Previous Article | Next Article 
Journal of Virology, January 2000, p. 173-183, Vol. 74, No. 1
0022-538X/0/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Rainbow Trout Sleeping Disease Virus Is an
Atypical Alphavirus
Stéphane
Villoing,1
Monique
Béarzotti,1
Stefan
Chilmonczyk,1
Jeannette
Castric,2 and
Michel
Brémont1,*
Unité de Virologie et Immunologie
Moléculaires, Institut National de la Recherche Agronomique,
78352 Jouy-en-Josas Cedex,1 and
Laboratoire de Pathologie des Animaux Aquatiques, AFSSA
Brest, Technopole Brest-Iroise, 29280 Plouzané,2 France
Received 18 May 1999/Accepted 20 September 1999
 |
ABSTRACT |
Sleeping disease (SD) is currently a matter of concern for salmonid
fish farmers in most parts of the world. A viral etiology of SD has
recently been suspected, since virus-like particles have been observed
in infected rainbow trout cells. In salmonid-derived cell lines, the
maximal rate of virus production was observed at 10°C, while little
virus was produced at 14°C. Through biochemical, physicochemical, and
morphological studies, SD virus (SDV) was shown to be an enveloped
virus of roughly 60 nm in diameter. The genome consists of 12 kb of
RNA, with the appearance of a 26S subgenomic RNA during the time course
of SDV replication. The screening of a random-primed cDNA library
constructed from the genomic RNA of semipurified virions facilitated
the identification of a specific SDV cDNA clone having an open reading
frame related to the alphavirus E2 glycoproteins. To extend the
comparison between SDV structural proteins and the alphavirus protein
counterparts, the nucleotide sequence of the total 4.1-kb subgenomic
RNA has been determined. The 26S RNA encodes a 1,324-amino-acid
polyprotein exhibiting typical alphavirus structural protein
organization. SDV structural proteins showed several remarkable
features compared to other alphaviruses: (i) unusually large individual
proteins, (ii) very low homology (ranging from 30 to 34%) (iii) an
unglycosylated E3 protein, and (iv) and E1 fusion domain sharing
mutations implicated in the pH threshold. Although phylogenetically
related to the Semliki Forest virus group of alphaviruses, SDV should
be considered an atypical member, able to naturally replicate in lower vertebrates.
| |
INTRODUCTION |
Sleeping disease (SD) syndrome of
farmed freshwater rainbow trout has been observed in France for many
years (4). The most characteristic sign of the disease is
the unusual behavior of the fish, which stay on their side at the
bottom of the tank. Histological observations of diseased fish showed a
chronological appearance of lesions in the pancreas, in the heart, and
in the muscle at the last stage of the disease (5, 6).
Transmission of SD may occur through contact with contaminated tissue
from fish that have SD (5). A viral etiology of SD was
suspected, since virus-like particles were observed in purified
homogenates from kidneys of diseased fish (3). However, all
attempts to isolate a viral agent on commonly available fish cell lines
by inoculating organ homogenates from diseased fish remained
unsuccessful until recently (7). Isolation of SD virus (SDV)
in cell culture was successfully achieved by direct inoculation of
salmonid cell lines (CHSE-214 and RTG-2) with plasma from infected fish.
The characterization of SDV was successfully achieved by optimizing
viral production in tissue culture and by studying several physicochemical features of this virus. Data include the type of
nucleic acid, size, and organization of the SDV genome. The viral
genome has been shown to be an RNA molecule of roughly 12 kb. A cDNA
library has been constructed, and the nucleotide sequencing of
recombinant cDNA clones definitively classified SDV as a member of the
important genus Alphavirus of the family
Togaviridae. The nucleotide sequence data presented in this
report emphasize the unusual characteristics of SDV compared to other
alphaviruses. The generation of a specific SDV anti-E2 rabbit antiserum
from recombinant protein provides a powerful tool for further
epidemiologic studies aiming to evaluate the impact of this virus in
the field.
| |
MATERIALS AND METHODS |
Virus and cells.
The rainbow trout-derived cell line RTG-2
(26) was maintained in Eagle's minimum essential medium
(MEM) (Sigma) buffered at pH 7.4 with Tris-HCl and supplemented with
10% fetal bovine serum (FBS) (Boehringer Mannheim), 50 IU of
penicillin ml
1, and 50 µg of streptomycin
ml1. Cells were propagated in 75- and 150-cm2
plastic cell culture flasks at 20°C. The SDV isolate used in this
study was originally obtained from kidney tissues of infected rainbow
trout and adapted in CHSE-214 cells (7). Other viruses used
included viral hemorrhagic septicemia virus (VHSV) (French strain
07-71) and infectious pancreatic necrosis virus (IPNV) (French strain
Sp), which were isolated in our institute, and salmonid herpesvirus 1 (SaHV1), which was provided through the courtesy of R. P. Hedrick,
University of California, Davis.
Virus titration.
Freshly trypsinized RTG-2 cells were grown
overnight at 20°C in six-well plates. Inoculum for which the titer
was to be determined was diluted from 102 to
107 in Tris-buffered MEM (pH 7.4) and used to infect
cells. Following adsorption, 2 ml of a 0.3% melted agarose solution in
Tris-buffered MEM containing 2% FBS was added to each well. Plates
were incubated at 10°C for 9 days. Agarose was then removed, and
either cells were stained with neutral red and visible plaques were
directly counted or cells were overinfected with the lytic VHSV and
left at 14°C for 2 days. Cells were then fixed with methanol and
stained with crystal violet solution. VHSV-resistant cell foci were
then directly counted.
