Previous Article | Next Article ![]()
Journal of Virology, May 2000, p. 4755-4764, Vol. 74, No. 10
Department of Biochemistry and Molecular
Biophysics1 and Howard Hughes Medical
Institute,2 Columbia University College of
Physicians and Surgeons, New York, New York 10032
Received 10 November 1999/Accepted 17 February 2000
Experiments were performed to determine the function of a
28-nucleotide untranslated sequence lying between the envelope gene and
the polypurine tract (PPT) sequence in the Moloney murine leukemia
virus (Mo-MuLV) genome. A mutant virus carrying a deletion of this
sequence (Mo-MuLV Retroviruses convert their
single-stranded genomic RNA into a double-stranded DNA molecule in a
complex reaction mediated by the viral reverse transcriptase (RT) (for
a general review, see reference 41). The synthesis
of each DNA strand is initiated by a specific RNA primer: the minus
strand is initiated by a primer tRNA taken from the host, while the
plus strand is initiated by a polypurine oligonucleotide formed by the
RNase H activity of RT acting on the RNA genome. The site of priming of
both DNA strands must be accurate because these positions determine the
5' ends of the completed double-stranded viral DNA; these termini, in turn, are recognized by the viral integrase and serve as its substrate in the formation of the integrated provirus. Thus, mispriming would
lead to incorrect sequences at the termini of the viral DNA, resulting
in a block to DNA integration and further virus replication.
The site of initiation of the plus-strand DNA, the polypurine tract
(PPT), lies near the 3' end of the genomic RNA. The PPT elements of
different retroviruses and retroelements exhibit considerable sequence
variation but always include a stretch of 10 to 20 purines, often
flanked on the 5' side by a T-rich block (20, 32, 33). As
minus-strand DNA synthesis proceeds, the RNA genome enters into an
RNA:DNA hybrid, and so the RNA becomes susceptible to the RNase H
activity of RT. The PPT is relatively resistant to digestion,
persisting as an oligonucleotide that remains bound to the minus-strand
DNA, and is extended by RT to form plus-strand DNA. Elongation first
copies the U3, R, and U5 sequences of the minus strand to form an
intermediate called plus-strand strong-stop DNA, which is subsequently
translocated to the 3' end of the minus strand and extended to form the
complete plus strand. The 3'-proximal nucleotide of the PPT (nt A number of other functions are often contained in nearby sequences in
the 3' untranslated region (3' UTR) of retroviral RNAs. For example,
the genomes of the Mason-Pfizer monkey virus (4) and simian
retroviruses type 1 and 2 (43) each contain a constitutive transport element located near the 3' end of the RNA that is important for the export of the unspliced genomic RNA from the nucleus to the
cytoplasm. This element, probably forming a highly stable RNA
stem-loop, is recognized by a complex of cellular proteins that shuttle
in and out of the nucleus and mediate export of the RNA. Similar
elements may exist in other simple retroviruses, but none have yet been
identified in the avian or mammalian viruses. In another example, the
avian leukosis virus genomic RNA contains an element near the 3' end,
termed dr1, that plays a small role in nuclear RNA export but is most
important for the packaging of the RNA into the virion particle.
Mutations in the dr1 sequence impair virus replication and reduce RNA
packaging about 10-fold (2). Similar elements have not yet
been identified in the 3' UTR of other retroviruses.
To probe the functions of the 3' UTR of the Mo-MuLV RNA, we introduced
a deletion into the complete proviral DNA that removes all the
nucleotides between the translational stop codon of the envelope gene
and the PPT. Analysis of the mutant virus revealed no defects in RNA
transport or processing and no defects in packaging of the RNA into the
genome. The mutant showed a significant reduction in viral DNA
synthesis and formed abnormal circular DNAs. The structure of these
molecules suggests that the mutant generates plus-strand DNAs with
aberrant 5' termini. These results extend recent findings that
mutations in the region immediately upstream of the PPT in simian
immunodeficiency virus (20), Mo-MuLV (33), and
the pararetrovirus cauliflower mosaic virus (26) cause a reduction in viral replication and defects late in reverse transcription.
Plasmid construction.
The pNCA plasmid contains an
infectious molecular clone of Mo-MuLV (7), and pNCS is the
same but contains a simian virus 40 origin of replication in the
plasmid backbone (11). Overlapping PCR (16) was
used to delete the 28-bp sequence immediately upstream from the PPT in
a ClaI-NheI fragment containing the 3' end of the
envelope gene, the PPT, and the 5' edge of the LTR. The mutated ClaI-NheI fragment was sequenced to verify the
presence of the deletion and used to replace the corresponding sequence
of pNCS. The resulting plasmid, pNCS
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Deletion of a Short, Untranslated Region Adjacent to the
Polypurine Tract in Moloney Murine Leukemia Virus Leads to
Formation of Aberrant 5' Plus-Strand DNA Ends In Vivo
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
28) replicated more slowly than wild-type (wt)
virus and reverted by recombination with endogenous sequences during
growth in NIH 3T3 cells. We show that this deletion did not affect the
level of viral protein expression or genomic RNA packaging.
Mo-MuLV
28 served as a helper virus as efficiently as the wt virus;
in contrast, a retroviral vector harboring this mutation exhibited
reduced transduction efficiency, indicating that the mutation acts not
in trans but in cis. Analysis of acutely infected cells revealed that reduced levels of viral DNA were generated
by reverse transcription of the Mo-MuLV
28 RNA as compared to the wt
RNA. Analysis of DNA circle junctions revealed that plus-strand DNA of
Mo-MuLV
28 but not wt virus often retained the PPT and additional
upstream sequences. These structures suggest that aberrant 5' ends of
plus-strand DNA were generated by a failure to remove the PPT RNA
primer and/or by mispriming at sites upstream of the PPT. These data
demonstrate that the major role of the sequences immediately upstream
of the PPT is specifying efficient and accurate plus-strand DNA synthesis.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
1)
thus determines the 5' end of the 5' long terminal repeat (LTR) (nt +1)
in the completed double-stranded viral DNA. Mutations affecting the
sequences of the PPT can change the cleavage site that determines the
site of priming; for the Moloney murine leukemia virus (Mo-MuLV) PPT,
residues
1,
2,
4, and
7 are important in determining the
cleavage position (32).
