Previous Article | Next Article 
Journal of Virology, May 2000, p. 4721-4728, Vol. 74, No. 10
Macfarlane Burnet Centre for Medical Research
and Australian Centre for Hepatitis Virology, Fairfield 3078, Victoria, Australia,1 and D. I. Ivanovsky Institute of Virology, Academy of Medical Sciences,
123098 Moscow, Russia2
Received 28 October 1999/Accepted 24 February 2000
To clarify the role of core protein phosphorylation in
pregenomic-RNA encapsidation of human and duck hepatitis B
viruses (HBV and DHBV, respectively), we have examined the
phosphorylation states of different forms of intracellular HBV core
protein and the phenotypic effects of mutations in the phosphorylation
sites of HBV and DHBV core proteins. We show that HBV core protein is phosphorylated to similar extents in the form of protein dimers and
after further assembly in pregenomic RNA-containing
capsids. Individual and multiple substitutions of alanine and aspartic acid for serine in the phosphorylation sites of HBV core protein resulted in site-specific and synergistic effects on RNA encapsidation, ranging from 2-fold enhancement to more than 10-fold inhibition. Core
protein variants with mutations in all phosphorylation sites exhibited
dominant-negative effects on RNA encapsidation by wild-type protein.
The results suggest that the presence of phosphoserine at position 162 of HBV core protein is required for pregenomic-RNA encapsidation, whereas phosphoserine at position 170 optimizes the
process and serine might be preferable in position 155. Examination of
the pregenomic-RNA-encapsidating capacities of DHBV core
protein variants, in which four phosphorylation sites were jointly
mutated to alanine or aspartic acid, suggests that phosphorylation of DHBV core protein at these sites may optimize
pregenomic-RNA encapsidation but that its impact is much
less profound than in the case of HBV. The possible mechanisms by which
RNA encapsidation may be modulated by core protein phosphorylation are
discussed in the context of the observed differences between the two viruses.
The DNA genome of hepadnaviruses is
replicated through reverse transcription of an RNA intermediate, the
pregenomic RNA (reviewed in reference
4). Replication begins with encapsidation of
pregenomic RNA, a process which requires two viral
proteins, core (capsid) protein and polymerase; however, the enzymatic
activities of the polymerase are not essential. Sequential synthesis of
a minus-strand DNA by reverse transcription and synthesis of the second
DNA strand are carried out by the polymerase inside the assembled nucleocapsid.
Core protein is a phosphoprotein (9, 11, 14, 15, 17). Three
phosphorylation sites have been identified in the core protein of human
hepatitis B virus (HBV), located in the arginine-rich C-terminal domain
of the protein (S155, S162, and S170 in subtype ayw, which are
equivalent to S157, S164, and S172 in subtype adw2) (10). The core protein of duck hepatitis B virus (DHBV) has four phosphorylation sites within the 28-amino-acid C-terminal sequence
(T239, S245, S257, and S259) and is also phosphorylated elsewhere
(20).
The function(s) of core protein phosphorylation is unclear. In
particular, conflicting evidence has been presented regarding the
possible role of core protein phosphorylation in encapsidation of
pregenomic RNA. There are no data directly showing when
core protein becomes phosphorylated: (i) prior to nucleocapsid
assembly, (ii) during assembly, (iii) after assembly, in viral capsids
containing pregenomic RNA, or (iv) later, during DNA
synthesis. Studies with HBV core protein phosphorylated in vitro have
suggested that the protein must be unphosphorylated to encapsidate
pregenomic RNA and remains unphosphorylated until a later
step of DNA synthesis (7). However, polymerase was not
included in these in vitro experiments, and therefore they fail to
reflect the situation of viral nucleocapsid assembly. Conversely, in
cells transfected with plasmids encoding the relevant viral products,
individual amino acid substitutions of four phosphorylation sites
in DHBV core protein (expected to functionally mimic their
unphosphorylated or phosphorylated forms; Ala or Asp for Ser or Thr,
respectively) had no effect on pregenomic-RNA encapsidation
(21). Similar experiments with HBV suggested that core
protein phosphorylation may be important for pregenomic-RNA
encapsidation, with S157 being nonessential, and S164 and S172 being
more important, for the process (8). However, in both
studies the levels of RNA encapsidation were determined from particles
in which viral DNA synthesis was allowed to proceed; therefore, some
effects of mutations on encapsidation may have been masked by effects
at later stages of replication.
In the present study, we have unlinked the steps of encapsidation and
DNA synthesis by the provision of a form of polymerase deficient for
reverse transcription, allowing RNA encapsidation but no subsequent DNA
synthesis. We determined the phosphorylation state of intracellular HBV
core protein in unassembled form versus that in
pregenomic-RNA-containing capsids by metabolic labeling and
density gradient ultracentrifugation, showing that core protein is
phosphorylated prior to encapsidation and that no significant change in
the overall level of phosphorylation occurs during encapsidation. Examination of the RNA-encapsidating capacities of HBV core protein variants containing one or more substitutions of Ala or Asp for Ser in
the phosphorylation sites revealed a variety of site-specific effects
on HBV RNA encapsidation, suggesting differential roles of the
individual phosphorylation sites, consistent with an important role for
phosphorylation in the encapsidation process. Examination of the
pregenomic-RNA-encapsidating capacities of DHBV core
protein variants, in which four phosphorylation sites were jointly
mutated, suggested that phosphorylation of DHBV core protein at these
sites may optimize pregenomic-RNA encapsidation but that
its impact is much less profound than in the case of HBV.