Electron microscopic examination.
SDV-infected cells were
fixed in 4% glutaraldehyde in 0.1 M cacodylate buffer (pH 7.8) and
then postfixed in 1% cacodylate-buffered osmium tetroxide. After
dehydration, fixed material was embedded in resin and thin sections
were mounted onto copper grids. Sample grids were stained in 2% uranyl
acetate. Grids were examined with a Philips TEM 300 at 60 kV.
Physicochemical studies.
Sensitivity of SDV to lipid solvent
was checked by adding 0.5 ml of chloroform to 1 ml of SDV supernatant.
The mixture was shaken for 30 min at 4°C and then centrifuged at
400 × g for 1 min to remove the chloroform. Titers of
infectious viral particles were then determined on RTG-2 cells. IPNV
(nonenveloped) and VHSV (enveloped) were also included as nonsensitive
and sensitive virus controls, respectively. The influence of pH on SDV
stability was evaluated by adjusting an SDV suspension to pH 3.0 or 11 and incubating for 4 h at 4°C before determining titers of
infectious viral particles on RTG-2 cells. IPNV and VHSV were used as
resistant and sensitive control viruses, respectively. The stability of
SDV to temperature was also investigated by incubating SDV suspension
aliquots for 60 min at temperatures of 10 to 50°C and then
transferring them at 4°C prior to virus titration. Titers of
infectious viral particles were then determined on RTG-2 cells.
Nature of the SDV genome.
Determination of the presence of
RNA or DNA within the SDV genome was examined in growing SDV in the
presence of 5-bromo-2'-deoxyuridine (BrdU) (Sigma) with and without
thymidine (THY) (Sigma). Groups of four wells in each of three 24-well
plates containing RTG-2 cells were inoculated with 100 µl of 100-fold
dilutions of SDV and allowed to absorb for 1 h at 10°C. To each
individual well was added culture medium with or without 1 mM BrdU or
BrdU plus THY (1 mM). An RNA virus (IPNV) and a DNA virus (SaHV-1) were included as controls. The plates were incubated for 14 days at 10°C
(SDV and SaHV-1) or for 3 days at 14°C (IPNV), and examined for
cytopathic effect (CPE). Titers of supernatants of each well were then determined.
Metabolic [5,6-3H]uridine labeling of SDV-infected
cells.
Freshly trypsinized RTG-2 cells were grown overnight in
75-cm2 plastic cell culture flasks. SDV was allowed to
absorb for 1 h at 10°C, and then culture medium containing 2%
FBS was added and the cells were incubated at 10°C for 3 days. The
medium was removed, replaced with fresh medium containing 2% FBS and
actinomycin D (0.5 mg/ml), and incubated for 2 h at 10°C before
[5,6-3H]uridine (final concentration, 100 µCi/ml) was
added to infected and uninfected cells. At 7 days after the
radiolabeling, supernatants and cells were collected and processed for
RNA extraction.
RNA preparation and electrophoresis.
Supernatants from
infected cells were clarified for 15 min at 3,000 × g
and then precipitated overnight at 4°C with polyethylene glycol 6000 (Sigma; 10% final concentration) (16). Pellets were collected by centrifugation at 10,000 × g for 30 min.
The pellets were resuspended in TNE (50 mM Tris [pH 7.4] 100 mM NaCl,
1 mM EDTA), and viral RNA was extracted following SDS-proteinase K treatment for 15 min at 37°C. RNA was recovered following
phenol-chloroform extraction and ethanol precipitation. Total RNAs were
recovered from infected and mock-infected cells by using the Stratagene RNA isolation kit and the manufacturer's procedure. Labeled RNA pellets were resuspended in denaturing buffer (1× MOPS
[morpholinepropanesulfonic acid], 6.4% formaldehyde, 50%
formamide), left for 15 min at 65°C, and cooled on ice. RNAs were
separated on a Tris-borate-EDTA-0.8% agarose gel. An RNA ladder (RNA
low-range marker; Gibco-BRL) was used as a size marker. The gel was
stained with Radiant Red RNA stain (Bio-Rad) and fixed with methanol
during 30 min, processed for fluorography with 1% 2,5-diphenyloxazol
in methanol, and then dried. The gel was subjected to autoradiography.
cDNA synthesis and cloning.
SDV virions were pelleted by
ultracentrifugation for 90 min at 35,000 rpm, and viral genomic RNA was
extracted by the QIAAMP viral RNA kit procedure (Qiagen, Courtaboeuf,
France). The eluted RNA was denatured with hydroxymethyl mercury before
cDNA synthesis. Random cDNA synthesis was done by the procedure
described previously (20). Blunt-ended cDNA was ligated into
EcoRV-digested pBluescript plasmid and used to transform the
XL1 Blue competent Escherichia coli strain. Recombinant
clones were randomly selected, and DNA was sequenced. The sequencing
reactions were carried out on an ABI 373A DNA automatic sequencer with
the DyeDeoxy Terminator-Prism (Applied Biosystems Division of
Perkin-Elmer). A search for homologies against data banks was made by
using the BLAST series program (1). From one cDNA clone
(clone 19 [cl19]) exhibiting homologies with the E2 gene of
alphaviruses, a specific oligonucleotide, SDV3
(5'GGATCCATTCAGATGTGGCGTTGCTATGG3') was derived and used in
a 5' RACE (rapid amplification of cDNA ends) system (Life Technologies, Gibco-BRL). Larger PCR products were gel purified and subcloned in the
pGEM-T vector (Promega). At least three independent clones were
entirely sequenced by using universal primers (T7 and SP6) and by
primer walking.