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
28, is identical to pNCS except
for the 28-bp deletion. The pNCS and pNCS
28 plasmids carry an
additional copy of the PPT and its upstream sequences outside the
provirus. To prevent the possibility of these sequences recombining
with the viral genome, the provirus was excised from the vector by digestion with NheI, purified by agarose gel
electrophoresis, and ligated prior to the transfection. This procedure
resulted in the formation of a circular genomic viral DNA containing a single LTR.
28), respectively. The retroviral vector
encoding luciferase (pSR
LLuc) has been described (1).
Cell cultures. Amphotropic-Phoenix (A-Phoenix) (15), AmpliGPE (39) helper cell lines, and COS-7 cells were grown in Dulbecco's modified Eagle's medium (DMEM) containing penicillin-streptomycin with 10% fetal calf serum (DMEM-FCS). NIH 3T3 and Rat2-2 cells (12) were grown in DMEM with 10% calf serum (DMEM-CS). All cells were grown at 37°C and 5% CO2.
Transformation of COS-7 cells. About 70% confluent COS-7 cells in 90-mm plates were washed three times with phosphate-buffered salt (PBS) solution and incubated at 37°C with 2 ml of PBS containing 10 µg of plasmid DNA and 200 µg of DEAE-dextran (Pharmacia). After 30 min, 8 ml of DMEM-FCS-chloroquine cocktail was added to make a final concentration of 100 µM chloroquine. After 2.5 h at 37°C, the medium was aspirated, and the cells were incubated with DMEM containing 10% dimethyl sulfoxide (DMSO) for 2.5 min. The DMSO solution was aspirated, and the cells were incubated in DMEM-FCS for 2 days, after which the expression of the transfected plasmid was assayed.
Transformation of helper cell lines.
AmpliGPE helper cells
(39) were transfected with plasmid DNAs by using
Lipofectamine (8). Cells stably expressing the pBabePuro(wt)
or pBabePuro(
28) vector were isolated after selection in medium
containing 5 µg of puromycin per ml. A few hundred
puromycin-resistant colonies were pooled after transformation with each
vector. Amphotropic-Phoenix helper cells (15) were
transiently transfected by the calcium phosphate method
(29).
Infectivity assays.
To test helper function, COS-7 cells
were transfected with 5 µg of plasmid expressing a luciferase
retroviral vector and 5 µg of plasmid expressing either Mo-MuLV or
Mo-MuLV
28. Two days later the culture supernatants were diluted as
indicated, filtered through 0.45-µm filters after addition of HEPES
(pH 7.4) (50 mM) and Polybrene (8 µg/ml), and used to infect Rat2-2
cells. Luciferase specific activity was determined in extracts of
transfected cells (see below). To test effects on transduction in
cis, A-Phoenix or AmpliGPE helper cells were transiently
transfected with 5 µg of plasmid DNA expressing retroviral vector
pBabePuro(wt) or pBabePuro(
28). A control transfection was performed
without plasmid DNA (mock). Culture supernatants were diluted 1:10,
filtered through 0.45-µm filters after addition of HEPES (pH 7.4) (50 mM) and Polybrene (8 µg/ml), and used to infect Rat2-2 cells. To
assay the infectivity of these preparations, Rat2-2 cells were plated
(2 × 105 cells per 60-mm dish) and 1 day later were
infected with 2 ml of diluted viral preparations for 2 h at
37°C. Lysates of infected cells were prepared 2 days after infection
and analyzed for specific luciferase activity with a luminometer (Lumat
LB 9501; Berthold) and a luciferase assay system (Promega) according to
the manufacturer's protocol. Total protein concentration in cell
lysates was determined with a protein assay kit (Bio-Rad) according to
the manufacturer's protocol. Cells infected with pBabePuro-(wt) and
-(
28) vectors were split into medium containing 5 µg of puromycin
per ml 2 days after infection and grown for a further 8 days.
Drug-resistant colonies were counted after fixation, followed by Giemsa
staining, and titers of the virus were calculated.
Kinetics of virus spread in NIH 3T3 and Rat2-2 cells.
Cells
were plated the day before transfection at a density of 2 × 105 cells per 60-mm dish. The cells were washed three times
with PBS containing 0.5 mM MgCl2 and 0.9 mM
CaCl2 (PBS+) and incubated with 0.4 ml of PBS+ containing
0.5 µg of DEAE-dextran (Pharmacia) per ml and 200 ng of circularized
viral DNA (see above) for 30 min at 37°C. The cells were washed once
with PBS+ before addition of culture medium. The cells were split 1:10
every 3 to 4 days, and aliquots of the supernatants were collected
daily and frozen at
20°C until they were assayed for RT activity.
RT assay. Both exogenous and endogenous reactions were performed as described before (40).
Hirt extraction of infected cells. Virus-containing supernatants (5 ml) containing Polybrene (8 mg/ml) were filtered through a 0.45-µm filter and used to infect Rat2-2 or NIH 3T3 cells at about 70% confluence in 100-mm dishes. After 3 h, another cycle of infection was performed with 5 ml of fresh virus. Hirt extracts were prepared (17) 18 h after infection, and the DNA from each dish was resuspended in 40 µl of 10 mM Tris-HCl-1 mM EDTA (pH 8) (TE).
Southern blot analysis. Viral DNA from acutely infected cells was analyzed by Southern blot with a vacuum blotter (model 785; Bio-Rad) following the manufacturer's protocol. A radiolabeled viral DNA probe was prepared from pNCA plasmid randomly labeled with an Oligolabeling kit (Pharmacia Biotech) according to the manufacturer's protocol. The intensity of the signal was quantified with a phosphoimager (model 445 S1; Molecular Dynamics).
