Previous Article | Next Article 
Journal of Virology, May 2000, p. 4831-4838, Vol. 74, No. 10
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Rescue of Mumps Virus from cDNA
David K.
Clarke,*
Mohinderjit S.
Sidhu,
J. Erik
Johnson, and
Stephen A.
Udem
Wyeth-Lederle Vaccines, Pearl River, New York
10965
Received 13 December 1999/Accepted 23 February 2000
 |
ABSTRACT |
A complete DNA copy of the genome of a Jeryl Lynn strain of mumps
virus (15,384 nucleotides) was assembled from cDNA fragments such that
an exact antigenome RNA could be generated following transcription by
T7 RNA polymerase and cleavage by hepatitis delta virus ribozyme. The
plasmid containing the genome sequence, together with support plasmids
which express mumps virus NP, P, and L proteins under control of the T7
RNA polymerase promoter, were transfected into A549 cells previously
infected with recombinant vaccinia virus (MVA-T7) that expressed T7 RNA
polymerase. Rescue of infectious virus from the genome cDNA was
demonstrated by amplification of mumps virus from transfected-cell
cultures and by subsequent consensus sequencing of reverse
transcription-PCR products generated from infected-cell RNA to verify
the presence of specific nucleotide tags introduced into the genome
cDNA clone. The only coding change (position 8502, A to G) in the cDNA
clone relative to the consensus sequence of the Jeryl Lynn plaque
isolate from which it was derived, resulting in a lysine-to-arginine
substitution at amino acid 22 of the L protein, did not prevent rescue
of mumps virus, even though an amino acid alignment for the L proteins
of paramyxoviruses indicates that lysine is highly conserved at that
position. This system may provide the basis of a safe and effective
virus vector for the in vivo expression of immunologically and
biologically active proteins, peptides, and RNAs.
 |
INTRODUCTION |
The etiological agent of
mumps was first shown reproducibly to be a virus by Johnson and
Goodpasture in 1935 (17). Since then, propagation in tissue
culture has facilitated virus classification and studies on the
biological properties of mumps virus (MUV). Originally classified
with influenza viruses in the myxovirus family, mumps virus has
since been reassigned to the Paramyxoviridae family,
subfamily Paramyxovirinae, genus
Rubulavirus, based on nucleocapsid morphology, genome
organization, and biological properties of the proteins. Other
members of the Rubulavirus genus include simian virus 5 (SV5), human parainfluenza virus type 2 and type 4, and Newcastle
disease virus (18). Like all viruses of the Paramyxoviridae, MUV is pleomorphic in shape,
comprising a ribonucleoprotein core surrounded by a host cell-derived
lipid membrane; the nucleocapsid core forms a helical structure
composed of the 15,384-nucleotide (nt) nonsegmented negative-sense RNA
genome closely associated with virus nucleocapsid protein (NP). The
genetic organization of the MUV genome has been determined to be
3'-NP-P-M (matrix)-F-SH (small hydrophobic)-HN-L-5' (10).
Each gene encodes a single protein except for the P cistron, from which
three unique mRNAs are transcribed. One is a faithful copy of the P
gene, encoding the V protein. The two other mRNAs contain two and four
nontemplated G residues inserted during transcription by a RNA editing
mechanism; they encode the P and I proteins, respectively
(26). The role of the V and I proteins in virus growth is
not yet clear, but there is evidence that V is a structural protein and
is associated with virus nucleocapsid (27). It is believed
that the P and L proteins in association with nucleocapsid form the
functional RNA polymerase complex of MUV. F and HN, integral membrane
proteins which project from the surface of the virion, are involved in virus attachment and entry of cells. The SH and M proteins are also
membrane associated (18, 38).
The MUV replicative cycle initiates with release of virus
nucleocapsid into the host cell cytoplasm, brought about by fusion of
virus envelope with host cell plasma membrane. Primary
transcription ensues, resulting in the production of all virus
proteins; a switch to replication of the virus genome occurs
later followed by assembly of virus components to form new virus
particles which bud from the host cell plasma membrane. Only the intact
nucleocapsid structure can act as template for RNA transcription,
replication, and subsequent virus amplification; therein lies the
difficulty in genetic manipulation of MUV and other negative-strand RNA
viruses. Unlike the positive-strand RNA viruses, where naked genomic
RNA is infectious and infectious virus can be recovered from a cDNA
copy of the genome in the absence of additional viral factors (31,
39), the naked genome of nonsegmented negative-strand RNA viruses
is not infectious, and rescue of virus from cDNA requires at least
intracellular coexpression of viral NP, P, and L proteins, along with a
full-length positive-sense genome RNA transcript, all under control of
a bacteriophage T7 RNA polymerase promoter (2, 3, 6, 9, 14, 15,
16, 19, 29, 32, 33, 40). In all of the rescue systems described so far for the nonsegmented RNA viruses, T7 RNA polymerase was supplied
either by a coinfecting recombinant vaccinia virus (12, 41)
or by endogenous expression in a transformed cell line (32). Recently influenza virus, whose genome comprises eight separate negative-sense RNA segments, was rescued from cDNA; where
essential virus proteins and genomic RNAs were coexpressed
intracellularly under control of either cellular RNA polymerase
promoters (23) or a combination of the human RNA polymerase
I promoter and the adenovirus type 2 major late promoter
(11). The ability to rescue negative-strand RNA viruses from
cDNA has provided an entirely new approach for the study of virus
growth and may provide the basis for a range of novel virus expression
vectors which may be used for the prevention and treatment of disease.
Here we report the recovery of infectious MUV from a cloned cDNA of the
virus genome.
 |
MATERIALS AND METHODS |
Cells and viruses.
Primary chick embryo fibroblast (CEF)
cells were obtained from SPAFAS Inc. (Preston, Conn.) and cultured in
Eagle's basal medium supplemented with 5% fetal calf serum. HEp-2,
293, A549, and Vero cells were obtained from the American Type Culture
Collection (Manassas, Va.) and grown in Dulbecco's modified Eagle
medium supplemented with 10% fetal calf serum. The Jeryl Lynn strain of mumps virus was obtained directly from a vial of Mumpsvax (Merck and
Co., Inc., Westpoint, Pa.). Recombinant vaccinia virus Ankara (MVA-T7),
expressing bacteriophage T7 RNA polymerase, was obtained from B. Moss
(National Institutes of Health, Bethesda, Md.).
Construction of expression plasmids for MUV NP, P, and L
proteins.
