (the nucleotides in lowercase letters were added to avoid an
overlap with the glucocorticoid response element [GRE]); for fp1m
(mutated nucleotides are in boldface), 5'
GACAAGTGGTGGAAATAGTTGG 3' and 5'
CCAACTATTTCCACCACTTGTC 3'; for fp2m, 5'
ggaCTTAAAACACTTCGTGGAGAC 3' and 5'
GTCTCCACGAAGTGTTTTAAGtcc 3'; for fp1-fp2 (equivalent to D, a double oligonucleotide containing both binding sites;
172/
133), 5' CCAACTCAGGAAACCACTTGTCTCACATCCTTGTTTTAAG 3'
and 5' CTTAAAACAAGGATGTGAGACAAGTGGTTTCCTGAGTTGG 3';
and for VW (promoter of adenovirus 2; position
2/
41
[54]), 5' GAAGGGGGGCTATAAAAGGGGGTGGGGGCGCGTTCGTCC 3' and 5' GGACGAACGCGCCCCCACCCCCTTTTATAGCCCCCCTTC 3'.
Mobility shift assays were carried out as described previously
(17). In brief, 20-µl binding reaction mixtures in 125 mM
HEPES (pH 7.5), 50 mM EDTA, 5 mM DTT, 10% glycerol, 0.5% Nonidet
P-40, 1 mM phenylmethylsulfonyl fluoride and 12.5 µg of bovine serum
albumin/ml were preincubated with 4 µg of nuclear extracts and 1 µg
of double-stranded poly[d(I-C)] for 10 min at 20°C (the same
pattern was observed at 0°C). Labeled probe (10 fmol) was added, and
the reaction was continued for another 20 min. After the addition of
Ficoll 400 to a final concentration of 5%, the reaction mixtures were
loaded onto 5% polyacrylamide gels containing 0.5× Tris-borate-EDTA. The gels were electrophoresed in 0.5× Tris-borate-EDTA buffer at 4°C
for 2 h at 200 V. They were transferred to Whatman 3MM paper,
dried, and autoradiographed. In competition experiments, a 300-fold
excess of unlabeled, double-stranded oligonucleotides was incubated
with the nuclear extracts 5 min before the probe was added. For the
experiments with antibodies, 2 µg of purified IgGs was added to the
preincubation mixture on ice for 20 min prior to addition of the probe,
and the reaction was prolonged for 30 min at 20°C.
 |
RESULTS |
Identification of binding sites for B-cell nuclear proteins in the
HRE of the MMTV LTR.
We demonstrated in a previous study that
tissue-specific factors bind to a DNA sequence immediately 5' to the
distal glucocorticoid receptor binding site (14). We also
observed a correlation between the pattern of protection and the
permissivity for MMTV expression of the mouse organ from which the
nuclear extracts were made, e.g., spleen (permissive) versus liver
(nonpermissive). To look for cell-type-specific factors, we further
analyzed the DNA-protein interactions occurring in the HRE that are
able to modify the promoter activity. We compared DNase I footprinting
patterns of nuclear extracts from the fibroblastic Ltk
cell line with those of a mouse B-lymphoma cell line, M12, which could
also be used for functional studies by transient-expression assays.
Ltk
cells have been utilized for numerous transcription
studies, as they are permissive for MMTV expression and display high
stimulation factors by glucocorticoid hormones (36, 58).
Neither cell type was treated with glucocorticoid hormones before the
preparation of the extracts. However, as observed previously
(47), crude nuclear extracts from cells with a high receptor
level yield a footprint in the distal GRE even in the absence of
treatment with the hormone, due to residual cytoplasmic receptor
activated by the ammonium sulfate precipitation. Figure
1 (lanes 5 to 7) shows that M12 cells,
which represent a mature B-cell stage, lack a distinct footprint in the
promoter-distal region (
175 to
200) that is present in
Ltk
cells (lane 4) and includes the GRE and the upstream
tissue-specific binding site DRa, also seen previously with total
spleen nuclear extracts (14). This indicates that M12 cells
most likely contain a relatively low level of glucocorticoid receptor
compared to L cells. In the basal promoter region (
40 to
80), a
protection is visible with the M12 extract mainly in the CTF/NF-I
binding site (
60 to
80) and also, at high concentrations of
extract, in the octamer motif region (
40 to
60). The cap site
region (+1) is protected by L-cell extracts but not by M12-cell
extracts. In contrast, two narrow areas on the 3' side of the GRE were
specifically protected by M12 nuclear extracts, one around
140 (
139
to
146; called fp1) and the other around
160 (
157 to
164;
called fp2).

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 1.
B-cell factors binding in vitro to the HRE of MMTV.
DNase I footprinting analysis with nuclear extracts of the M12 B-cell
line shows two protected sites, fp1 and fp2 (arrowheads), not seen with
nuclear extracts of the fibroblastic Ltk cell line. A DNA
fragment comprising the sequences from the StyI restriction
site at positions 303 to +133, where a synthetic BamHI
linker was inserted, was 5' end labeled at the StyI site.
The fragment was incubated without added proteins (lanes 2 and 3), with
60 µg of nuclear proteins from L cells (lane 4), or with 48 (lane 5),
72 (lane 6), or 104 (lane 7) µg of nuclear proteins from M12 cells.
The complexes were subjected to DNase I digestion and separated on a
sequencing gel. Lane 1 contains a purine sequencing reaction of the
probe, and the numbers on the left indicate the number of nucleotides
from the transcription start site (+1). Also represented in the scheme
on the right are known factor-binding sites in the HRE of the MMTV LTR
that are protected by L-cell extracts: RNA initiation site (CAP), TATA
box, binding sites for octamer factors (OCT), for CTF/NF-1, for the
glucocorticoid receptor (the distal GRE), and for a tissue-specific
factor (DRa [14, 47]).
|
|
To assess whether the observed footprints were indeed caused by
proteins bound to fp1 and fp2, an electrophoretic mobility
shift assay
was carried out with M12 nuclear extracts and radiolabeled
double-stranded oligonucleotides containing either fp1 or fp2
(Fig.
2B). Complexes with low mobility were
observed with each
probe. The specificity of each complex was verified
by competition,
which was apparent using the homologous unlabeled
oligonucleotide
(Fig.
2A, lanes 4 and 11) but not using the unrelated
oligonucleotide
VW from the adenovirus promoter (Fig.
2A, lanes 1 and
7). The
fp1 and fp2 complexes had similarly low electrophoretic
mobilities
(complex I). Cross competition between fp1 and fp2 (Fig.
2A,
lanes
5 and 10) indicated that similar binding activities interacted
with these probes. Oligonucleotides containing mutations in the
bases
involved in the footprints (Fig.
2B) did not form the specific
complexes when used as probes (Fig.
2A, lanes 14 and 16) and did
not
compete with the wild-type probes (Fig.
2A, lanes 2 and 3
and lanes 8 and 9), confirming the specificity of complex I.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 2.
B-cell nuclear extracts form similar complexes on probes
with the fp1 or fp2 sequences. Gel retardation assays (A) with M12
nuclear extracts and end-labeled oligonucleotide probes (B) are shown.