Plasmids.
Plasmid CMayw1 (a kind gift of C. Seeger)
contained a 1.1-length HBVayw genome under the control of the
cytomegalovirus (CMV) promoter. Plasmid HBV RT
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Core Protein Phosphorylation Modulates
Pregenomic RNA Encapsidation to Different Extents in Human
and Duck Hepatitis B Viruses
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
(containing a mutation in the reverse transcriptase active center) was
derived from CMayw1 by replacing the PflMI-BsrGI
fragment (nucleotides [nt] 725 to 770 of HBV; the numbering of the
HBVayw sequence follows the designation of Galibert et al.
[3]) with the oligonucleotide pair
5'- TTGGCTTTCAGTTATATGCATGCTGTGGTATTGGGGGCCAAGTCT and
3'-ACAAACCGAAAGTCAATATACGTACGACACCATAACCCCCGGTTCAGACATG (mutated codons are in bold). Plasmid HBV RT
C was created by digestion of HBV RT with
BsgI, followed by treatment with the Klenow fragment of DNA
polymerase I and religation, which resulted in deletion of 7 nt (nt
2037 to 2043 of HBV) and creation of a frameshift, generating a
termination codon in the core open reading frame (ORF) downstream of
the deletion site. Plasmid HBV C Pstop was a derivative
of HBV RT C in which 2 stop codons created
by replacing the BspEI-PshAI fragment (nt 3619 to
3688 of HBV) in HBV RT C with the
oligonucleotide pair
5'-CCGGAAATAACTGTGTTAGACGACGAGGCAGGTCCCCTAGAAGAAGAACTCCCTCGCCTCGCAGACGA and3'-TTTATTGACACAATCTGCTGCTCCGTCCAGGGGATCTTCTTCTTGAGGGAGCGGAGCGTCTGCT, were introduced into the ORF encoding the polymerase.
C was a derivative of plasmid
pUC119.DHBV.CMV (18) (a generous gift from J. Summers), in
which mutations resulting in YMHA-for-YMDD amino acid substitutions in
the reverse transcriptase active center of polymerase were introduced
using PCR, and a stop codon in the core ORF was created by substitution
of an EcoRV-XbaI fragment (nt 2652 to 2662 of
DHBV) with the oligonucleotide pair 5'-ATCTAAGCTT
and 3'-TAGATTCGAAGATC. DHBV C
Pstop was a derivative of DHBV RT C in
which 2 stop codons were introduced into the polymerase ORF by
replacing the XmaI-XhoI fragment (nt 1177 to 1212 of DHBV) with the oligonucleotide pair
5'-CCGGTGATGATCCACTCCTGTGAAATCAGTCTCTCC and
3'-ACTACTAGGTGAGGACACTTTAGTCAGAGAGGAGCT. It also
contained mutations abolishing production of viral surface proteins.
Cells and transfections.
HepG2 cells were maintained in
Dulbecco's modified Eagle's medium (DMEM) supplemented with 10%
fetal bovine serum (FBS), in 12.5-cm2 flasks (Falcon). LMH
cells were maintained in DMEM-F-12 medium supplemented with 10% FBS,
in 6-well plates (Greiner). Cells were transfected with 10 µg of DNA
per flask or well using the calcium phosphate method (5).
For cotransfections, 5 µg of plasmid HBV RT
C or DHBV RT C was mixed with
5 µg of plasmid encoding core protein. When two plasmids encoding
core protein variants were used for cotransfection, they were mixed in
the ratios 1:1 or 1:4 to achieve a total of 5 µg of DNA.
Core protein phosphorylation assay. Three days posttransfection, cells were labeled with [33P]phosphoric acid (Amersham) in phosphate-free DMEM (Gibco) supplemented with 10 nM okadaic acid (Calbiochem) for 6 h. Replicate cells were labeled with [35S]methionine-cysteine (TransLabel; ICN) in methionine- and cysteine-free minimal essential medium (ICN) for 3 h. After labeling, cells were lysed, and core protein was immunoprecipitated with a polyclonal anti-HBV core antibody (Zymed) and protein A-Sepharose (Pharmacia), resolved by sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis (SDS-12% PAGE), and transferred to polyvinyl difluoride (PVDF) membranes (DuPont) for subsequent autoradiography.