Expression plasmids for the MUV NP, P, and L proteins
(pMUVNP, pMUVP, and pMUVL) were constructed by positioning cDNA for each open reading frame (ORF) between the T7 RNA polymerase promoter and the T7 RNA polymerase transcription termination sequence of a
plasmid vector which contained the cap-independent translation enhancer
of encephalomyocarditis virus. The primers used for reverse transcription (RT)-PCR amplification of the MUV NP protein ORF, from
total MUV infected-cell (CEF) RNA, were
5'ATCATTCGTCTCCCATGTTGTCTGTGCTCAAAGC and
5'ATCATTCTCGAGTTGCGATTGGGGTTAGTTTG; the resulting
cDNA fragment was gel purified, trimmed with BsmBI and
XhoI (endonuclease sites are indicated in boldface), and
then cloned into NcoI/XhoI-cut pEMC, such that
the AUG of the NP protein ORF was adjacent to the cap-independent
translation enhancer. Primers for amplification of the MUV P ORF were
5'TTCCGGGCAAGCCATGGATC and
5'ATCATTCTCGAGAGGGAATCATTGTGGCTCTC. The P ORF
cDNA was also cloned into the NcoI/XhoI sites of
pEMC and subsequently modified by site-directed mutagenesis to include the two G nucleotides not present in the virus genome (26). Because of its large size, the L protein ORF was assembled in two
steps. Primers 5'ATCATTCGTCTCCCATGGCGGGCCTAAATGAGATACTC and 5'CTTCGTTCATCTGTTTTGGATCCG were used in
the first step to produce a cDNA fragment which was trimmed with
BsmBI and BamHI and then cloned into the
NcoI/BamHI sites of pEMC. In the second step,
primers 5'CAGAGTACCTTATATCGGATCC and
5'ATCATTCTGCAGGAATTTGGATGTTAGTTCGGCAC were used
to amplify a cDNA fragment which was cloned into the BamHI/PstI sites of the plasmid from step 1 above, to complete the L protein ORF. Four cDNA clones for each of the
three ORFs were sequenced, and the ORF with the highest level of
homology to the Jeryl Lynn consensus nucleotide/amino acid sequence was chosen in each case for use in rescue experiments.
Construction of a synthetic MUV minireplicon.
A synthetic
MUV minireplicon (MUVCAT) was assembled from cDNA representing a
modified MUV genome, where all coding and intercistronic regions were
replaced by the bacterial chloramphenicol acetyltransferase (CAT) ORF;
cDNA for the MUV 3' 145-nt and 5' 161-nt ends was amplified by RT-PCR
from total infected-cell (CEF) RNA, using primer pairs 5'ACCAAGGGGAGAATGAATATGGG-5'ATCATTCGTCTCTTTTCCAGGTAGTGTCAAAATGCC and
5'ACCAAGGG GAGAAAGTAAAATC-5'ATCATTCGTCTCTATCGAATAAAGACTCTTC TGGC,
respectively. In a second round of PCR amplification, nested primers were used for addition of the T7 RNA polymerase promoter and
the NarI-containing portion of the hepatitis delta virus
(HDV) ribozyme sequence to the MUV 5' and 3' ends, respectively; these primer pairs were
5'AAGCTCGGCGGCCG CTTGTAATACGACTCACTATAACCAAGGGGAGAAAGTAAAATC-5'ATCATTC GTCTCTATCGAATAAAGACTCTTCTGGC
for addition of the T7 RNA polymerase promoter (which is shown in
smaller print) and
5'ATCATTGGCGCCAG CGAGGAGGCTGGGACCATGCCGGCCACCAAGGGGAGAATGAATATGGG-5'AT CATTCGTCTCTTTTCCAGGTAGTGTCAAAATGCC for addition of the ribozyme component, which is shown in smaller print (30). The CAT ORF cDNA was amplified using primers
5'ATCATTCGTCTCGGAAAATGGAGAAAAAAATCACTGGATATACC and 5'ATCATTCGTCTCTCGATTTACGCCCCGCCCTGCCACTC.
All three cDNA components were gel purified, trimmed with
BsmBI, joined together in a four-way ligation, and cloned
into the NotI/NarI sites of modified pBluescript
KS(+) (35) to produce the complete minireplicon plasmid,
pMUVCAT (Fig. 1).

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 1.
Diagram (not to scale) showing the organization of the
MUVCAT minireplicon DNA construct and T7 RNA polymerase-transcribed
minireplicon antisense RNA genome. Key restriction endonuclease sites
used in the assembly of the DNA construct are shown. The T7 RNA
polymerase promoter sequence was designed to start transcription with
the exact MUV 5'-terminal nucleotide, and an HDV ribozyme (Rib.)
sequence was positioned to generate the precise MUV 3'-terminal
nucleotide in minireplicon RNA transcripts. Duplicate T7 RNA polymerase
termination signals were included after the HDV ribozyme sequence. The
CAT ORF replaces all of the coding and intercistronic sequence of the
MUV genome; the remaining essential MUV-specific sequence comprises the
3' MUV leader (55 nt) with adjacent 90-nt NP gene untranslated region
(UTR) and the 5' MUV trailer (24 nt) adjacent to the 137-nt L gene
untranslated region.
|
|
Construction of a full-length genome cDNA for MUV.
To enrich
for a clonal population of virus for the construction of a full-length
cDNA clone of the Jeryl Lynn strain of MUV, a well-isolated virus
plaque from the vaccine preparation was picked and used to prepare
working stocks of virus. The full-length genome cDNA (pMUVFL) was
assembled 5' end to 3' end (negative-sense genome) by the successive
cloning of contiguous cDNA fragments into the same plasmid backbone
that was used for the construction of pMUVCAT (Fig.
2). Each cDNA fragment was amplified from
total infected-cell RNA by RT-PCR using primer pairs which contained unique restriction sites; in each case the positive sense primer contained a 5'-proximal NotI site in addition to the
virus-specific endonuclease site, to facilitate the stepwise cloning
strategy. Prior to addition to the growing full-length clone, the cDNA
fragment spanning the virus 3' end to the BssHII site was
assembled separately in pBluescript II SK(+) (Stratagene, La Jolla,
Calif.); in the first step, the BssHII/ClaI cDNA
fragment was cloned into the ClaI/XhoI sites of
pBluescript II SK(+), using a 5'-extended primer to generate an
XhoI site adjacent to the virus-specific BssHII site. In the second step, the virus 3' end-to-ClaI cDNA
fragment was cloned into the NotI/ClaI sites of
plasmid from the first step to complete the virus
3'-end-to-BssHII sequence. The T7 RNA polymerase promoter
sequence was added to the virus 3' end by incorporation into the
plus-sense RT-PCR primer used to generate the virus
3'-end-ClaI fragment. The 5'-terminal fragment
(BamHI/NarI) of the genome cDNA was separately
modified in a second round of PCR amplification to add the virus 5' end
to NarI-containing portion of the HDV ribozyme sequence. A
total of four cloning cycles were required for assembly of pMUVFL;
after each round, four clones were sequenced in the region of newly
added cDNA and compared to the MUV consensus sequence. The cDNA clone
containing the least number of mutations was then selected for addition
of the next cDNA fragment. The fully assembled cDNA clone was
resequenced to verify stability during bacterial amplification.