The cDNA corresponding to the 3' part of the SDV 26S subgenomic RNA was
obtained with a dT15 linker (GAGA-XhoI) primer (Stratagene) to initiate the cDNA reaction, and PCR was conducted with a specific E2-derived primer and a GAGA-XhoI oligonucleotide.
Conditions for PCR were one step at 94°C for 3 min; then 35 cycles of
94°C for 30 s, 50°C for 30 s, and 72°C for 2 min; and a
final extension step at 72°C for 7 min. PCR products were gel
purified and subcloned in the pGEM-T vector (Promega). At least three
independent clones were entirely sequenced.
SDV E2 antiserum.
The insert of SDV cl19 was excised from
pBluescript and subcloned into the pET14b procaryotic expression vector
(Novagen), and the construct was transferred in E. coli
BL21(DE3) strain. By using the pET14b expression vector, six histidine
residues are fused at the N-terminal ends of the recombinant proteins, enabling their purification by metal chelation affinity chromatography. Expression of recombinant proteins was induced by the addition of IPTG
(isopropyl-
-D-thiogalactopyranoside) into log-phase
cultures. An aliquot was analyzed on a sodium dodecyl sulfate
(SDS)-12% polyacrylamide gel and visualized by Coomassie blue
staining. Protein of the expected molecular weight was purified by
using His-bind resin columns (Novagen). Briefly, the cell pellet from 50 ml of induced culture was resuspended in 20 ml of buffer A (5 mM
imidazole, 500 mM NaCl, 20 mM Tris-HCl [pH 7.9]) containing 200 U of
benzonase (Merck) and sonicated. Following centrifugation, the
resulting pellet was resuspended in 5 ml of buffer B containing 6 M
urea. Solubilized proteins were loaded on His-bind resin columns (Novagen) preequilibrated in buffer B plus 6 M urea. Following washes
and elution in buffer C (400 mM imidazole, 500 mM NaCl, 20 mM Tris-HCl
[pH 7.9]), purified recombinant protein was recovered, dialyzed
against phosphate-buffered saline (PBS), and used to immunize a rabbit
three times every 3 weeks (roughly 200 µg/injection). Following the
final boost, the rabbit was bled.
Reactivity of the SDV rabbit anti-E2 serum.
Proteins of
concentrated SDV virions and lysate of E. coli expressing
E2 were separated on an SDS-10% polyacrylamide gel and
electrotransferred onto a ProBlott membrane (Applied Biosystems) in
CAPS (3-[cyclohexylamino]-1-propanesulfonic acid) buffer containing 10% methanol. The membrane was blocked overnight in 3% bovine serum
albumin in PBS and then incubated with anti-E2 serum diluted to 1:500
in PBS-3% bovine serum albumin containing 0.05% Tween 20. The
membrane was washed and incubated with an alkaline
phosphatase-conjugated anti-rabbit immunoglobulin (BYOSIS). Detection
of bound antibodies was accomplished by using the Gibco-BRL nitroblue
tetrazolium-5-bromo-4-chloro-3-indolylphosphate detection kit.
Nucleotide sequence accession numbers.
The nucleotide
sequences of the SDV cDNA cl19 and of 26S subgenomic RNA have been
deposited in the EMBL database under accession no. AJ007631.1 and
AJ238578, respectively.
| |
RESULTS |
SDV optimally replicates at very low temperature.
The
improvement of the viral yield in cell culture was a prerequisite to
any further investigations. Among the numerous fish cell lines
available in our lab, only two salmonid-derived cells (RTG-2 and
CHSE-214) exhibited a visible CPE in some areas of the cell monolayer
following SDV infection (data not shown). The CPE consisted of small
groups of refringent cells with either a twisted or stretched shape, or
with a rounder appearance for some other cells. The more reliable
method to determine the titer of the viral production was a reverse
plaque titration assay in which SDV-infected cells were overinfected
with the lytic VHSV. Cell clusters, corresponding to SDV-infected cells
protected from VHSV infection by the heterologous interference
phenomenon (10), could be accurately counted.
The maximum rate of virus replication was observed at 10°C; the titer
routinely ranged from 10
6 to 10
7 PFU/ml,
whereas at 14°C, the titer was dramastically reduced,
since only few
plaques were observed (Fig.
1). The
strict temperature
dependence was not due to heat lability of the
virus, since incubation
of SDV before infection at temperatures of as
high as 37°C had
no effect on the viral production yield (Table
1). The other
parameters tested relative
to the SDV growth were the pH and viral
yield. Infectivity was totally
lost following exposure at pH 3.0
and was only reduced at pH 11.0 (Table
1). The viral yield was
optimal at 10 days postinfection (p.i.).
View larger version (111K):
[in this window]
[in a new window]
|
FIG. 1.
Comparison of SDV growth in RTG2 cells at 10 and 14°C.
(Rows A to C) RTG-2 cells were infected with serial dilutions of SDV (1 to 105 [columns 1 to 6, respectively]) starting from
the inoculum concentration indicated on the left. Plates were incubated
at 10°C (upper) or 14°C (lower). At 7 days p.i. SDV-infected cells
were overinfected with VHSV, and 3 days later they were overlaid with
agarose. SDV-infected cell foci were visualized following crystal
violet staining. (Rows D) Uninfected cells (except column 1 at 10°C,
where cells were infected only with VHSV).
|
|
SDV is an enveloped virus.
Numerous virus-like, spherical
particles, homogenous in size (60 ± 5 nm) were observed in the
cell cytoplasm of damaged infected cells sampled at 10 days p.i. (Fig.