To achieve the conditions which would allow normal core protein phosphorylation and nucleocapsid assembly, radioactive labeling commenced immediately after transfection and continued for 54 h, with 1 mCi (0.3 pmol) of [33P]phosphoric acid or 0.24 mCi (0.3 pmol) of [35S]methionine-cysteine per ml, in the presence of a 1,000-fold molar excess of cold phosphate or methionine-cysteine and 5% FBS. Cells were then lysed, and precleared lysates were layered onto 10 to 60% (wt/wt) sucrose step gradients (six 600-µl steps in 50 mM Tris-HCl-50 mM NaCl-50 mM NaF-1 mM EDTA [pH 7.65]). After ultracentrifugation (in an SW60 rotor [Beckman] at 55,000 rpm for 100 min at 4°C), eight fractions were collected from the top, and core protein was immunoprecipitated from each fraction, subjected to SDS-PAGE, and transferred to a PVDF membrane for subsequent autoradiography and phosphorimager analysis (Fuji FLA 2000).RNA encapsidation assay. RNA encapsidation within core protein particles was examined as described previously by Yu and Summers (21) with minor modifications. Transfected cells were lysed in 200 µl of 10 mM Tris-HCl-1 mM EDTA-0.2% NP-40-1 mM phenylmethylsulfonyl fluoride (pH 8.0). Precleared lysates were adjusted to 10 mM magnesium acetate and 0.1 mg of DNase I (Type II; Sigma)/ml and incubated for 30 min at 37°C. The lysates were then precleared and electrophoresed through a 0.8% agarose gel in duplicate 10-µl samples. One replicate was transferred to a Hybond ECL membrane (Amersham) by capillary action in 10 mM Tris-HCl-150 mM NaCl-1 mM EDTA (pH 8.0). Western blotting was performed on the membrane using an anti-HBV core antibody or a rabbit antibody raised against DHBV cores produced in Escherichia coli (a kind gift of A. Jilbert), with enhanced chemiluminescence (ECL) as the method of detection (SuperSignal substrate; Pierce). Another replicate was transferred to a Hybond-N membrane (Amersham) under the same conditions, where encapsidated nucleic acid was released from core protein particles by wetting the membrane in 0.2 M NaOH-1.5 M NaCl for 30 s followed by neutralization in 0.2 M Trizma-HCl-1.5 M NaCl for 1 min. Pregenomic RNA was detected by hybridization with a 32P-labeled DNA probe prepared using the Random Primer Plus Extension Labeling System (Du Pont). Fragments of double-stranded viral DNA used for preparation of the probes (nt 2906 to 490 of HBV or nt 1294 to 2351 of DHBV) were selected so that the probes hybridized with pregenomic RNA, but not with mRNA produced by the plasmids encoding core proteins.
Total cytoplasmic RNA was extracted using an RNeasy kit (Qiagen) according to the instructions of the manufacturer. Electrophoresis of cytoplasmic RNA for Northern blotting was performed in a formaldehyde-1% agarose gel.| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
HBV core protein is phosphorylated both when unassembled and when
in capsids containing pregenomic RNA.
To determine at
which step of HBV nucleocapsid assembly or maturation the core protein
becomes phosphorylated, we first examined whether it may be
phosphorylated prior to viral DNA synthesis. For this purpose we
conducted [33P]phosphoric acid labeling of HepG2 cells
transfected with one of three plasmids: CMayw1, HBV RT,
and HBV RT C. Plasmid CMayw1 produces
mature HBV virions, while HBV RT is a derivative of
CMayw1 in which the encoded polymerase bears the substitution YMHA for
YMDD in the reverse transcriptase active center. This substitution does
not influence encapsidation of the pregenomic RNA but
prevents DNA synthesis (1, 6). Plasmid HBV RT
C is a derivative of HBV RT containing a
mutation (C) abolishing core protein production, which
served as a negative control. Replicate cells from the same
transfections were labeled with [35S]methionine-cysteine
to monitor core protein production. Labeled cells were then lysed, and
core protein was immunoprecipitated from the lysates using an anti-HBV
core antibody and analyzed by SDS-PAGE and autoradiography. As shown in
Fig. 1A, core protein produced by HBV
RT, which consisted of unassembled core protein (dimers
[22]) and pregenomic-RNA-containing
capsids, was phosphorylated to approximately the same extent as core
protein produced by CMayw1, which formed capsids containing both HBV
RNA and DNA. This result clearly demonstrated that, contrary to an
earlier hypothesis (7), HBV core protein is phosphorylated
prior to the initiation of viral DNA synthesis.
|
and
labeled with 33P or 35S under conditions which
would allow normal core protein phosphorylation and
nucleocapsid assembly (see Materials and Methods). Cells were then
lysed, the lysates were sedimented over 10 to 60% (wt/wt) sucrose
gradients and then fractionated, and core protein was immunoprecipitated from each fraction and analyzed by SDS-PAGE and
autoradiography. The results demonstrated that both unassembled core
protein and RNA-containing capsids were phosphorylated (Fig. 1B). By
phosphorimager analysis of the total amounts of core protein (35S) and phosphorylated core protein (33P) in
each fraction, no difference was found between the amounts of phosphate
incorporated in unassembled core protein and in RNA-containing capsids
in this experiment. In two other experiments a twofold difference in
phosphate incorporation between the two forms of core protein was
observed, with an increase in phosphorylation after
assembly in one experiment and a decrease in the other (data not
shown). These results demonstrate that HBV core protein is phosphorylated to similar extents in the form of protein dimers and in
RNA-containing capsids.