Electrocompetent SURE cells (Stratagene) and DH5-alpha cells (GibcoBRL,
Rockville, Md.) were used as bacterial hosts for cloning of MUV cDNA.

View larger version (7K):
[in this window]
[in a new window]
|
FIG. 2.
Schematic representation (not to scale) of the MUV
full-length genome cDNA construct showing the genetic organization of
the MUV genome including the nontranscribed leader (Le) and trailer
(Tr) and the proteins expressed from each gene. The subgenomic cDNA
fragments and restriction endonuclease sites used in the assembly
process are delineated by the horizontal solid lines and the vertical
dotted lines, respectively. The T7 RNA polymerase promoter (T7-P) and
the HDV ribozyme (Rib) sequence were positioned to initiate
transcription with the exact 5'-terminal nucleotide and generate the
precise 3'-terminal nucleotide of the MUV antisense genome,
respectively. Tandem T7 RNA polymerase termination sequences were
placed adjacent to the HDV ribozyme.
|
|
Rescue of CAT activity from transfected cells.
For
rescue of CAT activity, cells were either infected with MUV and
transfected with in vitro-transcribed MUVCAT minireplicon RNA or
infected with MVA-T7 and transfected with pMUVCAT along with
expression plasmids pMUVNP, pMUVP, and pMUVL. In vitro
transcriptions were carried out with 4 µg of pMUVCAT as template
for T7 RNA polymerase in a 20-µl final volume as specified by the
manufacturer (Promega, Madison, Wis.); template DNA was then destroyed
by digestion with RQ-1 DNase for 15 min at 37°C. Overnight cultures
of 293 cells grown to ~80% confluence in six-well dishes were
infected with MUV at a multiplicity of infection (MOI) of 1 to 2; at
1 h postinfection (hpi), a mixture containing 5 to 10 µl of in
vitro transcription reaction (approximately 5 to 10 µg of RNA) and 10 to 12 µl of LipofectACE (GibcoBRL) was added to each well according
to the supplier's protocol. At 48 hpi, cells were scraped into
suspension, collected by centrifugation, resuspended in 100 µl of
0.25 M Tris buffer (pH 7.8), and subjected to three rounds of
freeze-thaw. The clarified cell extracts were then assayed for CAT
activity using either C-14-labeled chloramphenicol or
fluorescein-labeled chloramphenicol (Molecular Probes, Eugene, Oreg.),
followed by analysis of reaction products by thin-layer chromatography.
For rescue of CAT activity in the absence of MUV helper virus, 293, HEp-2, and A549 cells were grown overnight in six-well
dishes to
~80% confluence, infected with MVA-T7 at an MOI of 10,
and
transfected 1 hpi with a mixture containing 200 ng of pMUVCAT,
300 ng of pMUVNP, 50 ng of pMUVP, 200 ng of pMUVL, and 10 to 12
µl of LipofectACE. At 24 hpi, the transfection mixture was replaced
with 2 ml of fresh growth medium and cells were incubated for
a further 24 h, followed by preparation of cell
extracts and CAT
assay as described
above.
Recovery of infectious MUV from transfected cells.
For
rescue of infectious MUV from cDNA, A549 cells grown overnight to
~90% confluence in six-well dishes were infected with MVA-T7 at an
MOI of 4; at 1 hpi, cells were transfected with a mixture containing 3 to 7 µg of pMUVFL, 300 ng of pMUVNP, 50 ng of pMUVP, 200 ng of pMUVL, and 14 µl of LipofectACE. At 24 hpi, the
transfection mixture was replaced with growth medium (Dulbecco's modified Eagle medium containing 10% fetal calf serum), and cells were
incubated at 37°C for a further 48 h; either supernatants (P1)
or total transfected cell monolayers scraped into suspension were then
transferred directly onto confluent A549 cell monolayers, which were
incubated at 37°C for 4 days and then prepared for whole-cell
enzyme-linked immunosorbent assay (ELISA) (see below) in order to
detect MUV infectious foci. Supernatants (P2) from the A549 indicator
cells were further passaged onto confluent Vero cell monolayers and
incubated at 37°C for 3 to 4 days to observe MUV-induced syncytia.
Identification and authentication of rMUV.
Initial
identification of rescued MUV (rMUV) was carried out using a whole-cell
ELISA; A549 cells infected with P1 transfection supernatants (see
above) were fixed with 10% formaldehyde in 1× phosphate-buffered
saline (PBS) for 30 min at room temperature; cells were then rinsed
once with PBS and once with blocking solution (5% [wt/vol] dried
milk in 1× PBS), followed by incubation overnight at 4°C in blocking
solution. The overnight blocking solution was then removed, and cells
were incubated at room temperature for 2 to 3 h with MUV
polyclonal rabbit antiserum (Access Biomedical, San Diego, Calif.)
diluted 1/400 in fresh blocking solution. The polyclonal antiserum was
then removed; cells were rinsed five times with blocking solution and
then incubated at room temperature for 2 to 3 h with horseradish
peroxidase-conjugated goat anti-rabbit serum (DAKO Corporation,
Carpinteria, Calif.) diluted 1/1,000 in blocking solution. The goat
serum was then removed; cells were washed five times with blocking
solution and once with PBS, followed by addition of enough
3-amino-9-ethylcarbazole substrate (DAKO) to cover cell monolayers,
which were then incubated at 37°C for 15 to 20 min to facilitate
stain development.
Nucleotide tags present only in pMUVFL (not present in any
laboratory-grown Jeryl Lynn MUV) were verified in rMUV by sequence
analysis of cDNA fragments amplified by RT-PCR from Vero cells
infected
with P2 rMUV. RNA was prepared from infected cells in
a six-well dish
by extraction with Trizol (GibcoBRL) according
to the manufacturer's
protocol; one-fifth of the total RNA from
each well was used as the
template for RT-PCR amplification across
each of three nucleotide tags
according to directions for the
Titan kit (Boehringer Mannheim,
Indianapolis, Ind.). The resulting
RT-PCR fragments were purified from
a 1% agarose gel by electroelution
and sequenced using an ABI 377 sequencer (Applied Biosystems,
Inc., Foster City, Calif.) according to
the manufacturer's
protocol.
Nucleotide sequence accession number.
The consensus
nucleotide sequence for the complete genome of the Jeryl Lynn strain of
MUV and the amino acid sequences of the virus proteins encoded therein
have been submitted to Genbank (accession no. AF201473).
 |
RESULTS |
Rescue of reporter gene activity from transfected cells.