RNase protection assay. RNA was extracted from cells and purified virions with RNAzolB (Tel-Test) according to the manufacturer's protocol, and RNA levels were measured with an RNase protection kit (Ambion). A 572-base XbaI-EagI fragment from Mo-MuLV, spanning the splice donor site (3), was cloned in pBluescript plasmid SK and used as a template for transcription of the riboprobe. The plasmid DNA was linearized with HindIII, and the ribopobe was transcribed with T3 RNA polymerase using the Ambion MAXIscript in vitro transcription kit according to the manufacturer's protocol.
LM-PCR. For ligation-mediated PCR (LM-PCR), subconfluent Rat2-2 cells (10-cm dish) were infected with undiluted virus, and low-molecular-weight DNA was extracted after 18 h. The DNA was recovered and resuspended in TE (40 µl). One tenth of the sample (4 µl) was mixed with 6 µl of 3 µM dephosphorylated oligonucleotide (anchor oligonucleotide), with the arbitrary DNA sequence 5'GGAACTCAATGCACGCGT3', and 7 µl of water, and the mixture was boiled for 3 min and cooled on ice for another 3 min. Then 2 µl of 10× T4 RNA ligase buffer and 1 µl of T4 RNA ligase (New England BioLabs) were added to make final concentrations of 50 mM Tris-HCl (pH 7.8), 10 mM MgCl2, 10 mM dithiothreitol, 1 mM ATP, and 20 U of enzyme. The ligation was performed at 16°C overnight, after which 6 µl from the ligation reaction mixture was amplified by PCR. The PCR conditions were as described for the circle junction analysis (see below) except that 2.5 U of native Taq DNA polymerase per reaction was used and the primer pairs were either the anchor oligonucleotide (forward primer) and oligonucleotide 4091 (reverse primer) to amplify linear ends or oligonucleotides 4091 and 5784 to amplify circle junctions.
Circle junction analysis. Circle junction analysis was done by a modification of a procedure described previously (36). DNA from a Hirt extract was amplified by PCR with oligonucleotides 4091 (5'CTCTTTTATTGAGCTCGGG3'; nucleotides 8244 to 8226 in the Mo-MuLV map [35]) and 5784 (5'AGTCCTCCGATTGACTGAG3'; nucleotides 6 to 24 in the Mo-MuLV map). PCR was performed under the following conditions: 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 15 mM MgCl2, 0.01% (wt/vol) gelatin, 200 mM each of the four deoxynucleoside triphosphates, 0.3 mM each of the above primers, 1.25 U of native Taq DNA polymerase (Perkin-Elmer), and viral DNA (1/10 of the Hirt extract from a single dish of infected cells). The cycling conditions were 2 min at 94°C, followed by 30 cycles of 94°C for 15 s, 60°C for 30 s, and 72°C for 30 s, and one cycle of 72°C for 7 min in a GeneAmp PCR system 9700 (Perkin-Elmer). The PCR products were cloned directly from the PCR solution with a TOPO TA cloning kit (Invitrogen; K4500-01/40) according to the manufacturer's protocol, and clones were subjected to DNA sequence analysis.
Analysis of Mo-MuLV
28 and revertant viruses for the presence
of the
28 deletion.
Viral DNAs extracted from acutely infected
cells were amplified by PCR with the primers
5'CTCCTAATGATTTTGCTCTTCGGACCC3' and 5'TTCCATCTGTTCCTGACC3', located upstream and downstream of
the ClaI and the NheI sites, respectively. The
PCR products, with expected lengths of 298 bases for the wt virus or
270 bases for the Mo-MuLV
28, were cloned and sequenced. The PCR
conditions and cloning of the PCR products were as described for the
circle junction analysis.
| |
RESULTS |
|---|
|
|
|---|
A 28-bp deletion in the 3' UTR of Mo-MuLV impairs
replication.
The genomic RNA of Mo-MuLV contains a 28-nucleotide
untranslated sequence between the 3' end of the envelope gene and the start of the PPT sequence at the edge of the 3' LTR. This sequence contains a near-perfect inverted repeat and thus could form a stem-loop
hairpin structure in the RNA. To evaluate the significance of this
sequence, we deleted the 28 bases from a wt clone of Mo-MuLV, generating the Mo-MuLV
28 mutant virus (Fig.
1A). Rat2-2 cells were transfected with
plasmid DNAs containing either the wt or the Mo-MuLV
28 virus to
transiently initiate virus expression, and the spread of virus in the
cultures was monitored by measuring the RT activity present in the cell
culture supernatants on subsequent days. The Mo-MuLV
28 virus
consistently showed a 6-day delay in the appearance of detectable RT
activity compared with the wt virus (Fig. 1B). To test the rate of
viral spread in a different setting, virus stocks were first generated
by transformation of COS-7 cells with the same plasmids. The virus
preparations were normalized to equal RT activities and used to infect
NIH 3T3 cells, and the rate of virus replication in these cultures was
determined by RT assays. A similar delay in appearance of virus was
observed (data not shown).
|
28-transfected Rat2-2 cultures (day 20 after transfection)
was used to infect naive Rat2-2 cells, and 18 h later the
unintegrated viral DNA was isolated from the infected cells
(17). The region of the viral DNA that harbors the deletion
was amplified by PCR, cloned, sequenced, and found to retain the
28
deletion (data not shown). In two such clones sequenced, no nucleotide
changes from the parental mutant virus were detected in the vicinity of
the deletion. These data suggest that Mo-MuLV
28 can replicate but at
a slower rate than the wt virus.