Mutations of S155, S162, and S170 in HBV core protein affect pregenomic RNA encapsidation. Because HBV core protein was found to be phosphorylated both before and after pregenomic-RNA encapsidation, we further examined the role of this modification in RNA encapsidation by mutagenesis of core-expressing plasmids. We created a plasmid encoding wild-type HBV core protein and a series of variants containing substitutions of Ala or Asp for Ser in the phosphorylation sites to mimic their unphosphorylated and phosphorylated forms, respectively. The following amino acid combinations were used at the three phosphorylation sites (residues 155, 162, and 170, respectively): SSS (wild type); ASS, DSS, SAS, SDS, SSA, and SSD (individual mutations); ASD, ADS, and SDD (double mutations); and AAA, AAD, ADA, DAA, ADD, DAD, DDA, and DDD (triple mutations).
HepG2 cells were cotransfected with HBV RT
C, providing pregenomic RNA and polymerase,
together with plasmids encoding wild-type or mutant core proteins, such
that nucleocapsids would be formed if the core protein was competent
for HBV RNA encapsidation. Note in particular that the polymerase
provided in trans contained the RT mutation
ablating viral DNA synthesis, which allowed us to isolate the effects
of core protein variants on RNA encapsidation from possible effects at
later stages of replication. Negative controls for the encapsidation
reaction were provided by transfection with HBV RT
C alone (yielding pregenomic RNA and
polymerase but no core protein) and cotransfection of a plasmid
encoding wild-type core protein together with plasmid HBV
C Pstop (yielding core protein particles and
pregenomic RNA, respectively, but no encapsidation due to
the lack of polymerase [1]).
Three days posttransfection, the cells were lysed and HBV RNA
encapsidation within core protein particles was examined as described
previously for DHBV (21). Briefly, duplicate samples of cell
lysates were electrophoresed through a nondenaturing agarose gel and
transferred to nylon and nitrocellulose membranes by capillary action.
The amount of core protein particles in each sample was estimated by
ECL-Western blotting performed on the nitrocellulose membrane, followed
by densitometry. The pregenomic-RNA content of the core
protein particles was estimated by hybridization with a
32P-labeled HBV DNA probe performed on the nylon membrane
after destruction of the particles in situ with alkali and UV fixation of RNA to the membrane. The total amount of pregenomic RNA
produced in transfected cells was estimated by Northern blotting
performed on cytoplasmic RNA extracted from a duplicate flask of cells
from the same transfection. Radioactivity was quantitated by
phosphorimager analysis.
The results demonstrated that amino acid substitutions in
phosphorylation sites did not markedly affect the
production of core protein particles in transfected cells (Fig.
2A), although the differences observed
were consistent in repeated experiments. Therefore, in quantitation of
the results we normalized the amounts of encapsidated
pregenomic RNA by reference to the amounts of the
corresponding core proteins. In contrast, levels of total pregenomic RNA varied within ±30% of the mean between
samples in individual experiments, but these differences were not
related to particular core protein variants in repeated experiments
(data not shown). As such, the mean levels of total
pregenomic RNA for each core protein variant were equal.
|
|
|
Multiple mutations in phosphorylation sites of DHBV
core protein affect pregenomic-RNA encapsidation.
The
remarkable difference between HBV and DHBV in the effects of individual
mutations in phosphorylation sites of the core protein
on pregenomic-RNA encapsidation (our data and reference 21) prompted us to compare the roles of core protein
phosphorylation in RNA encapsidation in the two viruses
in more detail. We created plasmids which encoded DHBV core
proteins in which all the C-terminal phosphorylation sites (T239, S245, S257, and S259) were
replaced with alanine (AAAA) or aspartic acid (DDDD) residues.
The pregenomic RNA-encapsidating capacities of the variant
proteins were tested in cotransfection experiments similar to those
described above for HBV. Briefly, LMH cells were cotransfected with
mixtures of plasmids encoding core protein variants (wild type, AAAA,
or DDDD) and plasmid DHBV RT C, which
contained, under the control of the CMV promoter, a 1.2-length DHBV
genome with mutations abolishing reverse transcription and core protein
production. Transfection with DHBV RT C
alone and cotransfection of a plasmid encoding wild-type core protein
with plasmid DHBV C Pstop were used as negative controls,
as above.
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
The results obtained in this study demonstrated that HBV core protein is phosphorylated to similar extents in the form of protein dimers and after further assembly in pregenomic-RNA-containing capsids. While this does not formally exclude the possibility that core protein dimers may assemble into capsids while in a transiently dephosphorylated state, we believe that it is more likely that core protein is phosphorylated throughout the encapsidation process.
Further investigation of the role of HBV core protein phosphorylation in pregenomic-RNA encapsidation, by examination of the RNA-encapsidating capacities of core protein variants containing individual and multiple substitutions of Ala or Asp for Ser in the phosphorylation sites, revealed a variety of site-specific and synergistic effects of the mutations on HBV RNA encapsidation, ranging from 2-fold enhancement to more than 10-fold inhibition. In the following interpretation of these results, we took into account the fact that limitations of Ala and Asp as substitutes for serine and phosphoserine, respectively, could contribute in some cases to the negative effect on HBV RNA encapsidation. For example, alanine cannot form the hydrogen bonds which could be formed by the hydroxyl group of serine, while aspartic acid residues carry one negative charge instead of the two of a phosphate group, have a different sterical structure, and cannot form the same hydrogen bonds as phosphoserine. However, in the instances when Asp substitution resulted in a much higher level of HBV RNA encapsidation than Ala substitution, we conclude that phosphoserine in that position is preferable to serine, because Asp is a much less conservative change for Ser than is Ala.