Mutated oligonucleotides (1m and 2m) contained transversions at the
positions denoted by asterisks in the sequence in panel B, where the
GRE and the B-cell footprints fp1 and fp2 are underlined and in bold.
(A) Protein-DNA complexes were resolved on nondenaturing polyacrylamide
gels, followed by autoradiography. Where indicated (+; above the
probes), a 300-fold excess of competitor DNA, either homologous,
heterologous, mutated (m), or nonspecific (vw, an oligonucleotide with
the sequence of the adenovirus-2 promoter), was included in the
preincubation mixture. Specific complexes with similar mobilities (I)
on fp1 (1) or fp2 (2) showed cross competition (lanes 4, 5, 10, and
11). Mutations in the fp1 (1m) or fp2 (2m) sites abolished the
formation of complex I (lanes 14 and 16), which was not affected by
adding fp1m (lanes 3 and 9) or fp2m (lanes 2 and 8) in the competition
experiment. ns, nonspecific complex.
|
|
Transcriptional activity of LTRs with mutations in the fp1 and fp2
sites.
The same mutations of fp1 and fp2 which eliminated the
formation of complexes in vitro were engineered into LTRs (either
complete or 5' truncated at
303 to eliminate the effects of upstream
sequences) that directed the synthesis of the firefly luciferase
reporter gene. The transcriptional activities of the various plasmids
were assayed in transient-transfection experiments with M12 cells and also, to confirm the results, with a second B-lymphoma cell line, A20.
The measured firefly luciferase activity was standardized with respect
to the activity of a cotransfected plasmid carrying the
Renilla luciferase gene driven by either the simian virus 40 (SV40) promoter or the thymidine kinase promoter of herpes simplex
virus. The cells were either left untreated (to determine the basal
level of promoter activity) or stimulated for 3 to 5 h by the
addition of the synthetic glucocorticoid hormone dexamethasone (at a
concentration of 50 nM). Luciferase activity was measured in cell
extracts prepared 24 (M12 cells) or 48 (A20 cells) h after transfection. None of the mutated constructs differed significantly from their wild-type counterparts in basal promoter activity (Fig. 3A
and B,
dex samples). In contrast,
mutation of both fp1 and fp2 abolished the stimulatory effect of
dexamethasone in both A20 and M12 cell lines (Fig. 3A and B, + dex
samples). Plasmids carrying one mutation, either in fp1 or in fp2, had
only a partial activity (Fig. 3A and B), indicating that both sites
contributed roughly equally to the glucocorticoid induction in B cells.
The extent of stimulation by the wild-type LTR was about 10-fold in A20
cells (Fig. 3A) and about 3-fold in M12 cells (Fig. 3B). The transcriptional activity of the LTR carrying the SpeI site
(A-to-T mutation at position
151) used for recombining the single fp site mutations was indistinguishable from that of the wild-type LTR. An
LTR lacking the promoter downstream of position
105 (Fig. 3, bars
P) was used as a negative control. The double mutation in fp1 and
fp2 also abolished dexamethasone stimulation with an LTR truncated at
position
303, both in A20 cells (Fig. 3C) and in M12 cells (not
shown). Such truncated plasmids had overall higher expression levels
(also under unstimulated conditions [data not shown]), which were
probably due to the removal of negative regulatory elements present in
the LTR upstream of position
303 (42). The proximity of
fp1 and fp2 to the distal GRE, together with the observed suppression
of the glucocorticoid response in fp1 and fp2 mutants, suggested that
the in vitro complex I may interact with the glucocorticoid receptor
bound in the adjacent GRE (positions
171 to
182). While this
sequence element is essential for the glucocorticoid response in L
cells (12), its function had to be tested in B cells. We
therefore performed transient-expression assays in A20 cells with
luciferase reporter plasmids under the control of an LTR with the
distal GRE deleted (with a HindIII linker replacing the
sequence between
193 and
162) or an LTR carrying an 8-base
substitution in the GRE (mutant LS
175/
166). Both plasmids show a
10- to 20-fold reduction in glucocorticoid response in L cells
(12). As shown in Fig. 3D, both mutants were drastically
impaired in their responses to dexamethasone, demonstrating that the
distal GRE is responsible for the glucocorticoid stimulation of the
MMTV LTR in B cells as well (similar results were obtained in the M12
cell line [data not shown]). From the results shown in Fig. 3, we
concluded that fp1 and fp2 are required, in addition to the GRE, for
glucocorticoid-stimulated MMTV expression in these B-cell lines. We
were therefore interested in identifying the factors which bind to
these glucocorticoid coregulatory sites in the HRE.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 3.
Factors binding in fp1 and fp2 cooperate in the
transcriptional response to glucocorticoids in B cells. pGL-3
luciferase reporter plasmids were transiently transfected into A20
cells (A, C, and D) or M12 cells (B) and stimulated (+ dex) or not ( dex) with the glucocorticoid hormone dexamethasone (50 nM) for 5 h. The relative luciferase (Luc.) activity was calculated as the ratio
to the activity of the cotransfected SV40-Renilla luciferase
internal standard. Individual experiments are shown, which have been
repeated with the same results at least twice. The error bars show the
standard deviations between duplicate samples. (A and B) Luciferase
activities of plasmids containing a wild-type LTR (Lwt) or LTRs with
mutations in fp1 and fp2 (Lm1,2), in fp1 (Lm1), or in fp2 (Lm2).
Plasmid P contained an LTR lacking the sequences downstream of
position 105, including the promoter, and serves as a negative
control. (C) Luciferase activity (+ dex) of plasmids containing LTRs
truncated at position 303 (Twt and Tm1,2). (D) LTRs with mutations in
the GRE are unresponsive to dexamethasone in A20 B cells. In the
mutated LTRs an octameric HindIII linker replaces the
sequences between 193 and 162 (in L193m) or between 175 and 166
(in L175m).
|
|
Identification of fp1 and fp2 binding factors from B-lymphoma cell
lines.
The DNA sequence of the HRE was submitted to the World Wide
Web Signal Scan Information Matrix Database Search Service
(http://bimas.dcrt.nih.gov/molbio/matrixs/) for analysis of homologies
to published recognition sequences. The result indicated that fp1 and
fp2 could interact with proteins of the Ets family of transcription
factors, which comprises approximately 30 known members to date. These
are characterized by a common DNA-binding Ets domain of approximately
85 amino acids, and they are involved in cell proliferation and
differentiation and embryonic development (reviewed in reference
60). The most likely candidates were GABP, at both
fp1 and fp2, and PEA3, for which a consensus binding sequence is
present in fp2. PEA3 is a single-polypeptide Ets factor first described
as a regulator of the polyomavirus enhancer (61), while GABP
is a heterodimeric DNA-binding complex originally isolated as a factor
involved in immediate-early gene activation of herpes simplex virus
type 1 (37, 38). A human homolog is nuclear respiratory
factor 2 (NRF-2, or E4TF-1 [30, 53]). GABP is composed
of two distinct subunits, GABP
, which binds DNA via an Ets domain,
and GABP
, which interacts in a highly specific manner with GABP
(10) through Notch-ankyrin repeats, thereby greatly
stabilizing GABP
binding to DNA. To test whether GABP from B cells
binds to fp1 and fp2, we carried out gel retardation assays with
nuclear extracts preincubated with polyclonal antiserum directed
against GABP
or GABP
. These antisera had been shown to inhibit
GABP binding to its site in the distal interleukin-2 (IL-2) enhancer
(3). Whereas an unrelated antiserum allowed the formation of
specific complexes (Fig. 4A, lanes 4 and
8), these were completely inhibited by
anti-GABP
(lanes 1 and 5) and partially inhibited by anti-GABP
(lanes 2 and 6) for both probes, fp1 as well as fp2 (Fig. 4A).
