Previous Article | Next Article 
Journal of Virology, September 1999, p. 7745-7751, Vol. 73, No. 9
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Adenovirus-Mediated Expression of a Ribozyme to c-myb
mRNA Inhibits Smooth Muscle Cell Proliferation and Neointima
Formation In Vivo
Dennis G.
Macejak,1,*
Hua
Lin,2
Saiphone
Webb,1
Jennifer
Chase,1
Kristi
Jensen,1
Thale C.
Jarvis,1
Jeffrey M.
Leiden,2 and
Larry
Couture1,
Ribozyme Pharmaceuticals, Inc., Boulder,
Colorado 80301,1 and Departments of
Medicine and Pathology, University of Chicago, Chicago, Illinois
606372
Received 16 March 1999/Accepted 18 May 1999
 |
ABSTRACT |
Smooth muscle cell (SMC) proliferation is an important component of
restenosis in response to injury after balloon angioplasty. Inhibition
of proliferation in vivo can limit neointima hyperplasia in animal
models of restenosis. Ribozymes against c-myb mRNA have been shown to be effective inhibitors of SMC proliferation in vitro.
The effectiveness of adenovirus as a gene therapy vector in animal
models of restenosis is well documented. In order to test the utility
of ribozymes to inhibit SMC proliferation by a gene therapy approach,
recombinant adenovirus expressing ribozymes against c-myb
mRNA was generated and tested both in vitro and in vivo. This
adenovirus ribozyme vector is shown to inhibit SMC proliferation in
culture and neointima formation in a rat carotid artery balloon injury
model of restenosis.
| |
INTRODUCTION |
Vascular smooth muscle cells (SMC)
are an important component of normal arterial function (15).
These cells reside in the media in a nonproliferative (G0)
state. Arterial injury results in activation and migration of SMC from
the media into the intimal layer of the arterial wall, with subsequent
SMC proliferation and extracellular matrix deposition (7,
15). This SMC response to injury has been implicated in
restenosis following percutaneous transluminal angioplasty (PTA) and is
reported to occur following 30 to 50% of all PTA procedures (7,
15). Although the rate of restenosis in stented arteries is
reduced, in-stent restenosis also appears to be mediated primarily by
SMC proliferation (11).
Several strategies have been used to restrict cell cycle progression of
quiescent SMC upon growth factor stimulation. For example, expression
of a nonphosphorylatable analog of the retinoblastoma protein
arrests SMC in G0/G1 (3).
Adenovirus-mediated overexpression of the cyclin/cyclin-dependent
kinase inhibitor p21 arrests vascular SMC in G1
(2). In addition, antisense oligonucleotides directed against either proliferating cell nuclear antigen, Cdc2, or
c-myb transcripts appear to affect SMC growth in vivo
(16, 20).
Recently, chemically synthesized hammerhead ribozymes targeting the
mRNA of the transcription factor c-myb have been shown to be
efficient inhibitors of SMC proliferation in vitro (9). Effective delivery of a synthetic ribozyme to prevent restenosis would
require prolonged residence of the ribozyme in the arterial wall, since
SMC proliferation continues days to weeks after PTA (3, 17).
Alternatively, long-term expression of ribozymes could be achieved with
a gene therapy approach. Ribozymes have been developed for ex vivo gene
therapy (4, 5) but would require in vivo application to
prevent restenosis following PTA. To test the feasibility of a gene
therapy approach with ribozymes in an in vivo model of human disease,
we have generated a replication-deficient adenovirus vector expressing
a ribozyme directed against c-myb mRNA and demonstrate its
efficacy both in vitro and in a rat carotid artery balloon injury model.
| |
MATERIALS AND METHODS |
Plasmid construction and adenovirus generation.
The mouse U6
gene (obtained from J. Dahlberg, University of Wisconsin, Madison) was
amplified via PCR with oligonucleotides (AAGTCGACCGACGCCGCCATCTCTA
and AACCATGGAAAAAGCTTGAATTCTAGTATATGTGCTGC) and cloned
into pGEM5Z (Promega) to create EcoRI and
HindIII sites between nucleotide 27 of U6 RNA and an RNA
polymerase III termination signal.