Therefore, our results suggest that phosphorylation of S162 in at least a proportion of core protein molecules is required for HBV RNA encapsidation, because the SAS protein containing an individual alanine substitution in this position encapsidated fivefold less HBV RNA than wild-type protein and nearly threefold less than its aspartic acid counterpart (the SDS variant). The roles of S155 and S170 in encapsidation appear to be less crucial than that of S162, because individual mutations in these positions caused much more moderate effects on RNA encapsidation (within twofold of the level in wild-type protein). Phosphoserine in position 170 appears to increase the RNA-encapsidating capacity of core protein, because an individual aspartic acid substitution in this position resulted in nearly twofold-increased levels of RNA encapsidation in comparison with the level for wild-type protein and a threefold increase in comparison with that for the alanine counterpart, and its combination with an Asp substitution in position 162, which individually caused a decrease in RNA encapsidation, resulted in a nearly wild-type RNA-encapsidating capacity of the mutant protein (SDD). Serine might be preferable to phosphoserine in position 155; however, the difference between individual alanine and aspartic acid substitutions in this case is much less convincing than those for the other two phosphorylation sites.
The effects of selected double amino acid substitutions in the phosphorylation sites on RNA encapsidation generally confirmed the results obtained using individual mutations, with nearly wild-type levels of RNA detected within capsids formed by two of three mutant proteins. However, one combination (ASD) had a synergistic negative effect on RNA encapsidation. Such synergistic inhibition of RNA encapsidation by multiple substitutions in the phosphorylation sites was much more pronounced when all three phosphorylation sites were mutated, resulting in a low RNA-encapsidating capacity of the mutant proteins, which could not be improved by coassembly by two mutant proteins or by a mutant protein with wild-type protein.
The dominant-negative effects of the proteins with triple mutations on pregenomic-RNA encapsidation by wild-type protein were similar to the effects previously demonstrated for HBV core protein with the N-terminal pre-C extension (16) and for DHBV core proteins with C-terminal additions (19). The inhibitory role of HBV pre-C-core protein was suggestively explained by the alteration of the protein structure, which renders capsids unable to incorporate pregenomic RNA (16). Our results also suggest that the disruption of protein folding created by three amino acid substitutions may be the cause of the dominant-negative effect of the mutant proteins on HBV RNA encapsidation. However, our data do not exclude an alternative explanation, that HBV RNA encapsidation may require a change in the extent of phosphorylation in the majority, or in all, of the core protein molecules during the process.
The above conclusions regarding the differential roles of the
phosphorylation sites in HBV core protein in
pregenomic-RNA encapsidation largely agree with the
conclusion of Lan and coauthors that S157 is nonessential and S164 and
S172 are more important for the process (8); however, our
results suggest a much more important role for S162 than for S170 and
call into question the insignificance of S155 due to the observed
synergistic effects of the three sites (the different numbering of
amino acids reflects the differences between the virus strains;
adw2 was used in reference 8, and ayw
was used in this study). There is also a striking discrepancy between
the results obtained in the two studies using dicarbonic amino acids as
substitutes for phosphoserine. The triple glutamic acid (EEE)
substitutions in the phosphorylation sites used by Lan
et al. resulted in close to wild-type levels of HBV RNA encapsidation
by the mutant protein, in contrast to the dominant-negative effect on
RNA encapsidation of the DDD variant in this study. Since glutamic acid
seems unlikely to have any advantages over aspartic acid as a
substitute for phosphoserine, we see two possible explanations for the
discrepancy in the results. One is that RNA encapsidation has different
requirements for the arginine-rich domains of core proteins in
different viral strains (adw2 and ayw). The other is
that this discrepancy relates to the linkage between RNA
encapsidation and reverse transcription, which results in degradation
of the encapsidated RNA by RNase H activity. We have used
RT forms of polymerase in these studies to dissociate
encapsidation from later events, so that the amount of encapsidated RNA
is related only to the efficiency of encapsidation. The experiments of
Lan and colleagues were conducted using wild-type polymerase
(8). In the presence of wild-type polymerase, those core
proteins which are competent for encapsidation and also for the support
of reverse transcription will contain amounts of RNA reflecting a
balance between the efficiencies of encapsidation and reverse
transcription. Because EEE mutations were found to abolish reverse
transcription (8), we believe that the amount of
encapsidated RNA could be overestimated compared to that in wild-type
capsids, in which a proportion of the RNA would be degraded.
In the case of DHBV, AAAA and DDDD substitutions in core protein diminished pregenomic-RNA-encapsidating capacity, and the DDDD mutant encapsidated nearly twofold more DHBV RNA than the AAAA mutant; however, the effects of both mutations were much less profound than those of analogous substitutions in HBV. These results, together with the previously published data showing that individual mutations of the phosphorylation sites in DHBV core protein have no effect on pregenomic-RNA encapsidation (21), suggest that phosphorylation of DHBV core protein at these sites may optimize pregenomic-RNA encapsidation but that its impact is much less profound than in the case of HBV.