2). The particles show an inner core of
indefinite structure apparently surrounded by a bilayered lipidic
membrane with short spikes visible on the viral membrane surface. The
majority of the viral particles accumulated in cytoplasmic vesicles. An
inoculum of SDV was subjected to chloroform treatment before infection
of cells to confirm that SDV was an enveloped virus. Table 1 summarizes
the results of that experiment, in which chloroform treatment was done
in parallel with VHSV, a salmonid rhabdovirus, and IPNV, a salmonid
birnavirus, as controls sensitive and resistant to chloroform
treatment, respectively. A significant decrease in infectivity
following exposure of SDV to chloroform was observed, demonstrating the
presence of a lipid-containing envelope in the viral particle.
View larger version (144K):
[in this window]
[in a new window]
|
FIG. 2.
SDV ultrastructural morphology. RTG-2 infected cells
were fixed in 1.25% glutaraldehyde, postfixed in 1% OsO4,
and embedded in Epon by conventional techniques. Thin sections were
stained with uranyl acetate and examined with an electron microscope.
Arrows indicates viral particles. Bars, 100 nm.
|
|
SDV has an RNA genome.
Further characterization of SDV
involved the determination whether DNA or RNA is in the SDV genome.
Initially, an inhibitor of DNA virus replication was used to evaluate
the effect on SDV replication. SDV replication was not affected when
BrdU was added to the culture medium, whereas the replication of the
DNA virus control (SaHV-1) was inhibited (Table
2). The data strongly suggested that the
SDV genome consisted of RNA. The size and type (segmented or not) of
that RNA genome was determined by using labeled RNAs from SDV-infected
cells and from concentrated supernatant which were separated on a gel
and visualized following fluorography. The comparison of the RNAs
extracted from the mock-infected (Fig. 3a, lane 1) and infected (Fig. 3b, lane
2) cells indicated the presence of two additional bands at
approximately 5 and 12 kb in the total RNA extracted from infected
cells. Analysis of RNA extracted from infected cell supernatant also
revealed the presence of a 12-kb viral band (Fig. 3b, lane 2). The
detection of a 12-kb viral genomic RNA and a putative 5-kb subgenomic
viral RNA strongly supports the possibility that SDV belongs to the
Togaviridae (21).
View larger version (30K):
[in this window]
[in a new window]
|
FIG. 3.
Characterization of the SDV genome. (a) Total RNA from
metabolically [5,6-3H]uridine-labeled mock-infected (lane
1) or SDV-infected (lane 2) RTG-2 cells separated on a nondenaturing
agarose gel. (b) RNA extracted from supernatant of mock-infected (lane
1) or SDV-infected (lane 2) cells.
|
|
Molecular cloning of the SDV genome.
Definitive
characterization and grouping of SDV as a member of the
Togaviridae were accomplished through the construction of a
random-primed cDNA library from viral genomic RNA. Recombinant cDNA
clones were randomly selected, and cDNA inserts were used as probes
against the SDV RNA genome. A positive signal was observed for one SDV
cDNA clone (cl19) (Fig. 4, lane 2). The
cDNA of cl19 was sequenced and compared to known sequences in data
banks by using BLAST programs (1). Significant homologies
were detected at both the nucleotide and amino acid levels with part of
the gene and the encoded glycoprotein E2 of all the alphavirus isolates sequenced so far (data not shown).
View larger version (29K):
[in this window]
[in a new window]
|
FIG. 4.
Slot blot hybridization. RNA extracted from
mock-infected (lane 1) or SDV-infected (lane 2) cell supernatants was
spotted onto a nitrocellulose membrane and subjected to hybridization
with 32P-radiolabeled cl19 cDNA insert.
|
|
The complete 26S subgenomic RNA was cloned in a multistep procedure
(Fig.
5), starting from total RNA
extracted from SDV-infected
cells. A GAGA-
XhoI-anchored dT15
primer (Stratagene) was used
to initiate the reverse transcription from
the poly(A) tail. Specific
SDV cDNA was amplified by PCR with a
specific SDV primer derived
from cl19 and a GAGA-
XhoI
primer. A 2-kbp PCR product covering
part of E2, the
6,000-molecular-weight protein (6K), E1, and the
3' untranslated region
was obtained. The 5' untranslated region
together with the capsid (C)
and the E3 regions were recovered
by 5' RACE with the 5'-end sequence
of cl19 as a cDNA primer.
Additionally, by using specific primers, the
complete coding region
of the 26S RNA was recovered by reverse
transcription-PCR as two
overlapping cDNA clones, clP-C/E2 and
clP-E2/E1 (Fig.
5). These
clones were sequenced to ascertain that no
artifactual sequences
were added during the 5' RACE process.
View larger version (6K):
[in this window]
[in a new window]
|
FIG. 5.
Cloning and sequencing strategy for SDV. The initial SDV
cl19 cDNA, cDNA clones clT-E2 and clT-ntr [generated by 5' RACE with
cl19-derived and oligo(dT)-anchored primers, respectively], and cDNA
clones cl-C/E2 and cl-E2/E1 (generated through specific reverse
transcription-PCR) are shown. Three clones from each series were
sequenced by using universal primers and by primer walking.
|
|
Compilation of sequencing data allowed the determination of the total
sequence of the SDV subgenomic RNA encoding the structural
proteins.
Relationships between SDV and other alphaviruses.