Conversely, to show that the fp1 and fp2 sequences can be bound by
GABP, the corresponding oligonucleotides were incubated with
recombinant GABP
or -
, or with both together, and displayed in a
gel retardation assay in parallel with the product of incubation with a
nuclear extract of A20 cells (Fig. 4B and C). The addition of both
and
subunits of GABP resulted in the formation of a complex with
each of the probes (fp1 [Fig. 4B, lane 2] and fp2 [Fig. 4C, lane
3]) that comigrated with those formed upon addition of nuclear
extracts (Fig. 4B, lane 4, and C, lane 1). As GABP
is not a
DNA-binding protein, the faster-migrating complex is considered
nonspecific. GABP
bound less well than
and
together, in
agreement with the observation of a strong stabilizing effect of
GABP
on the DNA-binding activity of
(19, 23). The
major complex (I) formed by the nuclear extract comigrated with the

complex of recombinant proteins, confirming the identification
of fp1 and fp2 as GABP binding sites. We could not convincingly
demonstrate an effect of a PEA3-specific antiserum on any retarded
complex of nuclear extracts with either probe, consistent with the
reports that PEA3 is normally expressed in epithelial cells
(61) and myoblasts (57) but not in B lymphocytes
(J. A. Hassell, personal communication).

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 4.
GABP binds to fp1 and fp2 and is present in complex I of
B-cell extracts in a redox-sensitive form. (A to E) Gel retardation
assays with end-labeled oligonucleotide probes. (A) Specific antibodies
against GABP and/or GABP (lanes 1 to 3 and 5 to 7) abolished the
formation of complex I-GABP (lanes 4 and 8) on
32P-labeled oligonucleotides containing either fp1 (1) or
fp2 (2). A20 nuclear extracts were preincubated with the polyclonal
antibodies (purified IgGs) prior to addition of the probes. A similarly
purified unrelated (Unrel) antibody was used as a negative control
(lanes 4 and 8). (B and C) Recombinant GABP (rGABP ) and/or
GABP was incubated with the fp1 probe (B, lanes 1 to 3) or the fp2
probe (C, lanes 2 to 4) in parallel with A20 nuclear extracts (NE) (B,
lane 4, and C, lane 1). ns, nonspecific complex (also present in the
non-DNA-binding GABP sample). (D and E) Redox sensitivity of complex
formation in vitro. Treatment with NEM (0.25, 0.5, or 5 mM) or DTT (2, 3, or 4 mM) for 20 min at 20°C was carried out in the binding
reaction with A20 nuclear extracts and the fp1 (D) or the fp2 (E)
probe. (F) Redox sensitivity of reporter activity in vivo. M12 cells
were cotransfected with a plasmid expressing thioredoxin (Trx; 0, 1, 3, or 6 µg) and a vector plasmid (to a total of 6 µg) plus 0.75 pmol
of a luciferase reporter under the control of either the wild-type LTR
(Lwt) or an LTR with mutations in fp1 and fp2 (Lm1,2). The cells were
cultured in the presence of 1 mM H2O2 for
24 h, and dexamethasone (50 nM) was added to the +dex samples
during the last 4 h before harvesting. The firefly luciferase
activity of the extracts was measured and normalized to the
SV40-Renilla luciferase activity of a cotransfected internal
standard. The ratio of the activity of Lwt to that of Lm1,2 was plotted
as a function of the amount of cotransfected thioredoxin plasmid. The
error bars indicate standard deviations. +, present; , absent.
|
|
Redox sensitivity of the complexes.
DNA binding and
heterodimer formation of GABP are sensitive to redox. Both functions
require reducing conditions, and they are inhibited by pro-oxidant
agents both intracellularly and in nuclear extracts (15,
45). We tested whether this applied to the complexes of B-cell
extracts with fp1 and fp2. Nuclear extracts of A20 cells were treated
in vitro with increasing amounts of the alkylating agent
N-ethylmaleimide (NEM) or of DTT as a control and then used
in mobility shift assays with the fp1 or fp2 probes. The results are
shown in Fig. 4D and E. The lowest concentration (0.25 mM) of NEM
caused a reduction in the intensity of the 
dimer band compared
to that under reducing conditions (Fig. 4D and E, lanes 3 versus 6).
Moreover, it induced the appearance of a complex with higher mobility.
We think it may contain the
subunit alone, consistent with the
observation that the protein-protein interactions between the
and
subunits are more sensitive to oxidative conditions than the
binding of GABP
to DNA (15). Increasing NEM
concentrations resulted in the disappearance of both DNA-
and
DNA-
complexes (Fig. 4D and E, lane 1). We also tested the
sensitivity of the fp1-fp2 binding activity to intracellular redox
changes. A20 cells were treated for 2 h with the
glutathione-depleting agent DEM before nuclear extracts were prepared
(45). These in vivo-treated extracts, similarly to the in
vitro NEM-treated samples, were unable to form a complex with either
fp1 or fp2 (Fig. 5A, lane 2 versus lane 1 and 7 versus 6). Finally, it has been shown that the reducing protein
thioredoxin regulates the DNA-binding activity of GABP (45)
and the transcriptional activity of the glucocorticoid receptor
(44). We therefore measured the activity of the luciferase
reporter with either the wild-type or the fp1-fp2-mutated LTR in M12
cells cotransfected with a plasmid expressing thioredoxin and
pretreated with H2O2 (Fig. 4F). To assess the
contribution of the fp1-fp2 mutation, the ratio of the activities
(wild-type LTR over mutated LTR) was plotted in Fig. 4F as a function
of the amount of cotransfected thioredoxin plasmid. In its absence, no
response to dexamethasone was observed (ratio, 1). The intracellular
expression of thioredoxin reestablished the hormonal response of the
wild-type LTR but not that of the mutated LTR (ratio, >1). These data
show that the fp1-fp2 binding activity is regulated by redox conditions
in vitro and in vivo, in agreement with its identification as GABP.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 5.
Redox-sensitive GABP tetramers are formed by B-cell
nuclear extracts on a probe containing both fp1 and fp2. (A) Gel
retardation assay with A20 nuclear extracts and oligonucleotide probe
fp1 (1), fp2 (2), or fp1-fp2 (D; see Fig. 2B). With probe D, a
slower-migrating band is detected (lane 4). By analogy to the complex
formed by recombinant GABP, and to those observed with similarly
arranged Ets sites of known genes, it is tentatively identified as the
tetrameric from of GABP and is labeled 2 2. Treatment with
alkylating agents eliminated the tetrameric complex, in vitro by adding
NEM (20 min; 20°C) to the binding reaction (lane 3) or in vivo by
using a nuclear extract of DEM-treated cells (lane 5). On the
single-site probes as well, DEM treatment of the cells used for the
nuclear extract eliminated the  complex (lanes 2 versus 1 and 7 versus 6). (B) For comparison, tetramer formation on probe D by a
mixture of recombinant GABP (rGABP ) and GABP (lane 2). +,
present; , absent. ns, nonspecific complex.
|
|
Formation of heterotetrameric complexes.