Our results, combined with published data, provide new information for
elucidation of the function of phosphorylation in the encapsidation process. The previous study of Nassal (13)
demonstrated that coexpression of HBV core protein lacking the
arginine-rich domain together with wild-type core protein resulted in
wild-type levels of pregenomic RNA encapsidation. This
means that intermolecular interactions in nucleocapsid assembly do not
require the presence of the arginine-rich domain in every core protein
molecule. Moreover, the C-terminal part of the domain including S170
can be deleted without any effect on viral RNA encapsidation
(13) (Fig. 5). However, our
results demonstrate that, when the arginine-rich domain is present, its
amino acid sequence in every assembling molecule of core protein (or at
least in the majority of molecules) is crucial for RNA encapsidation,
and S170 has a role in this process as well as the two other
phosphorylation sites.
|
Our hypothesis, therefore, is that phosphorylation plays a dual conformational role in HBV RNA encapsidation. When unphosphorylated, the arginine-rich domain assumes a conformation which obstructs the encapsidation of pregenomic RNA (perhaps in the same way as when all phosphorylation sites are mutated). One role of phosphorylation, therefore, is to create conformational changes which render the protein structure permissive for encapsidation. The N-terminal part of the arginine-rich domain in a proportion of core protein molecules is involved in the interaction with pregenomic RNA and/or polymerase in nucleocapsid assembly, which is indicated by its indispensability for the process (2) (Fig. 5). The second role of phosphorylation may be, therefore, to provide the proper conformation and exposure of the N-terminal part of the domain for intermolecular interactions. The role of phosphoserine 162 might go beyond providing the correct folding of the arginine-rich domain, because individual alanine substitution in this position strongly inhibits RNA encapsidation: it might also participate in ionic intermolecular interactions, since aspartic acid, which is permissive for encapsidation, can substitute for phosphoserine for this type of interaction only.
The difference between HBV and DHBV in the impact of substitutions in phosphorylation sites on pregenomic-RNA encapsidation is likely to be caused by the difference in the locations of these sites in viral core proteins. Phosphorylation sites T239, S245, S257, and S259 of DHBV core protein are located in the C-terminal part of the arginine-rich domain, which is absent in HBV core protein (Fig. 5, aligned with MacVector [Stratagene]). This part of DHBV core protein can be deleted without any effect on viral RNA encapsidation (17). We believe, therefore, that the conformational changes in the arginine-rich domain of DHBV core protein induced by phosphorylation of T239, S245, S257, and S259 (20) may optimize pregenomic-RNA encapsidation but are not crucial for the process. However, it must be noted that not all phosphorylation sites in DHBV core protein have been identified; therefore, the role of core protein phosphorylation in DHBV RNA encapsidation needs further examination.
| |
ACKNOWLEDGMENTS |
|---|
These studies were supported in part by the Research Fund of the Macfarlane Burnet Centre for Medical Research.
We thank C. Seeger and J. Summers for supplying plasmids, A. Jilbert for the antibody, and A. Jaworowski for critical reading of the manuscript.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Hepatitis Research Unit, Macfarlane Burnet Centre for Medical Research, Yarra Bend Rd., Fairfield, Victoria, Australia 3078. Phone: 61 3 9282 2236. Fax: 61 3 9282 2100. E-mail: gazina{at}burnet.edu.au.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. |
Bartenschlager, R.,
M. Junker-Niepmann, and H. Schaller.
1990.
The P gene product of hepatitis B virus is required as a structural component for genomic RNA encapsidation.
J. Virol.
64:5324-5332 |
| 2. | Beames, B., and R. E. Lanford. 1993. Carboxy-terminal truncations of the HBV core protein affect capsid formation and the apparent size of encapsidated HBV RNA. Virology 194:597-607[CrossRef][Medline]. |
| 3. | Galibert, F., E. Mandart, F. Fitoussi, P. Tiollais, and P. Charnay. 1979. Nucleotide sequence of the hepatitis B virus genome (subtype ayw) cloned in E. coli. Nature 281:646-650[CrossRef][Medline]. |
| 4. | Ganem, D. 1996. Hepadnaviridae: the viruses and their replication, p. 2703-2737. In B. Fields, D. M. Knipe, and P. M. Howley (ed.), Virology. Raven Publishers, Philadelphia, Pa. |
| 5. | Gorman, C. 1985. High efficiency gene transfer into mammalian cells, p. 143-190. In D. M. Glover (ed.), DNA cloning: a practical approach. IRL Press, Oxford, United Kingdom. |
| 6. | Hirsch, R. C., J. E. Lavine, L. Chang, H. E. Varmus, and D. Ganem. 1990. Polymerase gene products of hepatitis B viruses are required for genomic RNA packaging as well as for reverse transcription. Nature 344:552-555[CrossRef][Medline]. |
| 7. |
Kann, M., and W. H. Gerlich.
1994.
Effect of core protein phosphorylation by protein kinase C on encapsidation of RNA within core particles of hepatitis B virus.