The
translated sequence of the 3'-terminal 4,179 nucleotides of the SDV
genome is shown in Fig. 6. This sequence
starts in the region encoding the carboxy terminus of
the nonstructural protein nsp4 and continues through a junction
untranslated region to the start codon of the subgenomic mRNA which
encodes a 1,324-amino-acid p130 polyprotein. The overall organization
of the SDV polyprotein is similar to that for other alphaviruses, as
observed by the presence of proteins similar to capsid, E3, E2, 6K, and
E1, from the amino terminus to the carboxy terminus of the polyprotein. The overall identity of the SDV polyprotein with alphaviruses was 30 to
32%, and the similarity was 47 to 50%, depending on the alphavirus
used for comparison. A phylogenic tree was constructed (Fig.
7), which emphasizes that SDV is more
related to the Semliki Forest virus group of alphaviruses than to the
others. Individual SDV structural proteins have the lowest percentages
of homology among the alphaviruses and exhibit some remarkable
features. A unique feature is the putative size of each individual
processed protein, which is larger than for the other alphaviruses
(Table 3).
View larger version (6173K):
[in this window]
[in a new window]
|
FIG. 6.
Translated nucleotide sequence of SDV 26S RNA and the
extreme C terminus of nsp4. The nucleotide sequence is numbered from
the 3' end of nsp4 gene. Amino acids are numbered from the first Met
capsid residue. Putative polyprotein cleavage site are indicated by
bent arrows. Potential glycosylation sites are indicated by arrows.
Amino acid residues with dots correspond to the transmembrane region.
Underlined residues correspond to the E1 fusion domain. Asterisks
indicate catalytic amino acid triad residues.
|
|
View larger version (13K):
[in this window]
[in a new window]
|
FIG. 7.
Phylogenic tree for the structural polyproteins of
various alphaviruses. The phylogenic tree was generated by using the
ClustalW program (11) and drawn with the TreeView software.
Alphaviruses and accession numbers: SDV, AJ238578; Barmah forest virus
(BFV), AAB40702; Ross river virus (RRV), K00046; Semliki forest virus
(SFV), S42462; Chikungunya virus (CHIKV), AAA53256; O'Nyong-Nyong
virus (ONNV), M20303; EEEV, X63135; VEE virus, L04598; Aura virus
(AURA), S78478; WEE virus, J03854; Sindbis virus (SIN), M13818; Ockelbo
virus (OCK), P27285.
|
|
Capsid protein.
The SDV nucleocapsid is 285 amino acid
residues long (calculated molecular weight of 31,600), slightly larger
than the other alphavirus capsids. The characteristic catalytic triad
amino acid residues forming the serine protease active site i.e.,
H141, D163, and S215 for Sindbis
virus (23), are found at H162, D184,
and S236, respectively, for SDV. The putative autocleavage
site is located at W285 at a consensus site, (E/P) W
(S/T). The N-terminal domain from R68 to
K113 is very rich in K, R, and P residues, similar to the
case for other alphavirus capsid proteins.
The domain described by Wengler et al. (
24) that acts as a
ribosome binding region cannot be found in the SDV core protein.
Whether this element is different for binding to fish cell ribosomes
is
unknown.
E3 signal peptide and E2 glycoprotein.
The signal peptide E3
and the E2 glycoprotein are respectively, 71 and 438 amino acids long
and have respective calculated molecular weights of 7,900 and 47,000. The site of processing between E3 and E2 by a furin-like host cell
protease is thought to be located in the consensus region RKKR X
(17). Surprisingly, no N-glycosylation site can be found in
the SDV E3 protein. The lack of an N-glycosylation site does not appear
to affect the maturation and cleavage of E2, since an SDV E2 having the
expected molecular weight was detected on virions by Western blotting
with anti-E2 SDV antiserum (Fig. 8, lane
2). A variant of the Western equine encephalitis (WEE) virus in which
E3 is not glycosylated has been shown to grow poorly in BHK cells
(22); whether the lack of SDV E3 glycosylation may explain
the relatively poor growth of SDV in lower vertebrate cells remains to
be determined.
View larger version (53K):
[in this window]
[in a new window]
|
FIG. 8.
Immunodetection of SDV E2 glycoprotein. The partial SDV
E2 protein produced in E. coli and concentrated SDV virions
were separated on an SDS-12% polyacrylamide gel, transferred onto a
polyvinylidene difluoride membrane, and incubated with a rabbit E2
antiserum. Lane 1, recombinant E. coli E2 protein; lane
2, SDV virions. Positions of molecular weight markers (in thousands)
are indicated on the left.
|
|
The E2 protein has a single N-linked glycosylation site at
N
319 from the amino terminus of the E2 protein. A highly
hydrophobic
region, presumably representing the transmembrane domain,
was
detected at the carboxy end from amino acid residue 380 to 404,
followed by 34 residues of cytoplasmic tail domain encompassing,
near
the end, 2 cysteine residues. These two Cys residues are
conserved in
all alphaviruses and have been predicted to be the
acylation sites by
the addition of palmytic acid (
12). The motif
TPY is
strictly conserved in the E2 endo domains of all alphaviruses;
this TPY
motif has been shown to be a site for phosphorylation
and to play a
role in capsid binding to the E2 endo domain (
15).
The
cytoplasmic tail of the SDV E2 glycoprotein does not have
such a TPY
motif but rather has one tyrosine and three threonine
residues, located
at different places, which may serve as phosphorylation
sites.
SDV 6K equivalent and E1 glycoprotein.