A different result occurred when this experiment was repeated using NIH
3T3 cells. Virus arising in these cells after a delay were used in an
acute infection, and the unintegrated DNAs were cloned and sequenced as
before. These viral DNAs had reverted to the wt sequence. Of two clones
sequenced, both had restored the entire 28-bp wt sequence; whereas one
contained no additional changes, the other one contained two A-to-G
substitutions in the adjacent sequences of the 3' LTR. The reappearance
of the wt sequence in these revertants is most likely due to
recombination with endogenous retrovirus-like elements very similar to
Mo-MuLV present in the mouse genome. To rule out the possibility that
these reverted viruses originated from a contamination of the
transfected DNA, the experiments were repeated with a single
transfection mixture used to initiate viral spread in both Rat2-2 cells
and NIH 3T3 cells. As before, wt virus was generated only in NIH 3T3
cells. These experiments indicate that the
28 virus can replicate
slowly in Rat cells without reversion but that it tends to revert in NIH 3T3 cells. The reversion is probably facilitated by the high copy
number of provirus-like sequences in the mouse genome.
The 28-bp deletion acts in cis and not in
trans.
The 28-bp deletion could act by impairing viral gene
expression, through effects on either mRNA stability or mRNA
translation. To address this possibility, we tested the ability of
Mo-MuLV
28 and the wt virus to provide helper function in
trans for the transfer of a retroviral vector carrying the
luciferase reporter gene. COS-7 cells were transfected with vector plus
helper DNAs, virus was collected, and the efficiency of transfer was
assessed by measuring luciferase levels after infection of Rat2-2
cells. Both viruses pseudotyped the retroviral vector with
similar efficiencies (Table 1). Similar
results were obtained with a green fluorescence protein-containing
vector (data not shown). These results demonstrate that the mutation
had no effect on expression of viral proteins required in
trans. In addition, pools of 293 cells stably expressing either the wt or the mutated virus released similar levels of RT
activity into the culture medium (data not shown). These data suggest
that the 28-base deletion does not affect the level of production of
functional viral proteins.
|
28) vector, respectively. These
vector DNAs were expressed in helper cell lines that provide viral
proteins in trans, and the titer of the transducing virus was measured after infection of Rat2-2 cells by counting the resulting puromycin-resistant colonies. Transient expression of these vectors in
two different cell lines (A-Phoenix and AmpliGPE) revealed that
pBabePuro(
28) consistently produced approximately 10-fold-lower titers than pBabePuro(wt) (Table 2). To
rule out the possibility that the reduction in the titer was due to a
difference in the efficiency of transient transfection, the
experiment was repeated by generating pools of several hundred
AmpliGPE colonies that stably express these vectors. The virus produced
by the pBabePuro(
28) pools showed a similar reduction in titer
compared with the wt pools (Table 2). These experiments demonstrate
that the
28 mutation acts in cis to impair virus
replication.
|
The 28-base deletion does not affect RNA packaging.
One
possible explanation for the slower replication of Mo-MuLV
28 is a
reduced level of packaged viral RNA. Indeed, mutations in the 3' UTR
between the 3' end of env and the LTR of the avian sarcoma/leukosis virus have been shown to cause a reduction in genomic
RNA packaging (2). To examine the levels of viral RNA packaged into virions, 293T cells were transfected with plasmids expressing either Mo-MuLV or Mo-MuLV
28, and virus particles were harvested from the culture medium. RNAs were isolated from the producer
cells and from virus particles and normalized by RT assays, and the
levels of viral RNA were determined by RNase protection assays with a
riboprobe that detects both unspliced and spliced viral RNA forms (Fig.
2A). The wt and mutant viruses exhibited similar levels of spliced and unspliced viral RNAs both in the expressing cells and in the purified virions (Fig. 2B). Similar results
were obtained in stably transfected virus-producing Rat2-2 cells. Thus,
MuLV
28 packages its genomic RNA as efficiently as wt virus.
|
Mo-MuLV
28 virions carry out the early stages of reverse
transcription as efficiently as wt virions.
To examine the ability
of Mo-MuLV
28 to carry out reverse transcription, we used the
endogenous RT reaction assay in which the encapsidated genomic RNA
serves as the template for the virion-associated RT. Virions of Mo-MuLV
and Mo-MuLV
28 were purified from culture supernatants of transiently
transfected 293T cells, and the levels were normalized by quantitative
exogenous RT assay. The virions were then incubated with NP-40 and
radiolabeled nucleotides, and the formation of minus-strand strong-stop
DNA (
sssDNA) was measured by electrophoresis and autoradiography.
Similar levels of
sssDNA were formed by both the wt and mutant
viruses (Fig. 3A). To test for the
formation of longer DNA products, reaction mixtures were incubated for
extended times, and the products were analyzed by electrophoresis on
alkaline agarose gels followed by autoradiography. The mutant and
control virions produced a similar heterogeneous distribution of DNAs,
appearing as a smear in the gels (Fig. 3B). These data indicate that
the viral RNA is packaged in a functional form by the mutant and that
the early stages of reverse transcription are carried out with normal
efficiency. Similar results were obtained with purified virions
produced from COS-7 cells and with levels of virions normalized by
Western blot analysis with antibodies against RT (data not shown).
|
28 deletion reduces the yield of viral full-length genomic
DNA.
We next examined the amount of the full viral DNA genome
generated by reverse transcription in vivo. Mo-MuLV and Mo-MuLV
28 were transiently expressed in COS-7 cells, and supernatants with equal
amounts of RT activity were used to infect naive Rat2-2 cells.
Low-molecular-weight DNA was extracted from the Rat2-2 cells 18 h
after infection by the Hirt extraction method, and the viral DNAs were
analyzed by Southern blotting with the complete viral genome as a
probe. This analysis revealed a reduction in the linear genome levels
of Mo-MuLV
28 compared with Mo-MuLV (Fig. 4). This reduction was about sixfold, as
quantitated with a phosphoimager. Thus, the
28 deletion appears to
reduce the yield of full-length linear viral genomic DNA, indicating
that some step in reverse transcription is inefficient.
|
Mo-MuLV
28 generates aberrant 5' plus-strand DNA ends.