Oligonucleotides (AATTCATTGTTTTCCCTGATGAGGCCGAAAGGCCGAAATTCTCCC CTA
and AGCTTAGGGGAGAATTTCGGCCTTTCGGCCTCATCAGGGAAAACAATG)
encoding the ribozyme were designed to generate
EcoRI/HindIII ends upon annealing and
were inserted into the pGEMU6 plasmid. The U6+27Rz transcription unit
was then reamplified with oligonucleotides (AAAGAAGATCTCCGACGCCGCCATCTCTA and
GGGATCCGGCGAATTGGGCCCGAC) to create
BglII/BamHI ends, which were used for
insertion into the BamHI site of an E1-deleted adenovirus
transfer plasmid. All plasmid inserts were verified by sequencing.
Replication-defective adenovirus vectors were generated by homologous
recombination between plasmid DNA and E1-deleted adenovirus DNA in 293 cells as described previously (18). Recombinant virus was
plaque purified three to five times, and high-titer virus stocks were
prepared by infecting 293 cells. Adenovirus was purified from 293 cell
lysates by a two-step CsCl gradient centrifugation procedure. Viral
titers were determined by plaquing on 293-G cells. Viral stocks
contained <1 replication-competent virus in 108 PFU as
determined by an A547 cell assay.
In vitro cleavage assay.
For in vitro cleavage analysis, the
ribozyme was amplified with oligonucleotides to generate a T7 RNA
polymerase promoter template. RNA was then transcribed in vitro (Ambion
Megashortscript) and gel purified. Ribozyme RNA was renatured in
cleavage buffer (10 mM MgCl2, 50 mM Tris-HCl [pH 7]) for
5 min at 65°C, followed by 10 min at 37°C, prior to incubation with
a 32P-labeled RNA substrate containing the cleavage site.
The cleavage reaction was performed under single-turnover conditions in
ribozyme excess and analyzed by denaturing polyacrylamide gel
electrophoresis (PAGE). Activity of chemically synthesized ribozyme to
site 575 was described previously (1). For cleavage analysis
of 293 cell lysates (21), total cellular RNA was isolated
from cells 48 h after mock or virus infection. Total RNA (5 µg)
was incubated with 32P-labeled RNA substrate in cleavage
buffer for 24 h and analyzed by denaturing PAGE.
RNA analysis.
For ribozyme RNA analysis, cells were mock or
virus infected for 1 h. Total RNA was isolated 48 h later and
analyzed by Northern blot analysis of RNA separated on a 6%
polyacrylamide denaturing gel as described previously (21).
The blot was probed with an antisense riboprobe specific for the
U6+27Rz transcript generated from the pGemU6+27Rz plasmid. For
c-myb and glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
mRNA analysis, RNA was isolated 12 h after serum stimulation and
quantified by quantitative competitive (QC)-PCR as described previously
(9). The competitor RNA for c-myb was derived
from a fragment of rat cDNA containing a deletion of 50 bases. The
GAPDH competitor was derived from plasmid pTRI-GAPDH (Ambion) and also
contained a 50-base deletion. Primer annealing was performed at 50°C.
The concentration of c-myb and GAPDH RNAs in each sample was
determined from a nonlinear, least-squares fit of the percent
competitor in the PCR products versus the amount of input competitor
RNA over the entire series of competitor dilutions made against a given
target sample. Error bars indicate range of duplicate samples. The
Student t test was used to calculate P values.
Proliferation assay.