J. Virol.
68:7993-8000 |
| 8. | Lan, Y. T., J. Li, W.-Y. Liao, and J.-H. Ou. 1998. Roles of the three major phosphorylation sites of hepatitis B virus core protein in viral replication. Virology 259:342-348. |
| 9. | Lanford, R. E., and L. Notvall. 1990. Expression of hepatitis B virus core and precore antigens in insect cells and characterization of a core-associated kinase activity. Virology 176:222-233[CrossRef][Medline]. |
| 10. | Liao, W., and J.-H. Ou. 1995. Phosphorylation and nuclear localization of the hepatitis B virus core protein: significance of serine in the three repeated SPRRR motifs. J. Virol. 69:1025-1029[Abstract]. |
| 11. |
Machida, A.,
H. Ohnuma,
F. Tsuda,
A. Yoshikawa,
Y. Hoshi,
T. Tanaka,
S. Kishimoto,
Y. Akahane,
Y. Miyakawa, and M. Mayumi.
1991.
Phosphorylation in the carboxyl-terminal domain of the capsid protein of hepatitis B virus: evaluation with a monoclonal antibody.
J. Virol.
65:6024-6030 |
| 12. |
Mandart, E.,
A. Kay, and F. Galibert.
1984.
Nucleotide sequence of a cloned duck hepatitis B virus genome: comparison with woodchuck and human hepatitis B virus sequences.
J. Virol.
49:782-792 |
| 13. |
Nassal, M.
1992.
The arginine-rich domain of the hepatitis B virus core protein is required for pregenome encapsidation and productive viral positive-strand DNA synthesis but not for virus assembly.
J. Virol.
66:4107-4116 |
| 14. |
Pugh, J.,
A. Zweidler, and J. Summers.
1989.
Characterization of the major duck hepatitis B virus core particle protein.
J. Virol.
63:1371-1376 |
| 15. |
Roossinck, M. J., and A. Siddiqui.
1987.
In vivo phosphorylation and protein analysis of hepatitis B virus core antigen.
J. Virol.
61:955-961 |
| 16. | Scaglioni, P. P., M. Melegari, and J. R. Wands. 1997. Posttranscriptional regulation of hepatitis B virus replication by the precore protein. J. Virol. 71:345-353[Abstract]. |
| 17. |
Schlicht, H. J.,
R. Batrenschlager, and H. Schaller.
1989.
The duck hepatitis B virus core protein contains a highly phosphorylated C terminus that is essential for replication but not for RNA packaging.
J. Virol.
63:2995-3000 |
| 18. |
Summers, J.,
P. M. Smith,
M. J. Huang, and M. S. Yu.
1991.
Morphogenetic and regulatory effects of mutations in the envelope proteins of an avian hepadnavirus.
J. Virol.
65:1310-1317 |
| 19. | von Weizsacker, F., J. Kock, S. Wieland, W.-B. Offensperger, and H. E. Blum. 1999. Dominant negative mutants of the duck hepatitis B virus core protein interfere with RNA pregenome packaging and viral DNA synthesis. Hepatology 30:308-315[CrossRef][Medline]. |
| 20. |
Yu, M., and J. Summers.
1994.
Phosphorylation of the duck hepatitis B virus capsid protein associated with conformational changes in the C terminus.
J. Virol.
68:2965-2969 |
| 21. |
Yu, M., and J. Summers.
1994.
Multiple functions of capsid protein phosphorylation in duck hepatitis B virus replication.
J. Virol.
68:4341-4348 |
| 22. |
Zhou, S., and D. N. Standring.
1992.
Hepatitis B virus capsid particles are assembled from core-protein dimer precursors.
Proc. Natl. Acad. Sci. USA
89:10046-10050 |
Journal of Virology, May 2000, p. 4721-4728, Vol. 74, No. 10
0022-538X/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Newman, M., Chua, P. K., Tang, F.-M., Su, P.-Y., Shih, C.
(2009). Testing an Electrostatic Interaction Hypothesis of Hepatitis B Virus Capsid Stability by Using an In Vitro Capsid Disassembly/Reassembly System. J. Virol.
83: 10616-10626
[Abstract] [Full Text] -
Nguyen, D. H., Hu, J.
(2008). Reverse Transcriptase- and RNA Packaging Signal-Dependent Incorporation of APOBEC3G into Hepatitis B Virus Nucleocapsids. J. Virol.
82: 6852-6861
[Abstract] [Full Text] -
Nassal, M., Leifer, I., Wingert, I., Dallmeier, K., Prinz, S., Vorreiter, J.
(2007). A Structural Model for Duck Hepatitis B Virus Core Protein Derived by Extensive Mutagenesis. J. Virol.
81: 13218-13229
[Abstract] [Full Text] -
Puro, R., Schneider, R. J.
(2007). Tumor Necrosis Factor Activates a Conserved Innate Antiviral Response to Hepatitis B Virus That Destabilizes Nucleocapsids and Reduces Nuclear Viral DNA. J. Virol.
81: 7351-7362
[Abstract] [Full Text] -
Basagoudanavar, S. H., Perlman, D. H., Hu, J.
(2007). Regulation of Hepadnavirus Reverse Transcription by Dynamic Nucleocapsid Phosphorylation. J. Virol.