The
28 deletion is located immediately adjacent to the PPT and might
affect the efficiency or the position of plus-strand DNA priming. The
site of initiation of plus-strand DNA synthesis near the PPT ultimately
determines the 5' end of the linear double-stranded viral DNA. We first
attempted to amplify and clone the 5' ends of the plus-strand DNAs by
LM-PCR. Rat2-2 cells were infected with equal amounts of either wt or
mutated virus, and after 18 h, low-molecular-weight DNA was
extracted and denatured. The 5' ends of the DNA were ligated to an
anchor oligonucleotide using T4 RNA ligase, and the ligation products
were amplified by PCR using the anchor oligonucleotide as a forward
primer and an oligonucleotide derived from the U3 region as a reverse
primer. The expected LM-PCR product could only be obtained from Hirt
extracts of wt-infected cells and not from Mo-MuLV
28-infected cells
(Fig. 5). The failure to obtain LM-PCR
products from Mo-MuLV
28-infected cells may be due either to a lower
yield of linear plus-strand DNA by Mo-MuLV
28 or to aberrant
structures at the 5' ends of plus-strand DNA that cannot be amplified
(see Discussion).
|
28-infected cells migrated slightly more slowly than those of
the wt, suggesting the presence of additional sequences (Fig. 5). To
characterize these sequences, the LTR-LTR junctions were
amplified by PCR and cloned directly into plasmids, and clones chosen
at random were sequenced. This procedure was repeated in two
independent experiments. In the first experiment, viruses were
collected from transiently transfected COS-7 cells, and in the second
experiment the viruses were obtained from chronically infected Rat2-2
cells. Figure 6 shows a schematic
representation of 32 clones of circle junctions (16 of the wt and 16 of
the mutated virus).
|
28 mutant virus, the circle junction analysis gave a
strikingly different result. Only 1 of the 16 clones (clone
II 40)
had an intact LTR-LTR junction (Fig. 6, group 1). More importantly,
another major and unique group of clones was identified in which the
intact LTRs were retained and flanked additional viral sequences. This
group included 8 of the 16 clones (Fig. 6, group 4). In five of these
clones (
I 5 and 6 and
II 33, 38, and 39), the additional sequence
consisted of 11 nucleotides derived from the PPT sequence (an
additional thymidine was found at the 5' end of this extra sequence in
clone
II 39, and its source is not clear). The other three clones
had even longer sequences that included the PPT and part of the
envelope gene. These sequences varied in their length, consisting of an
additional 19 bases (clone
I 3), 175 bases (clone
I 1), and about
300 bases (clone
I 36) (the sequencing reaction did not reach the
LTR edge, and the length of the insert was estimated by restriction
analysis). All three of these clones contained the expected
28
deletion, confirming that they indeed originated from Mo-MuLV
28. The
other clones, like the wt, could be divided into two groups, in which
the LTR-LTR junctions contained either truncated LTR ends (Fig. 6 group
2, clones
II 31 and 32) or truncated LTRs flanking additional
sequences which originated from either the plasmid backbone, inverted
viral sequences, or unknown sources (Fig. 6, group 3, clones
I 4, 7, 8, and 9 and
II 35). These rearranged clones probably represent amplification of rare recombination events.
The observations that Mo-MuLV
28 produces few DNAs with perfect
LTR-LTR junctions (1 of 16 clones, compared with 8 of 16 clones for the
wt) and that half of the mutant clones had additional sequences
attached to the 5' end of the 5' LTR (whereas none did for the wt)
strongly suggest that formation of the correct 5' end of plus-strand
DNA is impaired in this virus.
| |
DISCUSSION |
|---|
|
|
|---|
The experiments described here show that a mutation near the PPT
causes slower viral replication, impairs transfer of viral genomes to
new cells in cis, and causes a reduction in the level of
viral genomic DNA synthesized in infected cells. The most remarkable feature of the mutant virus was a high frequency of extra sequences at
the LTR-LTR junctions of circular viral DNAs. These extra sequences were of various lengths and derived from the 3' portion of the genome,
contiguous with the 5' end of the 3' LTR. In contrast, no structures
similar to these were observed for the wt virus in this or other
studies (36). While deletions and insertions at both LTR
edges have been reported for nucleocapsid mutants (14), the
asymmetric retention of sequences adjacent only to the 3' LTR is unique
to the Mo-MuLV
28 virus.
How did these additional sequences arise? Previous reports have
described additional nucleotides at the LTR edges. For example, analysis of a circular DNA of an Mo-MuLV variant with a mutation at the
U5-primer binding site border revealed a tRNA sequence at the LTR-LTR
junction; these sequences probably resulted from a failure to remove
the tRNA primer from the 5' end of the minus-strand DNA (6).
Other studies observed the presence of additional sequences that
resulted from a nontemplated nucleotide addition (18, 22, 25, 27,
28, 37). However, the extra sequences found in our analysis are
unique in that they are asymmetric, derived from viral sequences just
upstream of the PPT. The simplest explanation is that the circles arose
from linear DNAs with aberrant 5' ends of the plus-strand DNA. We
propose that these additional sequences are the result of either
nonlegitimate plus-strand priming at a site upstream from the PPT, the
inefficient removal of a short RNA primer, or both (Fig.
7).
|
In one mechanism, priming which starts 5' to the PPT will generate
plus-strand DNA with additional sequences attached to the U3 region
(Fig. 7A and B). This mechanism allows for the addition of relatively
short or long sequences, depending on how far from the 5' end of U3 the
priming occurs. Mutations in the PPT itself have been shown to affect
the efficiency and accuracy of priming of several viruses in vitro.
Point mutations in human immunodeficiency virus type 1 at positions
2
and
4 relative to the site of priming showed the importance of two
guanine residues for primer production (31). The 3'-proximal
nucleotides are most important, since an artificial sequence containing
six guanines could be recognized and cleaved correctly. A short RNA-DNA
hybrid with a sequence different from the wt was found to serve as a
primer, but the site of cleavage and initiation was imprecise
(30). Mutations in the PPT have also been shown to affect
priming in vivo; between 9 and 29 nucleotides near the PPT of Rous
sarcoma virus were required for replication (38), and point
mutations in the Mo-MuLV PPT caused a delay in virus replication and
reduced efficiency of plus-strand priming (33). Thus, the
mutation studied here might well impair proper priming and reveal
inefficient priming at upstream sites.