To
help define conditions which would permit the rescue of infectious MUV
from cDNA, an MUV minireplicon containing the CAT reporter gene was
assembled. The construct was designed to allow synthesis of a RNA
minigenome of negative polarity under control of the T7 RNA polymerase
promoter. The three terminal G residues of the T7 promoter were omitted
during construction of the minireplicon to provide a transcriptional
start site which began with the precise 5' nucleotide of the MUV
genome. Inclusion of the HDV ribozyme in the minireplicon construct
permitted cleavage of the T7 RNA polymerase transcript to produce the
authentic MUV specific 3' end (30). The total number of
nucleotides (966) in the MUVCAT minireplicon RNA was divisible by 6, in
agreement with the "rule of six" proposed for Sendai virus, where
it has been suggested that each NP molecule interacts with six
nucleotides along the RNA genome, and so genome lengths containing
multiples of six nucleotides would be more efficient in replication and
rescue (4, 22). Expression of the CAT gene was under control
of an MUV-specific promoter and could occur only if minireplicon RNA
became encapsidated with NP and that ribonucleocapsid
template then interacted with functional MUV-specific RNA
polymerase protein(s) to transcribe CAT mRNA.
Recovery of CAT activity was observed here using two different rescue
systems. In the first procedure, in vitro-transcribed
MUVCAT RNA was
transfected into 293 cells which had been previously
infected with MUV.
Under these conditions rescued CAT activity
was usually quite low, but
it was reproducible and always well
above background levels (Fig.
3A). Interestingly, CAT activity
could
not be rescued from a MUVCAT construct (pMUVCAT-GG) which
contained
two of the three additional G residues normally present
in the T7 RNA
polymerase promoter. However, two mutations (relative
to the Jeryl Lynn
consensus sequence) present in the MUV trailer
region of the same
MUVCAT construct prevent conclusive interpretation
of this observation.
Results from these experiments indicated
that nt 1 to 145 and 15223 to
15384 of the MUV genome contained
the necessary signals for genome
encapsidation, transcription,
and presumably replication. Having
defined a minireplicon sequence
which allowed rescue of CAT activity in
the presence of MUV-expressed
helper proteins, a second system was
designed to carry out rescue
of CAT activity from transfected DNA
without MUV helper. In this
system, MUV NP, P, and L proteins and
MUVCAT minireplicon RNA
transcripts, under control of MVA-T7-induced T7
RNA polymerase,
were coexpressed from transfected plasmids in 293, HEp-2, and
A549 cells. Initial experiments carried out with 293 cells
indicated
that CAT rescue was relatively efficient and highly
reproducible.
CAT rescue was more efficient in HEp-2 cells than in 293 cells,
and we performed a series of plasmid titrations to optimize the
molar ratios of the required
trans-acting MUV proteins
expressed
within the transfected cells. The efficiency of CAT rescue
was
very sensitive to the relative amounts of pMUVP and pMUVL
in the
transfection mixtures (data not shown), while a broader peak of
rescued CAT activity was observed when pMUVNP was titrated in
transfection mixtures. A further increase in rescue efficiency
was
observed in A549 cells relative to HEp-2 cells, with almost
100%
conversion of substrate in a 3-h CAT assay, using 20% of
A549 cell
lysate from one well of a six-well dish (Fig.
3B). These
results
demonstrated that the MUV helper proteins expressed from
pMUVNP,
pMUVP, and pMUVL were sufficient to promote encapsidation,
transcription, and presumably replication of MUVCAT antisense
RNA
minigenomes. Furthermore, the optimal conditions observed
for CAT
rescue in A549 cells provided a guideline for the rescue
of infectious
MUV entirely from cDNA.

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 3.
(A) Thin-layer chromatograms showing CAT activity in 293 cells following infection with MUV and transfection with RNA
transcribed in vitro from pMUVCAT. Panels A1, A2, and A3 show the
results from three separate rescue experiments. (A1) Lane 1, CAT
activity in MUV-infected cells transfected without in vitro-transcribed
pMUVCAT RNA; lane 2, CAT activity in extracts of MUV-infected cells
transfected with RNA transcribed in vitro from pMUVCAT; lane 3, CAT
activity in MUV-infected cells transfected with RNA transcribed in
vitro from pMUVCAT-GG; lane 4, CAT activity in uninfected cells
transfected with RNA transcribed in vitro from pMUVCAT. Each CAT
assay was carried out at 37°C for 3 to 4 h with 20% of the
extract from ~106 transfected cells. (A2) Lane 1, MUV-infected cells transfected with RNA transcribed in vitro from
pMUVCAT; lane 2, uninfected cells transfected with RNA transcribed
in vitro from pMUVCAT. Each CAT assay was carried out at 37°C for
5 h using 50% of the extract from ~106 transfected
cells. (A3) Lane 1, MUV-infected cells transfected with RNA transcribed
in vitro from pMUVCAT; lane 2, MUV-infected cells transfected
without in vitro-transcribed pMUVCAT RNA; lane 3, uninfected cells
transfected with in vitro-transcribed RNA from pMUVCAT. Each CAT
assay shown in panel A3 was carried out at 37°C for 4 h using
50% of the extract from ~106 transfected cells. (B)
Thin-layer chromatograms showing CAT activity in extracts of
MVA-T7-infected HEp-2 and A549 cells following transfection with
pMUVCAT and plasmids expressing MUV NP, P, and L proteins. The
level of pMUVNP expression plasmid was titrated in both cell lines.
Lanes 1 to 4, CAT activity following transfection with mixtures
containing 200 ng of pMUVCAT, 50 ng of pMUVP, and 200 ng of
pMUVL each, and 300, 450, 600, and 750 ng of pMUVNP,
respectively; lane 5, CAT activity produced when pMUVL was omitted
from the transfection mixture. Each CAT assay was performed at 37°C
for 3 h using 20% of the cell extract from each well of
transfected cells (~106 cells/well of a six-well dish).
|
|
Recovery of MUV from transfected cells.
In line with the
strategy first used by Schnell et al. (33) for the rescue of
rabies virus, the full-length MUV cDNA was assembled to permit the
synthesis of a precise 15,384-nt positive-sense RNA copy of the virus
genome under control of the T7 RNA polymerase promoter, precluding
intracellular annealing with mRNA transcribed from NP, P, and L
expression plasmids during rescue experiments. As for the MUVCAT
minireplicon, the T7 RNA polymerase promoter sequence was modified to
omit the three terminal G residues, providing a transcriptional start
site beginning at the exact MUV 5'-terminal nucleotide. The HDV
ribozyme was used to generate the exact MUV 3'-terminal nucleotide of
the positive-sense genome transcripts.
To recover MUV from cDNA, A549 cells were infected with MVA-T7, which
expresses T7 RNA polymerase, and then transfected with
pMUVFL and
plasmids expressing the MUV NP, P, and L proteins.