GABP forms an
2
2 tetramer on tandemly arranged sites (like those in the
immediate-early promoter of herpes simplex virus) through a leucine
zipper domain at the carboxyl terminus of GABP
(19). As
fp1 and fp2 form an analogous arrangement in the MMTV LTR, separated by
8 bp, we investigated the binding properties of a double-stranded
oligonucleotide comprising both fp1 and fp2. In a gel retardation
assay, a complex with very low mobility is clearly visible (Fig. 5A,
lane 4) above the 
band. It is tentatively identified as
2
2, although its stoichiometry is not known. A complex with the
same mobility was detected with recombinant GABP
plus -
(Fig. 5B,
lane 2), whereas the addition of GABP
alone produced a faint lower
band (possibly an
2 complex [Fig. 5B, lane 1]). In agreement with
their putative identifications, both cellular
2
2 and 
complexes disappeared upon in vitro treatment of the nuclear extract
with the alkylating agent NEM (Fig. 5A, lane 3). An extract from cells
treated in vivo with DEM did not form any heterotetramers on the
fp1-fp2 probe (Fig. 5A, lane 5), whereas some 
dimers, and
predominantly
monomers, were detectable, suggesting that the in
vivo oxidation of the relevant cysteines of GABP
had been
incomplete. Compared to the total suppression of complex formation on
single-site probes (Fig. 5A, lanes 2 and 7), the partial effect on the
double-site probe (Fig. 5A, lane 5) may be due to cooperativity of GABP
binding. In conclusion, the DNA-binding activity to the fp1 and fp2
sites present in nuclear extracts of B-cell lines was identified as the
heterodimeric Ets family member GABP, based on its electrophoretic
mobility, reactivity with specific antisera, comigration with
recombinant proteins, and sensitivity to redox conditions.
Functional cooperation of GABP with the glucocorticoid
response.
We have shown (Fig. 3) that mutations which prevent GABP
binding to the fp1 and fp2 sites abolished the transcriptional
stimulation elicited by dexamethasone in B-cell lines. As the fp1 and
fp2 sites are contiguous to the distal GRE, which mediates the
glucocorticoid response (Fig. 3D), the endogenous GABP of B cells may
improve the binding or the activation properties of the glucocorticoid receptor. To test if added exogenous GABP is able to further increase the stimulated expression from the MMTV-LTR-luciferase reporter plasmid, we cotransfected M12 cells with expression vectors for the
cDNAs of the GABP subunits, singly or together. As shown in Fig.
6A, a twofold increase in luciferase
activity was observed even with the lowest dose (1 µg) of GABP
plasmids, especially with both subunits. Single subunits were also
effective, probably in cooperation with endogenous GABP. With
increasing amounts of GABP (3 or 6 µg), a maximum increase of
approximately threefold was obtained, approaching a plateau. For
comparison, we cotransfected the same plasmids into Ltk
cells, which contain a relatively large amount of glucocorticoid receptor (Fig. 1) (47) but do not show any presence of GABP in mobility shift assays with the fp1 or fp2 probe or with a consensus GABP binding probe (not shown). The results (Fig. 6B) show an fp1- and
fp2-dependent increase of dexamethasone-induced reporter activity of
approximately twofold with either GABP
alone or
plus
;
GABP
alone had no effect, consistent with its inability to bind DNA
and with the absence of endogenous GABP
in L cells. In M12 cells as
well, the increase of dexamethasone-stimulated activity by GABP
was dependent on the fp1 and fp2 sequences, whereas no effect was
observed on the uninduced basal level (Fig. 6C). We conclude that GABP
is able to cooperate functionally with the endogenous glucocorticoid
receptor. Since the expression of exogenous GABP in M12 B cells showed
a saturation of reporter activity (Fig. 6A), the level of endogenous
receptor may be limiting. We therefore asked if the dexamethasone
response could be improved by expressing exogenous receptor and if its
action remained dependent on GABP. The results shown in Fig. 6D
indicate that cotransfection of an expression vector for the
glucocorticoid receptor increased the dexamethasone response of M12
cells approximately 15-fold and moreover cooperated synergistically
with coexpressed GABP. This remarkable increment was dependent on the
GRE (as expected) but also, to a similar extent, on the fp1 and fp2
motifs (Fig. 6E).

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 6.
Exogenous GABP increases glucocorticoid-stimulated
reporter activity in M12 cells (A and C) and L cells (B) in an
fp1-fp2-dependent manner (B and C); exogenous glucocorticoid receptor
synergizes with GABP (D) and requires fp1 and fp2 (E) in M12 cells. (A)
The expression plasmids sRSV-GABP and/or sRSV-GABP 1 (0, 1, 3, or
6 µg) plus the control plasmid pRSV-TK (Co) to a total amount of 12 µg were transiently cotransfected with 0.75 pmol of wild-type
LTR-(firefly) luciferase plasmid into M12 cells, which were treated
with dexamethasone (50 nM). (B) 6 µg of pRSV-TK (Co) or 3 µg of
sRSV-GABP and/or sGABP 1 plus pRSV-TK to a total of 6 µg were
cotransfected with 0.75 pmol of wild-type (Lwt) or fp1-fp2-mutated
(Lm1,2) LTR-luciferase reporter constructs into Ltk
cells, which were treated with 100 nM dexamethasone (+ dex). (C) Three
micrograms each of sRSV-GABP and sRSV-GABP 1 expression plasmids
( ) or 6 µg of pRSV-TK (Co) was cotransfected with 0.75 pmol of
wild-type (Lwt) or fp1-fp2-mutated (Lm1,2) LTR-luciferase constructs
into M12 cells, which were treated (+ dex) or not ( dex) with
dexamethasone (50 nM). (D) Synergistic effect of GABP and the
glucocorticoid receptor (GR). M12 cells were transfected with 0.75 pmol
of Lwt plus 9 µg of pRSV-TK (Co) or 3 µg each of sRSV-GABP and
sRSV-GABP 1 ( ) and/or 3 µg of pRSVhGR (GR). pRSV-TK was
added to a total amount of 9 µg per transfection. The cells were
treated (+ dex) or not ( dex) with 50 nM dexamethasone. (E)
Overexpressed glucocorticoid receptor required fp1 and fp2 as well as
the GRE for glucocorticoid stimulation in M12 cells. Three micrograms
of pSG5mGR (GR) or of pSV2-neo control plasmid (Co) was cotransfected
with 0.75 pmol of LTR-luciferase constructs containing either the
wild-type LTR (Lwt), an LTR with the mutation LS 175/ 166 in the GRE
(L175m), the fp1-fp2-mutated LTR (Lm1,2), or the promoterless P
plasmid as a negative control. The cells were treated with 50 nM
dexamethasone. In panel E, the firefly luciferase (Luc.) activities of
the extracts were measured and normalized to the
SV40-Renilla luciferase activity of a cotransfected internal
standard. In panels A to D, the luciferase activity is expressed in
arbitrary units with respect to the protein content. Individual
experiments are shown, which have been repeated with the same results
at least twice. The error bars show the standard deviations between
duplicate samples.