Rat SMC were isolated from aortic
tissue explants from female rats and grown in Dulbecco's minimal
essential medium as described previously (9). Human SMC were
obtained from Clonetics and grown as recommended. The bromodeoxyuridine
(BrdU) incorporation assay was performed as described previously
(9). Briefly, 5 × 103 rat SMC or 1 × 104 human SMC were plated per well of a 24-well plate in
growth medium. After 24 h, growth medium was replaced with
starvation medium containing 0.5% serum. Forty-eight hours later,
cells were infected with virus diluted in starvation medium for 1 h in a total volume of 100 µl per well. Starvation conditions
proceeded for an additional 24 h. Cells were then stimulated with
the addition of 10% serum, and BrdU was added at a final concentration
of 10 µM. Cells were incubated for 20 to 24 h, fixed with 10%
methanol, and stained for BrdU. A minimum of 400 cells per well were
scored microscopically, and the percent of proliferating cells was
determined. Error bars represent the range of duplicate wells. For Syto
13 staining, SMC were treated as described above, except that BrdU was
not added and cells were grown for 3 days after 10% serum stimulation. Medium was then removed, and a 1:2,000 dilution of Syto 13 (Molecular Probes) was added for 20 min at 37°C. Stained cells were quantified on a fluorimeter (Labsystems Fluoroskan Ascent). The Student
t test was used to calculate P values.
Cell cycle analysis.
SMC were treated as described above for
proliferation assays but were treated with propidium iodide 24 h
after infection by using a PI-STAIN kit (Sigma) according to the
manufacturer's instructions. Stained cell preparations were scanned on
a Becton Dickinson FACScan instrument and analyzed for cell cycle by ModFitLT.
Rat carotid balloon injury model.
The rat carotid artery
model of balloon angioplasty followed by recombinant virus
administration was performed as described previously (2, 3).
Briefly, Sprague-Dawley rats were subjected to balloon angioplasty of
the left common carotid artery by dilatation with a Fogarty catheter.
Immediately following injury, 2 × 109 PFU of
Ad/U6+27Rz, Ad/U6+27RzM, or Ad/U1 control virus in a volume of
50 to 100 µl was instilled into a 1-cm segment of the distal common
carotid artery for 5 min by using a 24-gauge intravenous catheter. Rat
carotid arteries were harvested 20 days after balloon injury and
adenovirus infection. Tissue sections were stained with hematoxylin and
eosin. Intimal and medial boundaries were determined by digital
planimetry of tissue sections. Areas and ratios were determined from
four to six stained sections of each artery spanning the 1-cm site of
balloon injury. The Student t test was used to calculate
P values. All animal experimentation was performed in
accordance with National Institutes of Health guidelines at the
University of Chicago or at Coromed Inc., Troy, N.Y.
| |
RESULTS |
Expression of a ribozyme in an adenovirus vector.
To
test the ability of an adenovirus vector expressing a ribozyme
targeting c-myb mRNA to inhibit SMC proliferation, we first cloned a ribozyme directed to cleave c-myb mRNA at
nucleotide 575 (based on the human c-myb sequence) into an
expression vector. Because RNAs contain extensive secondary structure
and are bound intracellularly by proteins, accessible sites for
ribozyme cleavage may be limiting in target RNA molecules. The 575 site
is conserved in both rat and human c-myb mRNA and has been
shown to be accessible to ribozyme targeting in rat and human SMC
(9).
Expression of RNA from eukaryotic promoters often results in the
addition of flanking sequences (e.g., the polyadenylation site and
polyadenylate end of RNA polymerase II mRNAs). However, extraneous
nucleotide sequence flanking a ribozyme can have a profound effect on
in vitro cleavage activity (21). We have analyzed ribozyme
expression and efficacy in a variety of contexts and transcription
units. To express ribozymes with minimal flanking sequence, we utilized
the U6 RNA promoter that is extragenic except for the first G and
requires only a stretch of four U residues for termination
(12). The U6 RNA ribozyme expression vector described in
these studies, U6+27Rz, includes the first 27 nucleotides from the
5' end of U6 RNA. This sequence provides 5'-end stability by signaling
methylation of the first ribose (19). To check that ribozyme
cleavage activity was not compromised by flanking sequences in the
U6+27 transcription unit, RNA containing the first 27 nucleotides
of U6 RNA, nucleotides derived from an EcoRI cloning site,
the c-myb site 575 ribozyme, nucleotides derived from a
HindIII site, and a UUUU termination (Fig.