Results for rescue
of reporter gene activity from the MUVCAT minireplicon
(described
above) along with results from similar work on the
related
rubulavirus SV5 (
14,
22) indicated that the MUV NP,
P,
and L proteins would be sufficient to encapsidate and replicate
the T7 RNA polymerase-generated positive-sense genome RNA transcripts,
provided that all the interacting components were present at the
correct levels and ratios. A549 cells were chosen for MUV rescue
experiments because they supported more efficient CAT rescue activity
than other cell lines tested, and they were more resistant to
MVA-T7-induced cytopathology. Following each rescue attempt,
transfected
cell cultures were assayed for the presence of MUV on A549
indicator
cells. In the first successful rescue experiment, three
infectious
foci were observed by whole-cell ELISA in one out of six
wells
of a six-well plate containing A549 indicator cells (data not
shown). Following passage of supernatant from the positive well
onto a
fresh Vero cell monolayer, syncytia were observed under
the microscope
(Fig.
4A). One of these syncytia was
aspirated
into medium as a liquid plaque-pick and used to infect fresh
Vero
cells; numerous syncytia, which were indistinguishable from those
induced by Jeryl Lynn virus, then were observed on this cell monolayer
(Fig.
4B), and total infected-cell RNA was prepared for identification
of rescued virus. Analysis of the transfection conditions which
gave
rise to the rescue event(s) indicated that the amount of
pMUVFL
used (5 µg) was important since wells transfected with
1 µg or less
of pMUVFL did not yield any measurable virus. In
a second rescue
experiment, where the amount of pMUVFL (3 to 7
µg) in the
transfection mixture had been optimized, at least 10
to 20 infectious
foci were obtained from the supernatant of each
of five separate
transfections, as seen on A549 indicator cells
stained by whole-cell
ELISA. In this experiment all transfections
yielded rescued virus,
indicating that the rescue process was
very reproducible. Only omission
of pMUVL from the transfection
mixture precluded virus recovery.
The optimum level of each plasmid
determined for the rescue of MUV from
cDNA is 300 ng of pMUVNP,
50 ng of pMUVP, 200 ng of pMUVL,
and 3 to 7 µg of pMUVFL.

View larger version (199K):
[in this window]
[in a new window]
|
FIG. 4.
(A) Photographs showing rMUV-induced syncytia on Vero
cell monolayers. Supernatants from MVA-T7-infected A549 cells
transfected with pMUVFL, pMUVNP, pMUVP, and pMUVL were
passaged onto A549 cells, incubated at 37°C for 4 days, then
transferred onto Vero cell monolayers, and incubated for 3 more days at
37°C prior to photography (A1). (A2) Representative portion of Vero
cell monolayer following transfer of supernatant from transfected A549
cells as described for panel A1 except that pMUVL was omitted from
the transfection mixture; (A3) syncytia produced on Vero cells
following infection with Jeryl Lynn vaccine virus. (B) Photographs
showing rMUV-induced plaques on Vero cell monolayers stained by
whole-cell ELISA. Supernatant from transfected cells was passed onto
A549 indicator cells and incubated for 3 days at 37°C; supernatant
from these cells was then passed onto Vero cell monolayers. One of the
resulting syncytia was picked and used to infect fresh Vero cell
monolayers. Virus-induced plaques were then stained by whole-cell ELISA
4 days postinfection (B1) and compared to plaques induced by Jeryl Lynn
vaccine virus (B3). Panel B2 shows Vero cells infected with cell
supernatants as for cells in panel B1 except that the L expression
plasmid was omitted from the starting transfection mixture.
|
|
Identification of rMUV.
It was important to demonstrate that
rMUV was derived from cDNA (pMUVFL). This was made possible by the
presence of three nucleotide tags in pMUVFL, introduced by RT-PCR
misincorporation during assembly of the full-length genome cDNA. These
tags differentiated pMUVFL from the consensus sequence of the Jeryl
Lynn vaccine virus and from that of a passaged plaque isolate of the
Jeryl Lynn vaccine preparation from which pMUVFL was derived. Two
of the tags represented silent changes at nt 6081 (T to C) and
11731 (A to G) in the F and L genes, respectively; a third tag (nt
8502, A to G) resulted in a Lys-to-Arg substitution at amino acid 22 of
the L protein of pMUVFL. To show that rMUV was generated from
pMUVFL and not from either of the other two MUV populations grown
in the laboratory, RT-PCR products prepared from rMUV-infected-cell
RNA, spanning each of the three nucleotide tags, were sequenced at the
relevant position(s). To demonstrate that carryover of transfecting
plasmid DNA was not contributing significantly to these RT-PCR
products, one reaction was carried out with rMUV-infected-cell RNA as
the template for PCR amplification without prior RT. Results from the
RT-PCR amplifications (Fig. 5), and
subsequent sequence analysis of RT-PCR products (Fig.
6), clearly demonstrated that the rescued virus was derived from pMUVFL. Interestingly, the Lys-to-Arg
mutation at position 22 of the L protein of rMUV did not prevent rescue from occurring even though an alignment of L proteins indicates that
Lys is highly conserved at the same relative position among members of
the Paramyxovirinae.

View larger version (73K):
[in this window]
[in a new window]
|
FIG. 5.
Gel analysis of RT-PCR products used to identify rMUV.
Total RNA was prepared from Vero cell monolayers infected with P2 rMUV
virus from transfected cells. RT-PCRs were set up to generate cDNA
products spanning the three separate nucleotide tag sites present only
in pMUVFL and rMUV. Lane 1, marker 1-kb ladder (Gibco/BRL); lanes 2 to 4, RT-PCR products spanning nucleotide tag positions 6081, 8502, and
11731, respectively. To demonstrate the absence of contaminating
plasmid DNA, a reaction identical to that used for generation of the
cDNA shown in lane 4 was performed without RT; the product(s) of this
reaction is shown in lane 5. To demonstrate that no rMUV could be
recovered when pMUVL was omitted from transfection mixtures, RT-PCR
identical to that used to generate the cDNA products shown in lane 4 was set up using Vero cell RNA derived from transfections carried out
without pMUVL; products from this reaction are shown in lane 6.
|
|

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 6.
Electropherograms showing nucleotide sequence across
identifying tag sites in rMUV. RT-PCR products (Fig. 5) were sequenced
across each of the three tag sites. The nucleotide sequence at each tag
site obtained for rMUV is compared with consensus sequence for the
plaque isolate of MUV used to derive pMUVFL.
|
|
 |
DISCUSSION |
Infectious MUV has been generated from a DNA copy of the virus
genome following cotransfection of MVA-T7-infected A549 cells with
plasmids encoding MUV NP, P, and L proteins, along with a plasmid
containing the complete genome cDNA of MUV. The success of this process
necessarily was preceded by the development of a consensus sequence for
the entire MUV genome (Jeryl Lynn strain) and the development of an MUV
minireplicon rescue system, which had not been previously reported.