|
|
 |
DISCUSSION |
In this study, we have identified a novel regulatory region in the
MMTV promoter that contains tandem Ets-like binding motifs and
interacts with the heterodimeric Ets factor GABP present in mature
B-cell lines. In these cells, mutation of both GABP binding sites
abolished the transcriptional stimulation elicited by glucocorticoid hormones, and expression of exogenous GABP increased it, indicating a
functional cooperation with the glucocorticoid receptor bound to the
adjacent GRE. The GABP binding site in MMTV DNA between positions
140
and
165 is composed of a dyad symmetry element with the GGA(A/T) core
sequences directed to the center of the dyad. Of the two components of
the dyad, fp1 shows a better homology (8 out of 10 bp) to the optimal
GABP binding site (10), whereas fp2 is less related (5 out
of 10 bp). This may explain their different efficiencies at binding
recombinant GABP (Fig. 4B and C). A similar internal arrangement of the
dyad is found in the GABP site of the distal IL-2 enhancer, and it was
described as rather unfavorable for the formation of
2
2
heterotetramers (3). Indeed, recombinant
2
2 complexes
were only a minor fraction of those formed on the fp1-fp2
oligonucleotide (Fig. 5). Structural features of the DNA-protein contacts have been described for a direct repeat of core elements (6, 28). On the other hand, a palindrome with the core
elements directed in opposite directions, as in the IL-16 promoter, was shown to favor heterotetramer formation (4). A relative
autonomy of the individual 
dimers on each site is suggested by
the functional analysis of reporters carrying mutations in either fp1
or fp2 that showed additivity and not synergism of their activities
(Fig. 3A and B). At first sight, the function of the GABP binding
sequences might seem to be to stabilize the binding of glucocorticoid
receptor molecules on the GRE, especially if they are present in low
abundance, as suggested by the absence of a footprint over the GRE with
M12 nuclear extracts (Fig. 1). However, overexpression of the receptor was unable to overcome the need for GABP binding, and the integrity of
the GABP sites was still required as much as the integrity of the GRE
(Fig. 6E). With mutants either in the GRE or in the fp1-fp2 sequence,
the residual activity observed with overexpressed receptor might be due
to protein-protein interactions between the receptor and GABP. These
data suggest that the role of GABP in B cells goes beyond a mere
stabilization of receptor binding to DNA and may involve a
transactivation function. Moreover, coexpression of GABP and receptor
resulted in a synergistic enhancement of the hormone response (Fig.
6D). An autonomous transactivating domain is present in the
subunit
of GABP, but none has been described so far in the
subunit
(30, 53). On the other hand, it was the
subunit which
showed cooperativity with endogenous glucocorticoid receptor in the
transfection experiment with L cells (Fig. 6B). It is likely that the
fp1 and fp2 sites are also occupied by Ets factors in Ltk
cells, because their mutation decreased the dexamethasone-induced luciferase level by two- to threefold. These putative Ets factors should be different from GABP
, as they cannot cooperate with transfected GABP
(Fig. 6B) and can be replaced by GABP
more efficiently, probably because of its overexpression. Identifying the
domains in GABP that are responsible for cooperation with the
glucocorticoid response will give new insights into the complexity of
the mechanisms of MMTV gene regulation by protein-protein interactions. Candidate proteins for conferring transactivation functions on GABP in
the context of the MMTV promoter are the nuclear coactivators CBP and
p300 (reviewed in reference 35), which were recently shown to bind to GABP
and enhance the induction of the IL-16 promoter (4). The prototype Ets factor, Ets-1, was also
shown to cooperate with CBP and p300, though the synergism was modest, suggesting that further cell or promoter requirements and/or factors are needed (63). It must be noted that the IL-16 promoter,
like most promoters activated by GABP, lacks a TATA box, unlike to the
MMTV promoter. Whether the mechanisms of transactivation would be the
same when a steroid receptor plus GABP interacts with a TATA-box-containing promoter will have to be determined. GABP was found
to be widely expressed in tissues (19, 37), yet it has been
shown to command the regulation of several genes which are expressed in
cell-type-specific patterns. Such selectivity depends in part on the
nature of the DNA-GABP
interactions and on regulation imparted by
its association with GABP
(28). Several of these genes
contain neither a TATA box nor a classical initiator element, and GABP
functions in them as a promoter element. In our study, no effect of
mutations in fp1 and fp2 on the basal, uninduced transcriptional
activity of the MMTV promoter was detected. In gel retardation assays
with the fp1 or fp2 probe and nuclear extracts of mouse
Ltk
cells, GR mammary tumor cells, or rat FTO-2B hepatoma
cells, we did not detect any complex with the migration property of a GABP heterodimer (data not shown). It is a general characteristic of
Ets factors to function in cooperation with other transcription factors
(reviewed in reference 60). Among the partners
described for GABP, one finds Jun-Fos (AP-1) (5), Sp-1
(64), c-Myb, and C/EBP (48). Few reports are
concerned with possible interactions of Ets factors with nuclear
receptors. In the rat tyrosine aminotransferase gene, an Ets binding
site of the
2.5-kb enhancer showed a weak cooperation with a
neighboring GRE (22). A cross inhibition between exogenously
expressed PU.1 (an Ets factor) and glucocorticoid receptor was observed
with promoter constructs carrying the respective DNA regulatory
elements (25). In the promoter of matrix metalloproteinases, an Ets binding site which is required for positive regulation in
cooperation with an AP-1 site was shown to be the target of repression
by the androgen receptor but not by other steroid (e.g., glucocorticoid) receptors (55).
Previous studies of regulatory functions of the MMTV LTR pointed to
sequences in the
140-to-
160 area as having negative effects, mainly
on the basal level of transcription (32, 39, 40). A report
on an activity affecting the glucocorticoid stimulation in a particular
rat hepatoma cell line showed a negative effect as well
(56). These observations are in contrast to the role of
fp1-fp2 in B cells described here, which is a positive one that affects
the glucocorticoid-stimulated expression, not the basal level. In the
course of its life cycle, MMTV replicates in lymphocytes, with B cells
as the first targets of viral infection. Apart from the expression of
the superantigen RNA encoded in the 3' LTR, for which separate
promoters located in the env gene have been identified
(2, 49, 50, 65), all other viral genes are transcribed from
the major proviral promoter in the LTR. In a search for B-cell-specific
transcriptional elements, it was not expected to find one that also
relied on the glucocorticoid receptor. Our results suggest a necessary
cooperation of GABP with the glucocorticoid receptor that may have
biological relevance for cells containing low levels of receptor, like
the mature B-cell lines used in this study. The basal activity of the
MMTV promoter is higher in B-cell lines and in primary B cells than in
mammary cells (16). Thus, two scenarios for MMTV expression
seem to occur in vivo, one in mammary cells, consisting of a very low basal level with a very high hormonal stimulation of promoter activity,
and one in B lymphocytes, characterized by a moderate basal level and a
moderate glucocorticoid induction with the help of GABP, a nonreceptor
factor. The data reported here concern a striking functional
cooperation of GABP with the glucocorticoid receptor at a natural viral
promoter. They provide the possibility to investigate the requirements
for binding site arrangement and for specific protein domains.