The other explanation for the extra sequences is a failure to
remove the RNA primer by RNase H, resulting in extension of the
minus-strand DNA to copy the RNA primer as a template at the final
stages of minus-strand DNA synthesis (Fig. 7C). This could explain the
relatively short PPT sequences found attached to U3 in some clones but
is not a likely mechanism in the case of long inserts of hundreds of
bases, because RNase H normally cleaves the RNA every 10 to 13 nucleotides (13). Defects in primer removal have been seen
in other settings; imprecise removal of tRNA and PPT primers by RNase H
has been observed for the yeast Ty1 retrotransposon (25).
The idea that the
28 mutation interferes with the removal of the RNA
primer is also supported by the experiment in which we attempted to use
LM-PCR to amplify the 5' ends of plus-strand DNA. While we were able to
amplify these ends from cells infected with wt virus, we were unable to
do so for the Mo-MuLV
28-infected cells (Fig. 5). Because T4 RNA
ligase can ligate oligonucleotides to both DNA and RNA molecules, the
inability to PCR-amplify the 5' ends of Mo-MuLV
28 might be explained
by the formation of a sequence composed of the anchor oligonucleotide
plus RNA plus the LTR, which Taq polymerase would be unable
to amplify.
What are the signals for accurate priming and for timely removal of the RNA primer? The RNase H domain of RT is thought to produce the primer by digesting the viral genomic RNA as it enters into an RNA-DNA duplex, leaving a purine-rich RNA fragment with a defined 3' end. RNase H should then remove the RNA primer soon after the initiation of plus-strand DNA synthesis, so that it would not normally be used as a template in the final stages of minus-strand DNA synthesis. It is not known how the RNase H domain specifically recognizes the PPT sequence to achieve the above tasks. Previous in vitro studies demonstrated that the PPT per se is essential for the priming of the plus-strand DNA and for correct cleavage of this RNA primer from the newly synthesized DNA strand. It was suggested that RNA-DNA hybrids in general, and the purine stretch in particular, form a unique structure that is somehow recognized by RNase H (9, 10, 30). However, the region upstream of the PPT may be recognized and bound by the DNA polymerase domain of RT in order to correctly position the RNase H domain to cleave the 3' end of PPT (19, 42).
Although experiments carried out in vitro show that the PPT sequence is the key element required for plus-strand priming, this work and two other recently published papers (20, 33) demonstrate the importance of additional upstream sequences for reverse transcription and plus-strand synthesis. Examination of simian immunodeficiency virus revealed that the sequence upstream of the PPT is rich in thymidines; this region, conserved in most retroviruses, was accordingly named the U box (20). Mutations in this sequence impaired replication, and the mutant viruses gave rise to revertants with additional alterations in the region. The most common compensatory mutation recovered in these revertants was the acquisition of thymidines immediately upstream of the PPT, indicating their importance at this position. However, another set of revertants included the addition of a stretch of adenines that extended the PPT. Similar reversion events were also observed for Mo-MuLV mutants (33). Presumably, either of these compensatory mutations can partially restore normal replication.
The 28-bp sequence that was deleted from Mo-MuLV in this work contains a stretch of adenines upstream of a stretch of thymidines. We observed that these two stretches, together with the two last bases of the envelope stop codon, have the potential to form a stem structure (except for one adenine in each of the 13-base-long stretches). However, there is no direct evidence for the existence of such an RNA stem structure, especially if the structure to be recognized by the RNase H is in the form of an RNA-DNA hybrid. Moreover, a deletion in the envelope gene that included all of the adenine stretch and part of the thymidine stretch was made in an attempt to minimize the length of Mo-MuLV-based retroviral vectors (21). This deletion did not reduce the titer of a retroviral vector, indicating that at least in this assay, the adenine stretch, and thus the presence of complementary stretches, is not important for PPT function.
Recently, Robson and Telesnitsky described substitution mutations in the region upstream from the Mo-MuLV PPT that caused a delay in replication and in some cases reduction in the use of PPT (33). These substitution mutations may have impaired replication in ways similar to the deletion mutation described here. However, the substitution mutations caused a more severe delay in replication than the deletion mutation, suggesting that subtly altered sequences in the region upstream of the PPT may be more deleterious to replication than the absence of the wt sequence. These investigators were unable to detect longer plus-strand DNAs by primer extension on linear viral DNA, but the levels of the products may have been low and below the limit of detection. Since any extended DNAs would be defective for integration, they may tend to be diverted to the pathway leading to the formation of circular species; the accumulation of these DNAs may have facilitated their detection in our assays.
The fact that some of the substitution mutations in the sequence
upstream from the PPT had a relatively modest effect on PPT usage but
severe effects on viral replication suggests that this region might
have other functions; one possibility is that it might act as an RNA
export element (33). In Mason-Pfizer monkey virus, a
constitutive RNA export element located in the 3' UTR was found to be
important for the efficient export of unspliced viral RNA from the
nucleus to the cytoplasm (4). Mutations in such an element
should in principle reduce expression of the Gag and Pol proteins,
which are encoded by the unspliced viral message. In our experiments,
transient or stable expression of Mo-MuLV
28 did not show reduced
amounts of Gag or RT compared with amounts in the wt controls,
suggesting that the deleted sequence does not serve as an RNA export
signal. Also, the sixfold reduction in the level of Mo-MuLV
28
genomic DNA is in a good agreement with the roughly 10-fold reduction
in titer observed for the vector pBabePuro(
28). Thus, the lower
efficiency and accuracy of the reverse transcription of Mo-MuLV
28
are probably the main cause of its slower replication.