Prior work had shown that the Jeryl Lynn vaccine strain contained a
mixture of two distinct virus populations (1). Therefore, to
minimize the potential for suboptimal protein-protein interactions (by
splicing together cDNA fragments derived from the different virus
populations into the genome cDNA) during the rescue process, a
well-isolated plaque from the Jeryl Lynn vaccine preparation was
selected and amplified for the derivation of the full-length genome
cDNA and the NP, P, and L expression plasmids.
To find conditions suitable for the rescue of infectious virus from a
genome cDNA, a synthetic MUV minireplicon similar to those
described for influenza virus and members of the
Paramyxoviridae and Rhabdoviridae was assembled
so as to contain the CAT reporter gene (5, 7, 8, 20, 24, 28,
35). Initially CAT activity was rescued by transfection of
MUV-infected 293 cells with RNA transcribed from this construct in
vitro. These results demonstrated that the minireplicon genome
contained all MUV-specific cis-acting sequences (nt 1 to 145 for the 3' leader region; nt 15223 to 15384 for the 5' trailer
region) necessary for encapsidation, transcription, and
presumably replication of the minireplicon, and they define a
basic rescue system by which these important regulatory sequences can
be further dissected. Interestingly, CAT rescue was not
detected when MUV-infected 293 cells were transfected with RNA
transcribed from a minireplicon construct which contained two
additional G residues at the 3'-proximal end of the T7 RNA polymerase
promoter; it is possible that the additional one or two G residues
present at the 5' end of the resulting negative-sense minireplicon RNA
transcript violated the rule of six proposed for members of the
Paramyxovirinae (4).
MUV minireplicon CAT rescue was then achieved in MVA-T7-infected
293, HEp-2, and A549 cells transfected with pMUVCAT and
plasmids expressing MUV NP, P, and L proteins in the absence of MUV
helper virus. This demonstrated that the expressed NP, P, and L
proteins were sufficient to substitute for helper virus in CAT rescue
experiments, thus indicating a role for these proteins in genome
encapsidation and RNA polymerase activity. The ratio of expression
plasmids was optimized in the minireplicon rescue system for later use in the effort to rescue full-length infectious MUV. It was notable that
the P expression plasmid was required at approximately one-sixth the
molar ratio of the NP plasmid. This observation was in line with
optimum plasmid ratios required for the rescue of another rubulavirus,
SV5 (14), and mirrors the anticipated lower level of the P
protein mRNA transcribed in infected cells, which is a result of
the RNA editing mechanism that occurs during transcription of the P
gene (26). Initially plasmid-based rescue of CAT activity was carried out in 293 cells; however, these cells were very
susceptible to MVA-T7-induced cytopathology and did not support
vigorous MUV growth. Although HEp-2 cells showed increased efficiency
and reproducibility of CAT rescue relative to 293 cells, further
improvements in CAT rescue efficiency were made in A549 cells which had
been used successfully for the rescue of SV5 (14). This cell
line appeared to be more resistant to MVA-T7-induced cytopathology than
HEp-2 cells, was readily transfectable, and did indeed support MUV
growth. For these reasons, A549 cells were selected for attempts to
rescue infectious MUV from cDNA.
Rescue of other nonsegmented negative-strand RNA viruses succeeded only
when Conzelmann and Schnell (7) and Lawson et al. (19) recognized that intermolecular annealing of N, P, and L mRNA transcripts with full-length negative-sense genome RNA
transcripts in transfected cells might greatly constrain nucleocapsid
formation, which is a prerequisite for rescue of infectious virus.
Virus rescue was achieved when they altered the design of plasmids
containing full-length virus genome cDNA such that a RNA transcript of
antigenome polarity would be produced in transfected cells. Similarly,
to prevent intermolecular annealing of RNA transcripts from the MUV NP,
P, and L expression plasmids with the full-length MUV genome RNA
transcript, the T7 RNA polymerase promoter was positioned to generate a
positive-sense RNA copy of the virus genome. Like the MUVCAT
minireplicon, the full-length construct was modified to allow synthesis
of a genome transcript beginning with the exact MUV 5'-terminal
nucleotide and ending with the exact MUV 3'-terminal nucleotide. The
conditions used for rescue of infectious MUV from A549 cells were
similar to those optimized for the MUVCAT minireplicon; however, it was
not clear how much full-length genome cDNA should be used in rescue
experiments, since the large size of the genome cDNA plasmid could
affect efficiency of uptake during transfection, preventing direct
correlation with levels of the much smaller MUVCAT plasmid DNA used in
CAT rescue experiments. A titration of transfection components showed
that rescue of infectious MUV was very reproducible when 3 to 7 µg of
the genome cDNA plasmid was present with the NP, P, and L expression
plasmids in transfection mixtures. The number of infectious particles
released during rescue experiments was not precisely measured; however,
the number of infectious foci observed by whole-cell ELISA on A549
indicator cells ranged from 3 to 20 for each well of transfected cells. It is possible that further improvements in the efficiency of infectious MUV rescue can be made by adjusting the MOI of MVA-T7 on
A549 cells and by using the process of heat shock described recently
for the rescue of measles virus from cDNA (25). One possible
impediment to rescue, a Lys-to-Arg substitution at amino acid 22 of the
L protein in the full-length construct, was not realized even though
Lys is highly conserved at the same relative position in other members
of the Paramyxovirinae. It would be interesting to see if
that position reverts to Lys on continued passage and what effect the
mutation has on the relative fitness of rescued virus.
Now that MUV can be rescued from cDNA, it may be possible to engineer
the virus genome of express foreign genes, as described for a number of
other negative-sense RNA viruses (13, 14, 16, 21, 34, 36).
The ability to do this may provide an ideal means to deliver
prophylactic and therapeutic agents for the prevention and treatment of
diseases other than mumps. Some properties of the Jeryl Lynn vaccine
strain which should facilitate its acceptance as an expression vector
in humans include a highly favorable attenuation phenotype, an apparent
absence of recombination, an impressive safety record for the >100
million doses administered, and the ability to induce long-lasting
immunity with a single inoculation.
 |
ACKNOWLEDGMENTS |
We thank Becky Nowak for the design of oligonucleotides used to
sequence the full-length MUV genome. Thanks go to Bob Lerch and Jean
Adamus for guidance with the automated sequencer. Thanks go also to
Pramila Walpita for input on the choice of cell line used for rescue of
MUV. We are grateful to Chris Parks for useful discussion on factors
affecting transfection efficiency.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: 401 N. Middletown Rd., Bldg. 180, Pearl River, NY 10965. Phone: (914)
732-3465. Fax: (914) 732-4941. E-mail:
clarked3{at}war.wyeth.com.
 |
REFERENCES |
| 1.
|
Afzal, M. A.,
A. R. Pickford,
T. Forsey,
A. B. Heath, and P. D. Minor.
1993.