1A) was synthesized by T7 polymerase in
vitro. The in vitro cleavage activity (Fig. 1B) of the U6+27Rz RNA
was comparable to a chemically synthesized anti-c-myb site
575 ribozyme with no flanking sequences. The cleavage activity of the
U6+27Rz transcript is greater than that of the synthetic ribozyme
because the synthetic ribozyme contains modifications which
significantly increase nuclease stability but have a slight inhibitory
effect on cleavage activity (1). Thus, the catalytic activity of the anti-c-myb site 575 ribozyme was not
severely compromised by flanking sequences in the transcript. We have
found that this U6+27Rz transcription unit has minimal impact on
cleavage activity for several different hammerhead ribozymes
(10).
View larger version (49K):
[in this window]
[in a new window]
|
FIG. 1.
U6+27 ribozyme. (A) Sequence of U6+27Rz RNA
transcript (left sequence) hybridized to c-myb mRNA (right
sequence) at site 575. The ribozyme (in bold) is flanked by sequence
derived from EcoRI and HindIII sites
(underlined) and preceded by 27 nucleotides derived from endogenous U6
RNA. (B) Catalytic activity of the c-myb site 575 ribozyme
in the context of U6+27 (open squares) measured in vitro compared
to a chemically synthesized 7/7 nucleotide arm ribozyme (open diamonds)
to the same site. (C) Intracellular expression of ribozyme transcript.
The arrow denotes the ribozyme RNA expressed in cells 48 h after
mock infection (M) or infection with Ad/U6+27Rz (Ad). RASMC
and HASMC denote RNA extracts of rat and human aortic SMC,
respectively. (D) In vitro cleavage activity from 293 cell RNA.
Substrate was incubated with synthetic ribozyme (10 or 100 nM) or RNA
from 293 cells mock infected (M) or infected with Ad/U6+27Rz (Ad).
The arrow denotes 5'-end-labeled cleavage product. The 3'
cleavage product does not contain label.
|
|
The U6+27Rz transcription unit was inserted into an adenovirus
packaging plasmid and E1-deleted, replication-defective recombinant
adenovirus, Ad/U6+27Rz, encoding the ribozyme, was generated
(
18).
We then tested for expression of the ribozyme in
Ad/U6+27Rz-infected
SMC (Fig.
1C). A transcript of the expected
size (80 nucleotides)
was detected in both rat and human aortic SMC
48 h after infection
with 100 PFU of Ad/U6+27Rz/cell. Greater
than 80% of rat SMC were
X-Gal positive upon infection with AdlacZ, a
recombinant adenovirus
encoding
-galactosidase, under the same
conditions (data not
shown). Based on the intensity of the
hybridization signal compared
to a standard curve of T7 transcribed
RNA, we estimate approximately
5,000 copies of ribozyme RNA per rat
aortic SMC at a multiplicity
of infection (MOI) of 100. No toxicity was
observed in cell culture
by infection with adenovirus at this MOI. In
addition, ribozyme
RNA of the same size can be detected in 293 cells in
which the
E1-deleted virus is able to replicate (Fig.
1C). Total RNA
isolated
from 293 cells infected with this virus was observed to
contain
cleavage activity in vitro not detected in mock-infected cells
(Fig.
1D), confirming that the U6+27Rz RNA transcribed in
eukaryotic
cells maintains ribozyme cleavage
activity.
A recombinant adenovirus encoding a U1 RNA ribozyme transcription unit
was also constructed. Although expression of the U1
RNA ribozyme
transcript was detected in infected 293 cells, we
could not detect
expression in SMC infected with the recombinant
virus (data not shown).
A U1 RNA recombinant adenovirus encoding
a catalytically attenuated
ribozyme against c-
myb mRNA (Ad/U1)
was used in some
experiments to control for effects due to recombinant
adenovirus
infection
alone.
Inhibition of SMC proliferation in cell culture.
Since the
recombinant adenovirus Ad/U6+27Rz encodes a transcript with
ribozyme activity and expression of the RNA can be detected following
infection of SMC in vitro, we next determined whether Ad/U6+27Rz
had the ability to inhibit SMC proliferation. Serum-starved SMC (0.5%
serum was required to maintain viability) were infected with either
Ad/U6+27Rz or an adenovirus vector control (Ad/U1) and then induced
to proliferate by the addition of 10% serum. Ribozyme expression was
not inhibited by serum starvation conditions (data not shown). Rat
aortic SMC infected (MOI = 100) with Ad/U6+27Rz were inhibited
in their ability to proliferate over a 3-day period as measured by Syto
13 staining to quantify cell number (Table 1). The degree of inhibition by
Ad/U6+27Rz infection was about twofold greater than the inhibition
from control adenovirus infection (P < 0.035).