Moreover, as Ets factors in general (60), and GABP in
particular (23), have been shown to be targets of the
Ras-MAP kinase signal transduction cascade, they offer a novel example
of regulatory possibilities at the intersection of two signaling
pathways with a wide range of biological effects.
 |
ACKNOWLEDGMENTS |
We thank Egbert Flory for his generous gift of GABP reagents
(expression vectors, recombinant proteins, and antisera), Isabelle Kerblat for the thioredoxin plasmid, and, for the glucocorticoid receptor plasmids, Ron Evans (human glucocorticoid receptor) and Malcolm Parker (mouse glucocorticoid receptor). We also thank our
colleagues Eithne Costello and Roland Sahli for technical advice and
Markus Nabholz and Roland Sahli for critical reading of the manuscript.
This work was supported by the Swiss National Science Fund.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institute of
Microbiology, University of Lausanne, rue du Bugnon 44, CH-1011
Lausanne, Switzerland. Phone: 41-21-314 4100. Fax: 41-21-314 4095. E-mail: Elena.Buetti{at}chuv.hospvd.ch.
 |
REFERENCES |
| 1.
|
Acha-Orbea, H., and H. R. MacDonald.
1995.
Superantigens of mouse mammary tumor virus.
Annu. Rev. Immunol.
13:459-486[CrossRef][Medline].
|
| 2.
|
Arroyo, J.,
E. Winchester,
B. S. McLellan, and B. T. Huber.
1997.
Shared promoter elements between a viral superantigen and the major histocompatibility complex class II-associated invariant chain.
J. Virol.
71:1237-1245[Abstract].
|
| 3.
|
Avots, A.,
A. Hoffmeyer,
E. Flory,
A. Cimanis,
U. R. Rapp, and E. Serfling.
1997.
GABP factors bind to a distal interleukin 2 (IL-2) enhancer and contribute to c-Raf-mediated increase in IL-2 induction.
Mol. Cell. Biol.
17:4381-4389[Abstract].
|
| 4.
|
Bannert, N.,
A. Avots,
M. Baier,
E. Serfling, and R. Kurth.
1999.
GA-binding protein factors, in concert with the coactivator CREB binding protein/p300, control the induction of the interleukin 16 promoter in T lymphocytes.
Proc. Natl. Acad. Sci. USA
96:1541-1546[Abstract/Free Full Text].
|
| 5.
|
Basuyaux, J. P.,
E. Ferreira,
D. Stehelin, and G. Butticè.
1997.
The Ets transcription factors interact with each other and with the c-Fos/c-Jun complex via distinct protein domains in a DNA-dependent and -independent manner.
J. Biol. Chem.
272:26188-26195[Abstract/Free Full Text].
|
| 6.
|
Batchelor, A. H.,
D. E. Piper,
F. C. de la Brousse,
S. L. McKnight, and C. Wolberger.
1998.
The structure of GABP / : an ETS domain-ankyrin repeat heterodimer bound to DNA.
Science
279:1037-1041[Abstract/Free Full Text].
|
| 7.
|
Beato, M.
1989.
Gene regulation by steroid hormones.
Cell
56:335-344[CrossRef][Medline].
|
| 8.
|
Bittner, J. J.
1936.
Some possible effects of nursing on the mammary gland tumor incidence in mice.
Science
84:162-169[Free Full Text].
|
| 9.
|
Blake, M. C.,
R. C. Jambou,
A. G. Swick,
J. W. Kahn, and J. C. Azizkhan.
1990.
Transcriptional initiation is controlled by upstream GC-box interactions in a TATAA-less promoter.
Mol. Cell. Biol.
10:6632-6641[Abstract/Free Full Text].
|
| 10.
|
Brown, T. A., and S. L. McKnight.
1992.
Specificities of protein-protein and protein-DNA interaction of GABP and two newly defined ets-related proteins.
Genes Dev.
6:2502-2512[Abstract/Free Full Text].
|
| 11.
|
Buetti, E.
1994.
Stably integrated mouse mammary tumor virus long terminal repeat DNA requires the octamer motifs for basal promoter activity.
Mol. Cell. Biol.
14:1191-1203[Abstract/Free Full Text].
|
| 12.
|
Buetti, E., and B. Kühnel.
1986.
Distinct sequence elements involved in the glucocorticoid regulation of the mouse mammary tumor virus promoter identified by linker scanning mutagenesis.
J. Mol. Biol.
190:379-389[CrossRef][Medline].
|
| 13.
|
Cardiff, R. D., and L. J. T. Young.
1980.
Mouse mammary tumor biology: a new synthesis, p. 1105-1114.
In
M. Essex, G. Todaro, and H. Zur Hausen (ed.), Viruses in naturally occurring cancers. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 14.
|
Cavin, C., and E. Buetti.
1995.
Tissue-specific and ubiquitous factors binding next to the glucocorticoid receptor modulate transcription from the mouse mammary tumor virus promoter.
J. Virol.
69:3759-3770[Abstract].
|
| 15.
|
Chinenov, Y.,
T. Schmidt,
X. Y. Yang, and M. E. Martin.
1998.
Identification of redox-sensitive cysteines in GA-binding protein- that regulate DNA binding and heterodimerization.
J. Biol. Chem.
273:6203-6209[Abstract/Free Full Text].
|
| 16.
|
Corley, R. B.,
F. E. Lund,
T. D. Randall,
L. B. King,
S. Doerre, and D. L. Woodland.
1992.
Mouse mammary tumor proviral gene expression in cells of the B lineage.
Semin. Immunol.
4:287-296[Medline].
|
| 17.
|
Costello, E.,
P. Saudan,
E. Winocour,
L. Pizer, and P. Beard.
1997.
High mobility group chromosomal protein 1 binds to the adeno-associated virus replication protein (Rep) and promotes Rep-mediated site-specific cleavage of DNA, ATPase activity and transcriptional repression.
EMBO J.
16:5943-5954[CrossRef][Medline].
|
| 18.
|
Danielsen, M.,
J. P. Northrop, and G. M. Ringold.
1986.
The mouse glucocorticoid receptor: mapping of functional domains by cloning, sequencing and expression of wild-type and mutant receptor proteins.
EMBO J.
5:2513-2522[Medline].
|
| 19.
|
de la Brousse, F. C.,
E. H. Birkenmeier,
D. S. King,
L. B. Rowe, and S. L. McKnight.
1994.
Molecular and genetic characterization of GABP .
Genes Dev.
8:1853-1865[Abstract/Free Full Text].
|
| 20.
|
Dignam, J. D.,
R. M. Lebovitz, and R. G. Roeder.
1983.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
11:1475-1489[Abstract/Free Full Text].
|
| 21.
|
Dzuris, J. L.,
T. V. Golovkina, and S. R. Ross.
1997.