The Jeryl Lynn vaccine strain of mumps virus is a mixture of two distinct isolates.
J. Gen. Virol.
74:917-920[Abstract/Free Full Text].
|
| 2.
|
Baron, M. D., and T. Barrett.
1997.
Rescue of rinderpest virus from cloned cDNA.
J. Virol.
71:1265-1271[Abstract].
|
| 3.
|
Bucholz, U. J.,
S. Finke, and K.-K. Conzelmann.
1999.
Generation of bovine respiratory syncytial virus (BRSV) from cDNA: BRSV NS2 is not essential for virus replication in tissue culture, and the human RSV leader region acts as a functional BRSV genome promoter.
J. Virol.
73:251-259[Abstract/Free Full Text].
|
| 4.
|
Calain, P., and L. Roux.
1993.
The rule of six, a basic feature for efficient replication of Sendai virus defective interfering RNA.
J. Virol.
67:4822-4830[Abstract/Free Full Text].
|
| 5.
|
Collins, P. L.,
M. A. Mink, and D. S. Stec.
1991.
Rescue of synthetic analogs of respiratory syncytial virus genomic RNA and effect of truncations and mutations on the expression of a foreign reporter gene.
Proc. Natl. Acad. Sci. USA
88:9663-9667[Abstract/Free Full Text].
|
| 6.
|
Collins, P. L.,
M. G. Hill,
E. Camargo,
H. Grosfield,
R. M. Chanock, and B. R. Murphy.
1995.
Production of infectious human respiratory syncytial virus from cloned cDNA confirms an essential role for the transcription elongation factor from the 5' proximal open reading frame of the M2 mRNA in gene expression and provides a capability for vaccine development.
Proc. Natl. Acad. Sci. USA
92:11563-11567[Abstract/Free Full Text].
|
| 7.
|
Conzelmann, K.-K., and M. Schnell.
1994.
Rescue of synthetic genomic RNA analogs of rabies virus by plasmid-encoded proteins.
J. Virol.
68:713-719[Abstract/Free Full Text].
|
| 8.
|
De, B. P., and A. K. Banerjee.
1993.
Rescue of synthetic analogs of genome RNA of human parainfluenza virus type 3.
Virology
196:344-348[CrossRef][Medline].
|
| 9.
|
Durbin, A. P.,
S. L. Hall,
J. W. Siew,
S. S. Whitehead,
P. L. Collins, and B. R. Murphy.
1997.
Recovery of infectious human parainfluenza virus type 3 from cDNA.
Virology
235:323-332[CrossRef][Medline].
|
| 10.
|
Elango, N.,
T. Varsanyi,
J. Kovamees, and E. Norrby.
1988.
Molecular cloning and characterization of six genes, determination of gene order and intergenic sequences and leader sequence of mumps virus.
J. Gen. Virol.
69:2893-2900[Abstract/Free Full Text].
|
| 11.
|
Fodor, E.,
L. Devenish,
O. G. Engelhardt,
P. Palese,
G. G. Brownlee, and A. Garcia-Sastre.
1999.
Rescue of influenza A virus from recombinant DNA.
J. Virol.
73:9679-9682[Abstract/Free Full Text].
|
| 12.
|
Fuerst, T. R.,
E. G. Niles,
F. W. Studier, and B. Moss.
1986.
Eukaryotic transient expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase.
Proc. Natl. Acad. Sci. USA
83:8122-8126[Abstract/Free Full Text].
|
| 13.
|
Hasan, M. K.,
A. Kato,
T. Shioda,
Y. Sakai,
D. Yu, and Y. Nagai.
1997.
Creation of an infectious recombinant Sendai virus expressing the firefly luciferase gene from the 3' proximal first locus.
J. Gen. Virol.
78:2813-2820[Abstract].
|
| 14.
|
He, B.,
R. G. Paterson,
C. D. Ward, and R. A. Lamb.
1997.
Recovery of infectious SV5 from cloned DNA and expression of a foreign gene.
Virology
237:249-260[CrossRef][Medline].
|
| 15.
|
Hoffman, M. A., and A. K. Banerjee.
1997.
An infectious clone of human parainfluenza virus type 3.
J. Virol.
71:4272-4277[Abstract].
|
| 16.
|
Jin, H.,
D. Clarke,
H. Z.-Y. Zhou,
X. Cheng,
K. Coelingh,
M. Bryant, and S. Li.
1998.
Recombinant human respiratory syncytial virus (RSV) from cDNA and construction of subgroup A and B chimeric RSV.
Virology
251:206-214[CrossRef][Medline].
|
| 17.
|
Johnson, C. D., and E. W. Goodpasture.
1935.
The etiology of mumps.
Am. J. Hyg.
21:46-57.
|
| 18.
|
Lamb, R. A., and D. Kolakofsky.
1996.
Paramyxoviridae. The viruses and their replication, p. 1177-1204.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Virology, 3rd ed., vol. 1. Raven Press, New York, N.Y.
|
| 19.
|
Lawson, N.,
E. Stillman,
M. Whitt, and J. Rose.
1995.
Recombinant vesicular stomatitis viruses from DNA.
Proc. Natl. Acad. Sci. USA
92:4471-4481.
|
| 20.
|
Luytjes, W.,
M. Krystal,
M. Enami,
J. D. Parvin, and P. Palese.
1989.
Amplification, expression and packaging of a foreign gene by influenza virus.
Cell
58:1107-1113[CrossRef][Medline].
|
| 21.
|
Mebatsion, T.,
M. J. Schnell,
J. H. Cox,
S. Finke, and K.-K. Conzelmann.
1996.
Highly stable expression of a foreign gene from rabies virus vectors.
Proc. Natl. Acad. Sci. USA
93:7310-7314[Abstract/Free Full Text].
|
| 22.
|
Murphy, S. K., and G. D. Parks.
1997.
Genome nucleotide lengths that are divisible by six are not essential but enhance replication of defective interfering RNAs of the paramyxovirus simian virus 5.
Virology
232:145-157[CrossRef][Medline].
|
| 23.
|
Neumann, G.,
T. Watanabe,
H. Ito,
S. Watanabe,
H. Goto,
P. Gao,
M. Hughes,
D. R. Perez,
R. Donis,
E. Hoffmann,
G. Hobom, and Y. Kawaoka.
1999.
Generation of influenza A viruses entirely from cloned cDNAs.
Proc. Natl. Acad. Sci. USA
96:9345-9350[Abstract/Free Full Text].
|
| 24.
|
Park, K. H.,
T. Huang,
F. F. Correia, and M. Krystal.
1991.