In summary, the region upstream from the PPT of Mo-MuLV is apparently most important for reverse transcription of the viral RNA. No other replication function, including export of the viral RNA from the nucleus or packaging of the RNA genome into virion particles, was affected by the deletion of this sequence. Removal of this region results in reduced levels of viral DNA synthesis and in the formation of aberrant circular DNAs with extra viral sequences at the LTR-LTR junction. Thus, the data suggest that the major function of this short untranslated sequence adjacent to the 5' end of the PPT is to contribute to the accurate priming of the plus-strand DNA in vivo.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by Public Health Service grant R01 CA 30488 from the National Cancer Institute. E.B. is an Associate and S.P.G. is an Investigator of the Howard Hughes Medical Institute.
We thank Alice Telesnitsky for sharing data prior to publication, Guangxia Gao and Matthew Evans for helpful discussions, and Sharon Boast and Kenia de los Santos for technical assistance.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biochemistry and Molecular Biophysics and Howard Hughes Medical Institute, Columbia University College of Physicians & Surgeons, New York, NY 10032. Phone: (212) 305-3794. Fax: (212) 305-8692. E-mail: goff{at}cuccfa.ccc.columbia.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | An, D. S., Y. Koyanagi, J. Q. Zhao, R. Akkina, G. Bristol, N. Yamamoto, J. A. Zack, and I. S. Chen. 1997. High-efficiency transduction of human lymphoid progenitor cells and expression in differentiated T cells. J. Virol. 71:1397-1404[Abstract]. |
| 2. |
Aschoff, J. M.,
D. Foster, and J. M. Coffin.
1999.
Point mutations in the avian sarcoma/leukosis virus 3' untranslated region result in a packaging defect.
J. Virol.
73:7421-7429 |
| 3. | Berkowitz, R. D., A. Ohagen, S. Hoglund, and S. P. Goff. 1995. Retroviral nucleocapsid domains mediate the specific recognition of genomic viral RNAs by chimeric Gag polyproteins during RNA packaging in vivo. J. Virol. 69:6445-6456[Abstract]. |
| 4. |
Bray, M.,
S. Prasad,
J. W. Dubay,
E. Hunter,
K. T. Jeang,
D. Rekosh, and M. L. Hammarskjold.
1994.
A small element from the Mason-Pfizer monkey virus genome makes human immunodeficiency virus type 1 expression and replication Rev-independent.
Proc. Natl. Acad. Sci. USA
91:1256-1260 |
| 5. |
Colicelli, J., and S. P. Goff.
1986.
Isolation of a recombinant murine leukemia virus utilizing a new primer tRNA.
J. Virol.
57:37-45 |
| 6. |
Colicelli, J., and S. P. Goff.
1986.
Structure of a cloned circular retroviral DNA containing a tRNA sequence between the terminal repeats.
J. Virol.
57:674-677 |
| 7. | Colicelli, J., and S. P. Goff. 1988. Sequence and spacing requirements of a retrovirus integration site. J. Mol. Biol. 199:47-59[CrossRef][Medline]. |
| 8. |
Fassati, A.,
Y. Takahara,
F. S. Walsh, and G. Dickson.
1994.
Production of high titre helper-free recombinant retroviral vectors by lipofection.
Nucleic Acids Res.
22:1117-1118 |
| 9. | Fedoroff, O., M. Salazar, and B. R. Reid. 1993. Structure of a DNA:RNA hybrid duplex. Why RNase H does not cleave pure RNA. J. Mol. Biol. 233:509-523[CrossRef][Medline]. |
| 10. | Fedoroff, O. Y., Y. Ge, and B. R. Reid. 1997. Solution structure of r(gaggacug):d(CAGTCCTC) hybrid: implications for the initiation of HIV-1 (+)-strand synthesis. J. Mol. Biol. 269:225-239[CrossRef][Medline]. |
| 11. |
Gao, G., and S. P. Goff.
1998.
Replication defect of Moloney murine leukemia virus with a mutant reverse transcriptase that can incorporate ribonucleotides and deoxyribonucleotides.
J. Virol.
72:5905-5911 |
| 12. |
Gao, G., and S. P. Goff.
1999.
Somatic cell mutants resistant to retrovirus replication: intracellular blocks during the early stages of infection.
Mol. Biol. Cell
10:1705-1717 |
| 13. | Gerard, G. F. 1981. Mechanism of action of Moloney murine leukemia virus RNA-directed DNA polymerase associated RNase H (RNase H I). Biochemistry 20:256-265[CrossRef][Medline]. |
| 14. |
Gorelick, R. J.,
W. Fu,
T. D. Gagliardi,
W. J. Bosche,
A. Rein,
L. E. Henderson, and L. O. Arthur.
1999.
Characterization of the block in replication of nucleocapsid protein zinc finger mutants from Moloney murine leukemia virus.
J. Virol.
73:8185-8195 |
| 15. |
Grignani, F.,
T. Kinsella,
A. Mencarelli,
M. Valtieri,
D. Riganelli,
L. Lanfrancone,
C. Peschle,
G. P. Nolan, and P. G. Pelicci.
1998.
High-efficiency gene transfer and selection of human hematopoietic progenitor cells with a hybrid EBV/retroviral vector expressing the green fluorescence protein.
Cancer Res.
58:14-19 |
| 16. | Higuchi, R. 1990. Recombinant PCR, p. 177-188. In M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White (ed.), PCR protocols: a guide to methods and applications. Academic Press, Inc., New York, N.Y. |
| 17. | Hirt, B. 1967. Selective extraction of polyoma DNA from infected mouse cell cultures. J. Mol. Biol. 26:365-369[CrossRef][Medline]. |
| 18. |
Hong, T.,
K. Drlica,
A. Pinter, and E. Murphy.
1991.
Circular DNA of human immunodeficiency virus: analysis of circle junction nucleotide sequences.