Both T and B cells shed infectious mouse mammary tumor virus.
J. Virol.
71:6044-6048[Abstract].
|
| 22.
|
Espinás, M. L.,
J. Roux,
J. Ghysdael,
R. Pictet, and T. Grange.
1994.
Participation of Ets transcription factors in the glucocorticoid response of the rat tyrosine aminotransferase gene.
Mol. Cell. Biol.
14:4116-4125[Abstract/Free Full Text].
|
| 23.
|
Flory, E.,
A. Hoffmeyer,
U. Smola,
U. R. Rapp, and J. T. Bruder.
1996.
Raf-1 kinase targets GA-binding protein in transcriptional regulation of the human immunodeficiency virus type 1 promoter.
J. Virol.
70:2260-2268[Abstract].
|
| 24.
|
Galas, D. J., and A. Schmitz.
1978.
DNAse footprinting: a simple method for the detection of protein-DNA binding specificity.
Nucleic Acids Res.
5:3157-3170[Abstract/Free Full Text].
|
| 25.
|
Gauthier, J. M.,
B. Bourachot,
V. Doucas,
M. Yaniv, and F. Moreau-Gachelin.
1993.
Functional interference between the Spi-1/PU.1 oncoprotein and steroid hormone or vitamin receptors.
EMBO J.
12:5089-5096[Medline].
|
| 26.
|
Giguère, V.,
S. M. Hollenberg,
M. G. Rosenfeld, and R. M. Evans.
1986.
Functional domains of the human glucocorticoid receptor.
Cell
46:645-652[CrossRef][Medline].
|
| 27.
|
Gorski, K.,
M. Carneiro, and U. Schibler.
1986.
Tissue-specific in vitro transcription from the mouse albumin promoter.
Cell
47:767-776[CrossRef][Medline].
|
| 28.
|
Graves, B. J.
1998.
Inner workings of a transcription factor partnership.
Science
279:1000-1002[Free Full Text].
|
| 29.
|
Grosschedl, R., and D. Baltimore.
1985.
Cell-type specificity of immunoglobulin gene expression is regulated by at least three DNA sequence elements.
Cell
41:885-897[CrossRef][Medline].
|
| 30.
|
Gugneja, S.,
J. V. Virbasius, and R. C. Scarpulla.
1995.
Four structurally distinct, non-DNA-binding subunits of human nuclear respiratory factor 2 share a conserved transcriptional activation domain.
Mol. Cell. Biol.
15:102-111[Abstract].
|
| 31.
|
Günzburg, W. H., and B. Salmons.
1992.
Factors controlling the expression of mouse mammary tumour virus.
Biochem. J.
283:625-632.
|
| 32.
|
Härtig, E.,
B. Nierlich,
S. Mink,
G. Nebl, and A. C. Cato.
1993.
Regulation of expression of mouse mammary tumor virus through sequences located in the hormone response element: involvement of cell-cell contact and a negative regulatory factor.
J. Virol.
67:813-821[Abstract/Free Full Text].
|
| 33.
|
Held, W.,
G. A. Waanders,
A. N. Shakhov,
L. Scarpellino,
H. Acha-Orbea, and H. R. MacDonald.
1993.
Superantigen-induced immune stimulation amplifies mouse mammary tumor virus infection and allows virus transmission.
Cell
74:529-540[CrossRef][Medline].
|
| 34.
|
Higuchi, T.
1991.
Recombinant PCR, p. 177-183.
In
M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White (ed.), PCR protocols. Academic Press, San Diego, Calif.
|
| 35.
|
Janknecht, R., and T. Hunter.
1996.
Versatile molecular glue. Transcriptional control.
Curr. Biol.
6:951-954[CrossRef][Medline].
|
| 36.
|
Kühnel, B.,
E. Buetti, and H. Diggelmann.
1986.
Functional analysis of the glucocorticoid regulatory elements present in the mouse mammary tumor virus long terminal repeat. A synthetic distal binding site can replace the proximal binding domain.
J. Mol. Biol.
190:367-378[CrossRef][Medline].
|
| 37.
|
LaMarco, K.,
C. C. Thompson,
B. P. Byers,
E. M. Walton, and S. L. McKnight.
1991.
Identification of Ets- and notch-related subunits in GA binding protein.
Science
253:789-792[Abstract/Free Full Text].
|
| 38.
|
LaMarco, K. L., and S. L. McKnight.
1989.
Purification of a set of cellular polypeptides that bind to the purine-rich cis-regulatory element of herpes simplex virus immediate early genes.
Genes Dev.
3:1372-1383[Abstract/Free Full Text].
|
| 39.
|
Langer, S. J., and M. C. Ostrowski.
1988.
Negative regulation of transcription in vitro by a glucocorticoid response element is mediated by a trans-acting factor.
Mol. Cell. Biol.
8:3872-3881[Abstract/Free Full Text].
|
| 40.
|
Lee, J. W.,
P. G. Moffitt,
K. L. Morley, and D. O. Peterson.
1991.
Multipartite structure of a negative regulatory element associated with a steroid hormone-inducible promoter.
J. Biol. Chem.
266:24101-24108[Abstract/Free Full Text].
|
| 41.
|
Lichtsteiner, S.,
J. Wuarin, and U. Schibler.
1987.
The interplay of DNA-binding proteins on the promoter of the mouse albumin gene.
Cell
51:963-973[CrossRef][Medline].
|
| 42.
|
Liu, J.,
D. Bramblett,
Q. Zhu,
M. Lozano,
R. Kobayashi,
S. R. Ross, and J. P. Dudley.
1997.
The matrix attachment region-binding protein SATB1 participates in negative regulation of tissue-specific gene expression.
Mol. Cell. Biol.
17:5275-5287[Abstract].
|
| 43.
|
Luther, S. A., and H. Acha-Orbea.
1997.
Mouse mammary tumor virus: immunological interplays between virus and host.
Adv. Immunol.
65:139-243[Medline].
|
| 44.
|
Makino, Y.,
N. Yoshikawa,
K. Okamoto,
K. Hirota,
J. Yodoi,
I. Makino, and H. Tanaka.
1999.
Direct association with thioredoxin allows redox regulation of glucocorticoid receptor function.
J. Biol. Chem.
274:3182-3188[Abstract/Free Full Text].
|
| 45.
|
Martin, M. E.,
Y. Chinenov,
M. Yu,
T. K. Schmidt, and X. Y. Yang.
1996.
Redox regulation of GA-binding protein- DNA binding activity.
J. Biol. Chem.
271:25617-25623[Abstract/Free Full Text].
|
| 46.
|
Maxam, A. M., and W. Gilbert.
1980.
Sequencing end-labeled DNA with base-specific chemical cleavages.
Methods Enzymol.
65:499-560[Medline].
|
| 47.
|
Meulia, T., and H. Diggelmann.
1990.
Tissue-specific factors and glucocorticoid receptors present in nuclear extracts bind next to each other in the promoter region of mouse mammary tumor virus.
J. Mol. Biol.
216:859-872[Medline].
|
| 48.
|
Nuchprayoon, I.,
C. P. Simkevich,
M. Luo,
A. D. Friedman, and A. G. Rosmarin.
1997.