To confirm that Ad/U6+27Rz infection of SMC resulted in an
increased level of inhibition of proliferation over that of viral
infection alone, we analyzed SMC proliferation by BrdU incorporation.
Both rat and human aortic SMC were inhibited in their ability
to
proliferate when infected with Ad/U6+27Rz (
P < 0.05) but not
when infected with the control virus (Fig.
2). The inhibition
of proliferation,
observed with two independent preparations of
Ad/U6+27Rz, was
similar to that observed following infection of
these cells with
Ad
Rb, a recombinant adenovirus that expresses
a nonphosphorylatable
analogue of the retinoblastoma gene product
(Rb) shown previously to
inhibit growth factor-induced SMC proliferation
in culture
(
3). Thus, it appears that Ad/U6+27Rz infection
of SMC
causes a specific inhibition of proliferation over that
of viral
infection alone. Further, since c-
myb is thought to be
important for cell cycle progression, we analyzed the DNA content
of
infected cells. Serum-stimulated SMC infected with Ad/U6+27Rz
(MOI = 100) were prevented from entering S phase by 50% as
shown
by fluorescence-activated cell sorter-based cell cycle analysis
(Table
2), consistent with the BrdU assay
results.
View larger version (23K):
[in this window]
[in a new window]
|
FIG. 2.
Inhibition of SMC proliferation. (A) Rat aortic SMC. (B)
Human aortic SMC. SMC were serum starved for 72 h and infected
with Ad/U6+27Rz at an MOI of 100 or 10, as denoted, 24 h prior
to stimulation in 10% serum. Two independent preparations of AdRb
(Ad/RB lot A and Ad/RB lot B), two preparations of Ad/U6+27Rz
(Ad/U6 lot A and Ad/U6 lot B), or one preparation of an Ad/U1 control
virus (Virus control) were tested. Percent inhibition is relative to
the degree of proliferation of uninfected cells stimulated with 10%
serum.
|
|
Inhibition of SMC proliferation in cell culture is ribozyme
mediated.
In order to determine whether ribozyme cleavage activity
was responsible for the inhibition of proliferation observed, we generated a replication-defective recombinant adenovirus encoding an
anti-c-myb ribozyme with two nucleotide substitutions in the catalytic core (Ad/U6+27RzM) that are known to retain cleavage activity but at a much diminished level (1). Infection
of serum-starved SMC with this virus (MOI = 100) had
virtually no effect on proliferation (Fig.
3A). Thus, the specific inhibition of SMC
proliferation by infection with Ad/U6+27Rz required a fully active
ribozyme and was not due to base pairing alone or to a U6+27 RNA
motif effect.
View larger version (39K):
[in this window]
[in a new window]
|
FIG. 3.
(A) Inhibition of rat aortic SMC proliferation in the
presence of recombinant adenovirus encoding active ribozyme
(Ad/U6+27Rz) or catalytically diminished ribozyme RNAs
(Ad/U6+27RzM). (B) Relative levels of c-myb mRNA assayed
by QC-PCR from rat aortic SMC serum starved (0.5%), starved and
stimulated (10%), or starved, virus infected, and stimulated
(Ad/U6+27Rz) are shown normalized to GAPDH mRNA. (C) Relative
levels of c-myb mRNA assayed by QC-PCR from rat aortic SMC
infected with Ad/U6+27Rz or Ad/U6+27RzM as noted.
|
|
Ribozyme-mediated inhibition of SMC proliferation should result in a
reduction in c-
myb mRNA levels relative to those seen
in
uninfected or control virus-infected SMC. To further confirm
that the
inhibition of SMC proliferation by infection with Ad/U6+27Rz
was
due to a ribozyme effect, we analyzed the level of c-
myb
mRNA
in uninfected and Ad/U6+27Rz-infected (MOI = 100)
rat aortic SMC,
using QC-PCR (Fig.