81: 1641-1649
[Abstract] [Full Text] -
Takano-Maruyama, M., Ohara, Y., Asakura, K., Okuwa, T.
(2006). Theiler's Murine Encephalomyelitis Virus Leader Protein Amino Acid Residue 57 Regulates Subgroup-Specific Virus Growth on BHK-21 Cells. J. Virol.
80: 12025-12031
[Abstract] [Full Text] -
Law, L. J., Ilkow, C. S., Tzeng, W.-P., Rawluk, M., Stuart, D. T., Frey, T. K., Hobman, T. C.
(2006). Analyses of Phosphorylation Events in the Rubella Virus Capsid Protein: Role in Early Replication Events. J. Virol.
80: 6917-6925
[Abstract] [Full Text] -
Melegari, M., Wolf, S. K., Schneider, R. J.
(2005). Hepatitis B Virus DNA Replication Is Coordinated by Core Protein Serine Phosphorylation and HBx Expression. J. Virol.
79: 9810-9820
[Abstract] [Full Text] -
Wieland, S. F., Eustaquio, A., Whitten-Bauer, C., Boyd, B., Chisari, F. V.
(2005). Interferon prevents formation of replication-competent hepatitis B virus RNA-containing nucleocapsids. Proc. Natl. Acad. Sci. USA
102: 9913-9917
[Abstract] [Full Text] -
Perlman, D. H., Berg, E. A., O'Connor, P. B., Costello, C. E., Hu, J.
(2005). Reverse transcription-associated dephosphorylation of hepadnavirus nucleocapsids. Proc. Natl. Acad. Sci. USA
102: 9020-9025
[Abstract] [Full Text] -
Le Pogam, S., Chua, P. K., Newman, M., Shih, C.
(2005). Exposure of RNA Templates and Encapsidation of Spliced Viral RNA Are Influenced by the Arginine-Rich Domain of Human Hepatitis B Virus Core Antigen (HBcAg 165-173). J. Virol.
79: 1871-1887
[Abstract] [Full Text] -
Kock, J., Nassal, M., Deres, K., Blum, H. E., von Weizsacker, F.
(2004). Hepatitis B Virus Nucleocapsids Formed by Carboxy-Terminally Mutated Core Proteins Contain Spliced Viral Genomes but Lack Full-Size DNA. J. Virol.
78: 13812-13818
[Abstract] [Full Text] -
Robek, M. D., Boyd, B. S., Wieland, S. F., Chisari, F. V.
(2004). Signal transduction pathways that inhibit hepatitis B virus replication. Proc. Natl. Acad. Sci. USA
101: 1743-1747
[Abstract] [Full Text] -
Lu, X., Tran, T., Simsek, E., Block, T. M.
(2003). The Alkylated Imino Sugar, n-(n-Nonyl)-Deoxygalactonojirimycin, Reduces the Amount of Hepatitis B Virus Nucleocapsid in Tissue Culture. J. Virol.
77: 11933-11940
[Abstract] [Full Text] -
Ivanov, K. I., Puustinen, P., Gabrenaite, R., Vihinen, H., Ronnstrand, L., Valmu, L., Kalkkinen, N., Makinen, K.
(2003). Phosphorylation of the Potyvirus Capsid Protein by Protein Kinase CK2 and Its Relevance for Virus Infection. Plant Cell
15: 2124-2139
[Abstract] [Full Text] -
Rabe, B., Vlachou, A., Pante, N., Helenius, A., Kann, M.
(2003). Nuclear import of hepatitis B virus capsids and release of the viral genome. Proc. Natl. Acad. Sci. USA
100: 9849-9854
[Abstract] [Full Text] -
Law, L. M. J., Everitt, J. C., Beatch, M. D., Holmes, C. F. B., Hobman, T. C.
(2003). Phosphorylation of Rubella Virus Capsid Regulates Its RNA Binding Activity and Virus Replication. J. Virol.
77: 1764-1771
[Abstract] [Full Text] -
Chapdelaine, Y., Kirk, D., Karsies, A., Hohn, T., Leclerc, D.
(2002). Mutation of Capsid Protein Phosphorylation Sites Abolishes Cauliflower Mosaic Virus Infectivity. J. Virol.
76: 11748-11752
[Abstract] [Full Text] -
Daub, H., Blencke, S., Habenberger, P., Kurtenbach, A., Dennenmoser, J., Wissing, J., Ullrich, A., Cotten, M.
(2002). Identification of SRPK1 and SRPK2 as the Major Cellular Protein Kinases Phosphorylating Hepatitis B Virus Core Protein. J. Virol.
76: 8124-8137
[Abstract] [Full Text] -
Mabit, H., Breiner, K. M., Knaust, A., Zachmann-Brand, B., Schaller, H.
(2001). Signals for Bidirectional Nucleocytoplasmic Transport in the Duck Hepatitis B Virus Capsid Protein. J. Virol.
75: 1968-1977
[Abstract] [Full Text] -
Riddell, M. A., Li, F., Anderson, D. A.
(2000). Identification of Immunodominant and Conformational Epitopes in the Capsid Protein of Hepatitis E Virus by Using Monoclonal Antibodies. J. Virol.
74: 8011-8017
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»