GABP cooperates with c-Myb and C/EBP to activate the neutrophil elastase promoter.
Blood
89:4546-4554[Abstract/Free Full Text].
|
| 49.
|
Reuss, F. U., and J. M. Coffin.
1995.
Stimulation of mouse mammary tumor virus superantigen expression by an intragenic enhancer.
Proc. Natl. Acad. Sci. USA
92:9293-9297[Abstract/Free Full Text].
|
| 50.
|
Reuss, F. U., and J. M. Coffin.
1998.
Mouse mammary tumor virus superantigen expression in B cells is regulated by a central enhancer within the pol gene.
J. Virol.
72:6073-6082[Abstract/Free Full Text].
|
| 51.
|
Ringold, G. M.
1985.
Steroid hormone regulation of gene expression.
Annu. Rev. Pharmacol. Toxicol.
25:529-566[CrossRef][Medline].
|
| 52.
|
Rollini, P.,
J. Billotte,
E. Kolb, and H. Diggelmann.
1992.
Expression pattern of mouse mammary tumor virus in transgenic mice carrying exogenous proviruses of different origins.
J. Virol.
66:4580-4586[Abstract/Free Full Text].
|
| 53.
|
Sawada, J.,
M. Goto,
C. Sawa,
H. Watanabe, and H. Handa.
1994.
Transcriptional activation through the tetrameric complex formation of E4TF1 subunits.
EMBO J.
13:1396-1402[Medline].
|
| 54.
|
Sawadogo, M., and R. G. Roeder.
1985.
Interaction of a gene-specific transcription factor with the adenovirus major late promoter upstream of the TATA box region.
Cell
43:165-175[CrossRef][Medline].
|
| 55.
|
Schneikert, J.,
H. Peterziel,
P. A. Defossez,
H. Klocker,
Y. Launoit, and A. C. Cato.
1996.
Androgen receptor-Ets protein interaction is a novel mechanism for steroid hormone-mediated down-modulation of matrix metalloproteinase expression.
J. Biol. Chem.
271:23907-23913[Abstract/Free Full Text].
|
| 56.
|
Tanaka, H.,
Y. Dong,
Q. Li,
S. Okret, and J. A. Gustafsson.
1991.
Identification and characterization of a cis-acting element that interferes with glucocorticoid-inducible activation of the mouse mammary tumor virus promoter.
Proc. Natl. Acad. Sci. USA
88:5393-5397[Abstract/Free Full Text].
|
| 57.
|
Taylor, J. M.,
E. E. Dupont-Versteegden,
J. D. Davies,
J. A. Hassell,
J. D. Houle,
C. M. Gurley, and C. A. Peterson.
1997.
A role for the ETS domain transcription factor PEA3 in myogenic differentiation.
Mol. Cell. Biol.
17:5550-5558[Abstract].
|
| 58.
|
Toohey, M. G.,
J. W. Lee,
M. Huang, and D. O. Peterson.
1990.
Functional elements of the steroid hormone-responsive promoter of mouse mammary tumor virus.
J. Virol.
64:4477-4488[Abstract/Free Full Text].
|
| 59.
|
van Leeuwen, F., and R. Nusse.
1995.
Oncogene activation and oncogene cooperation in MMTV-induced mouse mammary cancer.
Semin. Cancer Biol.
6:127-133[CrossRef][Medline].
|
| 60.
|
Wasylyk, B.,
J. Hagman, and A. Gutierrez-Hartmann.
1998.
Ets transcription factors: nuclear effectors of the Ras-MAP-kinase signaling pathway.
Trends Biochem. Sci.
23:213-216[CrossRef][Medline].
|
| 61.
|
Xin, J. H.,
A. Cowie,
P. Lachance, and J. A. Hassell.
1992.
Molecular cloning and characterization of PEA3, a new member of the Ets oncogene family that is differentially expressed in mouse embryonic cells.
Genes Dev.
6:481-496[Abstract/Free Full Text].
|
| 62.
|
Yanagawa, S.,
A. Murakami, and H. Tanaka.
1990.
Extra mouse mammary tumor proviruses in DBA/2 mouse lymphomas acquire a selective advantage in lymphocytes by alteration in the U3 region of the long terminal repeat.
J. Virol.
64:2474-2483[Abstract/Free Full Text].
|
| 63.
|
Yang, C.,
L. H. Shapiro,
M. Rivera,
A. Kumar, and P. K. Brindle.
1998.
A role for CREB binding protein and p300 transcriptional coactivators in Ets-1 transactivation functions.
Mol. Cell. Biol.
18:2218-2229[Abstract/Free Full Text].
|
| 64.
|
Yu, M.,
X. Y. Yang,
T. Schmidt,
Y. Chinenov,
R. Wang, and M. E. Martin.
1997.
GA-binding protein-dependent transcription initiator elements. Effect of helical spacing between polyomavirus enhancer a factor 3 (PEA3)/Ets-binding sites on initiator activity.
J. Biol. Chem.
272:29060-29067[Abstract/Free Full Text].
|
| 65.
|
Zhang, D. J.,
V. K. Tsiagbe,
C. Huang, and G. J. Thorbecke.
1996.
Control of endogenous mouse mammary tumor virus superantigen expression in SJL lymphomas by a promoter within the env region.
J. Immunol.
157:3510-3517[Abstract].
|
Journal of Virology, June 2000, p. 4988-4998, Vol. 74, No. 11
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lucas, M. E., Crider, K. S., Powell, D. R., Kapoor-Vazirani, P., Vertino, P. M.
(2009). Methylation-sensitive Regulation of TMS1/ASC by the Ets Factor, GA-binding Protein-{alpha}. J. Biol. Chem.
284: 14698-14709
[Abstract]
[Full Text]
-
Vander Kooi, B. T., Onuma, H., Oeser, J. K., Svitek, C. A., Allen, S. R., Vander Kooi, C. W., Chazin, W. J., O'Brien, R. M.
(2005). The Glucose-6-Phosphatase Catalytic Subunit Gene Promoter Contains Both Positive and Negative Glucocorticoid Response Elements. Mol. Endocrinol.
19: 3001-3022
[Abstract]
[Full Text]
-
Ristevski, S., O'Leary, D. A., Thornell, A. P., Owen, M. J., Kola, I., Hertzog, P. J.
(2004). The ETS Transcription Factor GABP{alpha} Is Essential for Early Embryogenesis. Mol. Cell. Biol.
24: 5844-5849
[Abstract]
[Full Text]
-
Aurrekoetxea-Hernandez, K., Buetti, E.
(2004). Transforming Growth Factor {beta} Enhances the Glucocorticoid Response of the Mouse Mammary Tumor Virus Promoter through Smad and GA-Binding Proteins. J. Virol.
78: 2201-2211
[Abstract]
[Full Text]
-
Zhan, D., Santin, A. D., Liu, Y., Parham, G. P., Li, C., Meyers, C., Hermonat, P. L.
(1999). Binding of the Human Papillomavirus Type 16 p97 Promoter by the Adeno-associated Virus Rep78 Major Regulatory Protein Correlates with Inhibition. J. Biol. Chem.
274: 31619-31624
[Abstract]
[Full Text]