The short protein is 68 amino acids long and has a calculated molecular weight of 7,500, an
unusually large size for a "6K" protein. The putative signalase
cleavage site (A YE) at the carboxy end of 6K is very conserved
among all alphaviruses and was also found for SDV. The mature E1
product is 462 amino acid long and possesses a unique N-linked
glycosylation site at N35. N35 is a unique
position compared to the case for other alphaviruses, where the
N-glycosylation site is usually located at least 130 amino acid
residues from the amino terminus. The transmembrane domain is
presumably located at amino acid residues 430 to 450, followed by a
short cytoplasmic tail very rich in charged amino acids (K and R). A
unique feature for SDV E1 is the putative fusion domain (Fig.
9), which is highly conserved among
alphaviruses and also for SDV, with the exception of two particular
glycine residues which have been described by Levi-Mintz and Kielan
(14). When these Gly residues are replaced, the threshold of
the pH for fusion is shifted to a more acidic range. Both glycine
residues are replaced in SDV, by N94 and A102
respectively. It is expected that the fusion process for SDV takes
place more efficiently at a pH ranging from 5.0 to 5.4.
View larger version (46K):
[in this window]
[in a new window]
|
FIG. 9.
Multiple-sequence alignment of the E1 fusion domain. The
SDV E1 putative fusion domain was aligned with some alphavirus E1
glycoproteins by using Multalin software (9). Abbreviations
and accession numbers are as described in the legend to Fig. 7.
Asterisks and colons represent identical and similar amino acids,
respectively. Residues in boldface are the invariant amino acids in all
viruses except SDV (see text).
|
|
Untranslated regions of the 26S RNA.
The nucleotide sequence
corresponding to the junction region between the nsp4 end and the
beginning of the structural proteins has been compared to the
equivalent regions of other alphaviruses. That region is expected to be
more or less conserved, since it contains important regulatory elements
for transcription of the subgenomic mRNA. Figure
10a shows that with the exception of
three nucleotide changes invariant in all alphaviruses, there is an overall conservation of the consensus junction region in SDV.
View larger version (21K):
[in this window]
[in a new window]
|
FIG. 10.
Multiple-sequence alignment of the junction region and
the 3' untranslated region. (a) Nucleotide sequences of the junction
regions of SDV and several alphaviruses were aligned. Nucleotides
conserved with those of SDV are indicated with dots. The three
invariant nucleotides which are modified in the SDV sequence are
indicated with asterisks. (b) Alignment of consensus 19-nucleotide
3'-end sequences of SDV and several alphaviruses (19). Dots
indicate conserved nucleotides. Dashes have been introduced to optimize
the alignment. Abbreviations are as described in the legend to Fig. 7.
BEB, Bebaru; UNA, Una; BCR, Buggy Creek; MID, Middelburg.
|
|
Similarly, the extreme 3' end of the SDV subgenomic RNA was compared to
the ends of several alphaviruses, since it is hypothesized
that this
region serves as a promoter for initiation of minus-strand
RNA
synthesis on the plus-strand template. As shown in the
multiple-sequence
alignment in Fig.
10b, a significant conservation of
this region
exists in SDV, although there are three additional
nucleotides
before the poly(A) tail. The untranslated region is rather
short
(90 nucleotides), one of the shorter described. No repeated
sequence
elements can be detected in this region, but these elements do
not seem to be essential for alphavirus growth in vitro
(
13).
| |
DISCUSSION |
In the present study, we have for the first time characterized and
assigned to the alphavirus subfamily the viral agent (SDV) responsible
for SD in rainbow trout. The finding that SDV replicated in cell
culture at low temperature substantiated the temperature dependence of
SDV growth in fish. Natural outbreaks of SD and experimental disease
transmission to rainbow trout appeared almost exclusively at 10°C.
The strict temperature growth restraint was not related to stability of
the SDV particles, since following incubation at 37°C, SDV was still
infectious. It can be hypothesized that temperatures higher than 10°C
may affect the correct folding of viral proteins and most probably the
glycoproteins during the time course of viral replication and particle
assembly through the replication cycle in cells. Similar observations
were made for VHSV. VHSV is capable of replicating at temperatures
higher than 20°C; however, the VHSV glycoprotein is no longer
expressed at the cell surface but remains fully expressed in the
cytoplasm (M. Béarzotti and M. Brémont, unpublished data).
The CPE induced in SDV-infected tissue culture cells, even 10 days
p.i., remained incomplete and was confined to localized areas of the
cell monolayer when a low multiplicity of infection (0.1) was used. The
lack of obvious CPE at a low multiplicity of infection may explain why
during the past 10 years no virus was recovered from SD outbreaks, even
though several attempts to isolate a virus were made.
SD has been estimated to affect roughly 30% of the fish farms in
Brittany; however, that estimate is unreliable, since it has been
mainly supported by the observations of the particular behavior of fish
in tanks and by some histological studies of moribund fish, for which
it is sometimes difficult to discriminate between the similar
pancreatic lesions induced by SDV and IPNV, a salmonid birnavirus. The
generation of specific SDV polyclonal antibodies, such as anti-E2,
which reacts against SDV-infected cells as soon as 6 days p.i. (data
not shown), will permit future clarification of the situation in the
field and facilitate a survey of the epidemiologic status of SDV in
fish farms.
Several lines of evidence suggest that SDV belongs to the
Togaviridae, including (i) electron microscopic examinations
of infected cells, which revealed numerous enveloped viral particles of
roughly 60 nm in diameter, and (ii) studies on the viral genome, which
demonstrated the presence of a 12-kb genomic RNA and a 5-kb subgenomic
RNA in infected cells.