Rescue of a foreign gene by Sendai virus.
Proc. Natl. Acad. Sci. USA
88:1-5[Abstract/Free Full Text].
|
| 25.
|
Parks, C. L.,
R. A. Lerch,
P. Walpita,
M. S. Sidhu, and S. A. Udem.
1999.
Enhanced measles virus cDNA rescue and gene expression after heat shock.
J. Virol.
73:3560-3566[Abstract/Free Full Text].
|
| 26.
|
Paterson, R. G., and R. A. Lamb.
1990.
RNA editing by G-nucleotide insertion in mumps virus P-gene mRNA transcripts.
J. Virol.
64:4137-4145[Abstract/Free Full Text].
|
| 27.
|
Paterson, R. G.,
G. P. Leser,
M. A. Shaughnessy, and R. A. Lamb.
1995.
The paramyxovirus SV5 V protein binds two atoms of zinc and is a structural component of virions.
Virology
208:121-131[CrossRef][Medline].
|
| 28.
|
Pattnaik, A. K.,
L. A. Ball,
A. W. LeGrone, and G. W. Wertz.
1992.
Infectious defective interfering particles of VSV from transcripts of a cDNA clone.
Cell
69:1011-1020[CrossRef][Medline].
|
| 29.
|
Peeters, B. P. H.,
O. S. deLeeuw,
G. Koch, and A. L. J. Gielkens.
1999.
Rescue of Newcastle disease virus from cloned cDNA: evidence that cleavability of the fusion protein is a major determinant for virulence.
J. Virol.
73:5001-5009[Abstract/Free Full Text].
|
| 30.
|
Perrotta, A. T., and M. D. Been.
1991.
A pseudoknot-like structure required for efficient self-cleavage of hepatitis delta virus RNA.
Nature
350:434-436[CrossRef][Medline].
|
| 31.
|
Racaniello, V. R., and D. Baltimore.
1981.
Cloned poliovirus complementary DNA is infectious in mammalian cells.
Science
214:916-918[Abstract/Free Full Text].
|
| 32.
|
Radecke, F.,
P. Spielhofer,
H. Schneider,
K. Kaelin,
M. Huber,
C. Dotsch,
G. Christiansen, and M. A. Billeter.
1995.
Rescue of measles virus from cloned DNA.
EMBO J.
14:5773-5784[Medline].
|
| 33.
|
Schnell, M. J.,
T. Mebatsion, and K.-K. Conzelmann.
1994.
Infectious rabies viruses from cloned cDNA.
EMBO J.
13:4195-4203[Medline].
|
| 34.
|
Schnell, M. J.,
L. Buonocore,
E. Kretzschmar,
E. Johnson, and J. K. Rose.
1996.
Foreign glycoproteins expressed from recombinant vesicular stomatitis viruses are incorporated efficiently into virus particles.
Proc. Natl. Acad. Sci. USA
93:11359-11365[Abstract/Free Full Text].
|
| 35.
|
Sidhu, M. S.,
J. Chan,
K. Kaelin,
P. Spielhofer,
F. Radecke,
H. Schreider,
M. Masurekar,
P. C. Dowling,
M. A. Billeter, and S. A. Udem.
1995.
Rescue of synthetic measles virus minireplicons: measles genomic termini direct efficient expression and propagation of a reporter gene.
Virology
208:800-807[CrossRef][Medline].
|
| 36.
|
Singh, M., and M. A. Billeter.
1999.
A recombinant measles virus expressing biologically active human interleukin-12.
J. Gen. Virol.
80:101-106[Abstract].
|
| 37.
|
Stillman, E. A.,
J. K. Rose, and M. A. Whitt.
1999.
Rescue of influenza A virus from recombinant DNA.
J. Virol.
73:9679-9682.
|
| 38.
|
Takeuchi, K.,
K. Tanabayashi,
M. Hishiyama, and A. Yamada.
1996.
The mumps virus SH protein is a membrane protein and not essential for virus growth.
Virology
225:156-162[CrossRef][Medline].
|
| 39.
|
Taniguchi, T.,
M. Palmieri, and C. Weissman.
1978.
Q DNA-containing hybrid plasmids giving rise to Q phage formation in the bacterial host.
Nature
274:2293-2298.
|
| 40.
|
Whelan, S. P.,
L. A. Ball,
J. N. Barr, and G. T. Wertz.
1995.
Efficient recovery of infectious vesicular stomatitis virus entirely from cDNA clones.
Proc. Natl. Acad. Sci. USA
92:8388-8392[Abstract/Free Full Text].
|
| 41.
|
Wyatt, L. S.,
B. Moss, and S. Rozenblatt.
1995.
Replication-deficient vaccinia virus encoding bacteriophage T7 RNA polymerase for transient gene expression in mammalian cells.
Virology
210:202-205[CrossRef][Medline].
|
Journal of Virology, May 2000, p. 4831-4838, Vol. 74, No. 10
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Puri, M., Lemon, K., Duprex, W. P., Rima, B. K., Horvath, C. M.
(2009). A Point Mutation, E95D, in the Mumps Virus V Protein Disengages STAT3 Targeting from STAT1 Targeting. J. Virol.
83: 6347-6356
[Abstract]
[Full Text]
-
Malik, T., Wolbert, C., Mauldin, J., Sauder, C., Carbone, K. M., Rubin, S. A.
(2007). Functional consequences of attenuating mutations in the haemagglutinin neuraminidase, fusion and polymerase proteins of a wild-type mumps virus strain. J. Gen. Virol.
88: 2533-2541
[Abstract]
[Full Text]
-
Chaudhry, Y., Skinner, M. A., Goodfellow, I. G.
(2007). Recovery of genetically defined murine norovirus in tissue culture by using a fowlpox virus expressing T7 RNA polymerase. J. Gen. Virol.
88: 2091-2100
[Abstract]
[Full Text]
-
Lemon, K., Rima, B. K., McQuaid, S., Allen, I. V., Duprex, W. P.
(2007). The F Gene of Rodent Brain-Adapted Mumps Virus Is a Major Determinant of Neurovirulence. J. Virol.
81: 8293-8302
[Abstract]
[Full Text]
-
Wilson, R. L., Fuentes, S. M., Wang, P., Taddeo, E. C., Klatt, A., Henderson, A. J., He, B.
(2006). Function of Small Hydrophobic Proteins of Paramyxovirus. J. Virol.
80: 1700-1709
[Abstract]
[Full Text]
-
Neumann, G., Whitt, M. A., Kawaoka, Y.
(2002). A decade after the generation of a negative-sense RNA virus from cloned cDNA - what have we learned?. J. Gen. Virol.
83: 2635-2662
[Abstract]
[Full Text]