J. Virol.
65:551-555 |
| 19. | Hughes, S. H., Z. Hostomsky, S. F. Le Grice, K. Lentz, and E. Arnold. 1996. What is the orientation of DNA polymerases on their templates? J. Virol. 70:2679-2683[Medline]. |
| 20. | Ilyinskii, P. O., and R. C. Desrosiers. 1998. Identification of a sequence element immediately upstream of the polypurine tract that is essential for replication of simian immunodeficiency virus. EMBO J. 17:3766-3774[CrossRef][Medline]. |
| 21. |
Kim, S. H.,
S. S. Yu,
J. S. Park,
P. D. Robbins,
C. S. An, and S. Kim.
1998.
Construction of retroviral vectors with improved safety, gene expression, and versatility.
J. Virol.
72:994-1004 |
| 22. | Kulkosky, J., R. A. Katz, and A. M. Skalka. 1990. Terminal nucleotides of the preintegrative linear form of HIV-1 DNA deduced from the sequence of circular DNA junctions. J. Acquir. Immune Defic. Syndr. 3:852-858. |
| 23. | Martinelli, S. C., and S. P. Goff. 1990. Rapid reversion of a deletion mutation in Moloney murine leukemia virus by recombination with a closely related endogenous provirus. Virology 174:135-144[CrossRef][Medline]. |
| 24. |
Morgenstern, J. P., and H. Land.
1990.
Advanced mammalian gene transfer: high titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell line.
Nucleic Acids Res.
18:3587-3596 |
| 25. |
Mules, E. H.,
O. Uzun, and A. Gabriel.
1998.
In vivo Ty1 reverse transcription can generate replication intermediates with untidy ends.
J. Virol.
72:6490-6503 |
| 26. |
Noad, R. J.,
N. S. Al-Kaff,
D. S. Turner, and S. N. Covey.
1998.
Analysis of polypurine tract-associated DNA plus-strand priming in vivo utilizing a plant pararetroviral vector carrying redundant ectopic priming elements.
J. Biol. Chem.
273:32568-32575 |
| 27. |
Olsen, J. C., and R. Swanstrom.
1985.
A new pathway in the generation of defective retrovirus DNA.
J. Virol.
56:779-789 |
| 28. |
Patel, P. H., and B. D. Preston.
1994.
Marked infidelity of human immunodeficiency virus type 1 reverse transcriptase at RNA and DNA template ends.
Proc. Natl. Acad. Sci. USA
91:549-553 |
| 29. |
Pear, W. S.,
G. P. Nolan,
M. L. Scott, and D. Baltimore.
1993.
Production of high-titer helper-free retroviruses by transient transfection.
Proc. Natl. Acad. Sci. USA
90:8392-8396 |
| 30. |
Powell, M. D., and J. G. Levin.
1996.
Sequence and structural determinants required for priming of plus-strand DNA synthesis by the human immunodeficiency virus type 1 polypurine tract.
J. Virol.
70:5288-5296 |
| 31. |
Pullen, K. A.,
A. J. Rattray, and J. J. Champoux.
1993.
The sequence features important for plus strand priming by human immunodeficiency virus type 1 reverse transcriptase.
J. Biol. Chem.
268:6221-6227 |
| 32. | Rattray, A. J., and J. J. Champoux. 1989. Plus-strand priming by Moloney murine leukemia virus. The sequence features important for cleavage by RNase H. J. Mol. Biol. 208:445-456[CrossRef][Medline]. |
| 33. |
Robson, N. D., and A. Telesnitsky.
1999.
Effects of 3' untranslated region mutations on plus-strand priming during Moloney murine leukemia virus replication.
J. Virol.
73:948-957 |
| 34. |
Schwartzberg, P.,
J. Colicelli, and S. P. Goff.
1985.
Recombination between a defective retrovirus and homologous sequences in host DNA: reversion by patch repair.
J. Virol.
53:719-726 |
| 35. | Shinnick, T. M., R. A. Lerner, and J. G. Sutcliffe. 1981. Nucleotide sequence of Moloney murine leukaemia virus. Nature 293:543-548[CrossRef][Medline]. |
| 36. | Smith, C. M., W. B. Potts, 3rd, J. S. Smith, and M. J. Roth. 1997. RNase H cleavage of tRNAPro mediated by M-MuLV and HIV-1 reverse transcriptases. Virology 229:437-446[CrossRef][Medline]. |
| 37. |
Smith, J. S.,
S. Y. Kim, and M. J. Roth.
1990.
Analysis of long terminal repeat circle junctions of human immunodeficiency virus type 1.
J. Virol.
64:6286-6290 |
| 38. |
Sorge, J., and S. H. Hughes.
1982.
Polypurine tract adjacent to the U3 region of the Rous sarcoma virus genome provides a cis-acting function.
J. Virol.
43:482-488 |
| 39. |
Takahara, Y.,
K. Hamada, and D. E. Housman.
1992.
A new retrovirus packaging cell for gene transfer constructed from amplified long terminal repeat-free chimeric proviral genes.
J. Virol.
66:3725-3732 |
| 40. | Telesnitsky, A., S. Blain, and S. P. Goff. 1995. Assays for retroviral reverse transcriptase. Methods Enzymol. 262:347-362[Medline]. |
| 41. | Telesnitsky, A., and S. P. Goff. 1997. Reverse transcriptase and the generation of retroviral DNA, p. 121-160. In J. M. Coffin, S. H. Hughes, and H. E. Varmus (ed.), Retroviruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 42. |
Wohrl, B. M.,
M. M. Georgiadis,
A. Telesnitsky,
W. A. Hendrickson, and S. F. Le Grice.
1995.
Footprint analysis of replicating murine leukemia virus reverse transcriptase.
Science
267:96-99 |
| 43. |
Zolotukhin, A. S.,
A. Valentin,
G. N. Pavlakis, and B. K. Felber.
1994.
Continuous propagation of RRE( ) and Rev( )RRE( ) human immunodeficiency virus type 1 molecular clones containing a cis-acting element of simian retrovirus type 1 in human peripheral blood lymphocytes.
J. Virol.
68:7944-7952 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»