The cloning and nucleotide sequencing of the 4.1 kb at the 3' end of
the SDV genome confirmed that SDV belongs to the Alphavirus genus. The organization of the polyprotein is similar to that for other
alphaviruses, and putative cleavage sites for the processing of the
structural proteins were conserved in SDV. The main differences were in
the sizes of the individual proteins, which were larger than those of
other alphaviruses, and in the low percentage of amino acid identity
between SDV and other alphavirus proteins, with the exception of some
functional residues such as the serine-like protease catalytic triad
(H, D, and S) in the capsid protein. Untranslated regions at the 5' and
3' ends of the subgenomic RNA are, in contrast, rather conserved, which
emphasizes the role of these regions in the replication process of the
alphaviruses. Although alphaviruses are usually transmitted by
arthropods (8), it is unlikely that a mosquito serves as a
reservoir for SDV, since direct transmission from fish to fish has been
experimentally demonstrated by cohabition experiments (2).
Very recently, an alphavirus, salmon pancreas disease virus (SPDV),
infecting Salmon salar has been described (18,
25). SDV and SPDV seem to be closely related, and it will be of
interest to carefully compare SDV and SPDV sequences to evaluate if
these novel atypical alphaviruses may represent a new group in the
Alphavirus genus, specific for lower vertebrates, which
could represent the alphaviruses ancestors, since, interestingly,
Eastern equine encephalitis (EEE) virus, WEE virus, and Venezuelan
equine encephalitis (VEE) virus are able to replicate in salmonid cell
lines (27).
| |
ACKNOWLEDGMENTS |
We are grateful to F. Baudin-Laurencin (AFSSA Brest,
Plouzané, France), C. Chastel (Université de Bretagne,
Brest, France), and P. de Kinkelin (INRA, Jouy-en-Josas, France) for
helpful suggestions during the study. Scott Kramer (INRA,
Jouy-en-Josas, France) is gratefully acknowledged for critical reading
of the manuscript. We are also grateful to P. Vende for the nucleotide
sequencing data.
S.V. is a Ph.D. student financially supported by AFSSA and INRA.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Unité de
Virologie et Immunologie Moleculaires, Institut National de la
Recherche Agronomique, 78352 Jouy-en-Josas Cedex, France. Phone: 33 (1) 34 65 26 15. Fax: 33 (1) 34 65 26 21. E-mail:
bremont{at}biotec.jouy.inra.fr.
| |
REFERENCES |
| 1.
|
Altschul, S. F.,
T. L. Madden,
A. A. Schaffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402[Abstract/Free Full Text].
|
| 2.
|
Boucher, P.
1995.
Ph.D. thesis.
Université de Rennes I, Rennes, France
|
| 3.
|
Boucher, P.,
J. Castric, and F. Baudin-Laurencin.
1994.
Observation of virus-like particles in rainbow-trout Oncorhynchus mykiss infected with sleeping disease virulent material.
Bull. Eur. Assoc. Fish Pathol.
14:215-216.
|
| 4.
|
Boucher, P., and F. Baudin-Laurencin.
1994.
Sleeping disease of salmonids.
Bull. Eur. Assoc. Fish Pathol.
14:179-180.
|
| 5.
|
Boucher, P.,
A. Le Ven, and F. Baudin-Laurencin.
1995.
Transmission experimentale de la maladie du sommeil: histologie et caracterisation de l'agent infectieux.
Nouvelles Sci. Technol.
13:115-117.
|
| 6.
|
Boucher, P., and F. Baudin-Laurencin.
1996.
Sleeping disease and pancreas disease comparative histopathology and acquired cross-protection.
J. Fish Dis.
19:303-310[CrossRef].
|
| 7.
|
Castric, J.,
F. Baudin-Laurencin,
M. Brémont,
J. Jeffroy,
A. Le Ven, and M. Béarzotti.
1997.
Isolation of the virus responsible for sleeping-disease in experimentally infected rainbow-trout Oncorhynchus Mykiss.
Bull. Eur. Assoc. Fish Pathol.
17:27-30.
|
| 8.
|
Chamberlain, R. W.
1980.
Epidemiology of arthropod-borne togaviruses: the role of arthropods as hosts and vectors and of vertebrate hosts in natural transmission cycles, p. 175-227.
In
R. W. Schlesinger (ed.), The togaviruses: biology, structure, replication. Academic Press, Orlando, Fla
|
| 9.
|
Corpet, F.
1988.
Multiple sequence alignment with hierarchical clustering.
Nucleic Acids Res.
16:10881-10890[Abstract/Free Full Text].
|
| 10.
|
Fukusho, A.,
N. Ogawa,
H. Yammamoto,
M. Sawada, and H. Sazawa.
1976.
Reverse plaque formation by hog cholera virus of the GPE-strain inducing heterologous interference.
Infect. Immun.
14:332-336[Abstract/Free Full Text].
|
| 11.
|
Higgins, D.,
J. Thompson,
T. Gibson,
J. D. Thompson,
D. G. Higgins, and T. J. Gibson.
1994.
CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.
Nucleic Acids Res.
22:4673-4680[Abstract/Free Full Text].
|
| 12.
|
Ivanova, L., and M. J. Schlesinger.
1993.
Site-directed mutations in the Sindbis virus E2 glycoprotein identify palmitoylation sites and affect virus budding.
J. Virol.
67:2546-2551[Abstract/Free Full Text].
|
| 13.
|
Kuhn, R. J.,
Z. Hong, and J. H. Strauss.
1990.
Mutagenesis of the 3' nontranslated region of Sindbis virus RNA.
J. Virol.
64:1465-1476[Abstract/Free Full Text].
|
| 14.
|
Levi-Mintz, P., and M. Kielan.
1991.
Mutagenesis of the putative fusion domain of the Semliki Forest virus spike protein.
J. Virol.
65:4292-4300[Abstract/Free Full Text].
|
| 15.
|
Liu, L. N.,
H. Lee,
R. Hernandez, and D. T. Brown.
1996.
Mutations in the endo domain of Sindbis virus glycoprotein E2 block phosphorylation, reorientation of the endo domain, and nucleocapsid binding.
Virology
222:236-246[CrossRef][Medline].
|
| 16.
|
Magar, R., and J. Lecomte.
1987.
Comparison of methods for concentration and purification of bovine viral diarrhea virus.
J. Virol. Methods
16:271-279[CrossRef][Medline].
|
| 17.
|
Mayne, J. T.,
C. M. Rice,
E. G. Strauss,
M. W. Hunkapiller, and J. H. Strauss.
1984.
Biochemical studies of the maturation of the small Sindbis virus glycoprotein E3.
Virology
134:338-357[CrossRef][Medline].
|
| 18.
|
Nelson, R. T.,
M. F. McLoughlin,
H. M. Rowley,
M. A. Platten, and J. I. McCormick.
1995.
Isolation of a toga-like virus from farmed Atlantic salmon Salmo salar with pancreas disease.
Dis. Aquat. Org.
22:25-32.
|
| 19.
|
Pfeffer, M.,
R. M. Kinney, and O. R. Kaaden.
1998.
The alphavirus 3'-nontranslated region: size heterogeneity and arrangement of repeated sequence elements.
Virology
240:100-108[CrossRef][Medline].
|
| 20.
|
Rutledge, R. G.,
V. I. Seligy,
M. J. Cote,
K. Dimock,
L. L. Lewin, and M. P. Tenniswood.
1988.
Rapid synthesis and cloning of complementary DNA from any RNA molecule into plasmid and phage M13 vectors.
Gene
68:151-158[CrossRef][Medline].
|
| 21.
|
Schlesinger, S., and M. J. Schlesinger.
1996.
Togaviridae: the viruses and their replication, p. 825-841.
In
B. N. Fields, D. M. Knipe, P. M. Howley, et al. (ed.), Fields virology, 3rd ed. Lipincott-Raven Publishers, Philadelphia, Pa
|
| 22.
|
Simizu, B.,
K. Hashimoto, and I. Ishida.
1983.
A variant of western equine encephalitis virus with nonglycosylated E3 protein.
Virology
125:99-106[CrossRef][Medline].
|
| 23.
|
Strauss, J. H., and E. G. Strauss.
1990.
Alphavirus proteinases.
Semin. Virol.
1:347-356.
|
| 24.
|
Wengler, G.,
D. Wurkner, and G. Wengler.
1992.
Identification of a sequence element in the alphavirus core protein which mediates interaction of cores with ribosomes and the disassembly of cores.
Virology
191:880-888[CrossRef][Medline].
|
| 25.
|
Weston, J. H.,
M. D. Welsh,
M. F. McLoughlin, and D. Todd.
1999.
Salmon pancreas disease virus, an alphavirus infecting farmed atlantic salmon, salmo salar L.
Virology
256:188-195[CrossRef][Medline].
|
| 26.
|
Wolf, K., and M. C. Quimby.
1962.
Established eurythermic line of fish cells in vitro.
Science
135:1065-1066[Abstract/Free Full Text].
|
| 27.
|
Wolf, K., and J. A. Mann.
1980.
Poikilotherm vertebrate cell lines and viruses: a current listing for fishes.
In Vitro
16:168-179[Medline].
|
Journal of Virology, January 2000, p. 173-183, Vol. 74, No. 1
0022-538X/0/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Moriette, C., LeBerre, M., Lamoureux, A., Lai, T.-L., Bremont, M.
(2006). Recovery of a recombinant salmonid alphavirus fully attenuated and protective for rainbow trout.. J. Virol.
80: 4088-4098
[Abstract]
[Full Text]
-
Moriette, C., LeBerre, M., Boscher, S. K., Castric, J., Bremont, M.
(2005). Characterization and mapping of monoclonal antibodies against the Sleeping disease virus, an aquatic alphavirus. J. Gen. Virol.
86: 3119-3127
[Abstract]
[Full Text]
-
Weston, J., Villoing, S., Bremont, M., Castric, J., Pfeffer, M., Jewhurst, V., McLoughlin, M., Rodseth, O., Christie, K. E., Koumans, J., Todd, D.
(2002). Comparison of Two Aquatic Alphaviruses, Salmon Pancreas Disease Virus and Sleeping Disease Virus, by Using Genome Sequence Analysis, Monoclonal Reactivity, and Cross-Infection. J. Virol.
76: 6155-6163
[Abstract]
[Full Text]
-
Powers, A. M., Brault, A. C., Shirako, Y., Strauss, E. G., Kang, W., Strauss, J. H., Weaver, S. C.
(2001). Evolutionary Relationships and Systematics of the Alphaviruses. J. Virol.
75: 10118-10131
[Abstract]
[Full Text]
-
La Linn, M., Gardner, J., Warrilow, D., Darnell, G. A., McMahon, C. R., Field, I., Hyatt, A. D., Slade, R. W., Suhrbier, A.
(2001). Arbovirus of Marine Mammals: a New Alphavirus Isolated from the Elephant Seal Louse, Lepidophthirus macrorhini. J. Virol.
75: 4103-4109
[Abstract]
[Full Text]
-
Wielgosz, M. M., Raju, R., Huang, H. V.
(2001). Sequence Requirements for Sindbis Virus Subgenomic mRNA Promoter Function in Cultured Cells. J. Virol.
75: 3509-3519
[Abstract]
[Full Text]
Top
Abstract
Introduction