3B). As reported previously,
serum-starved
SMC had very low levels of c-
myb mRNA that
were induced about
50-fold 12 h after the addition of 10% serum
(
9). In contrast,
infection of SMC with Ad/U6+27Rz
reduced the level of c-
myb mRNA
in response to serum by
>90% (
P < 0.001), consistent with a
ribozyme-mediated
effect. In addition, c-
myb mRNA
levels were reduced in SMC infected
with Ad/U6+27Rz compared to SMC
infected with Ad/U6+27RzM (Fig.
3C,
P < 0.05). Taken together, these results confirm a
ribozyme
mechanism in cell culture. We did note, however, that
c-
myb RNA
levels in Ad/U6+27RzM-infected cells were
slightly reduced (<50%)
compared to those in uninfected cells (data
not shown), consistent
with a diminished catalytic activity. This
partial reduction in
c-
myb mRNA was not sufficient to
inhibit SMC proliferation in
vitro (Fig.
3A).
Inhibition of SMC proliferation in a rat model of balloon
injury.
SMC proliferation is an important component of restenosis
in response to injury after balloon angioplasty. The rat carotid artery
balloon injury model is a well-characterized and highly reproducible
vascular proliferative disorder that is dependent on SMC migration and
proliferation (2, 3, 8, 16, 20). Replication-defective
adenovirus vectors have been shown to efficiently infect medial SMC and
to program the expression of inhibitors of SMC proliferation in vivo
following balloon injury in rat carotid arteries (2, 3, 8).
Accordingly, we tested whether the inhibition of SMC proliferation by
Ad/U6+27Rz observed in culture was sufficient to impact neointima
formation in a rat carotid artery model of balloon angioplasty. Rat
carotid arteries were subjected to balloon angioplasty and
immediately exposed to 2 × 109 PFU of either
Ad/U6+27Rz or a virus control (Ad/U1). SMC proliferation, as
determined by the neointima-to-media (I/M) area ratio, was measured 20 days after balloon injury. An example of an arterial section from
ribozyme-treated and control-treated animals is shown in Fig.
4A. Overall, vessels of animals treated
with ribozyme showed a 53% reduction (P < 0.001) in the
I/M area ratio compared to vessels from animals treated with a virus
control (Fig. 4B). In a similar experiment in which arteries were
analyzed 14 days after injury and viral infection, the I/M ratio from
Ad/U6+27Rz-treated arteries was observed to be 44% lower than the
I/M ratio from saline-treated arteries (Fig. 4C;
P < 0.001). However, arteries treated with
Ad/U6+27RzM, the virus encoding ribozyme with diminished cleavage
activity, also displayed a reduced I/M ratio (Fig. 4C).
View larger version (55K):
[in this window]
[in a new window]
|
FIG. 4.
Rat carotid artery model of balloon angioplasty. (A)
Photomicrographs of representative sections from vessels treated with
control virus (Ad/U1 control) or Ad/U6+27Rz. Arrows denote the
internal elastic lamina that separates the medial and intimal layers of
the arterial wall. (B) I/M ratio quantified at day 20 from sections of
vessels treated with control virus (Ad/U1 control; n = 7) or Ad/U6+27Rz (n = 6). (C) I/M ratio
quantified at day 14 from sections of vessels treated with
Ad/U6+27Rz (n = 10), Ad/U6+27RzM (n = 10), or saline (n = 10).
|
|
| |
DISCUSSION |
In the studies described in this report, we have constructed a
replication-deficient recombinant adenovirus encoding a ribozyme to
c-myb mRNA (Ad/U6+27Rz). The ribozyme used in this study
is based on a previously described synthetic ribozyme against
c-myb RNA nucleotide 575 that contained binding arms of
seven nucleotides each (9). In this study, the ribozyme
contained binding arms of 10 nucleotides each, was expressed from a U6
RNA promoter, and contained the first 27 nucleotides of U6 RNA. The
ribozyme in the context of U6+27Rz RNA maintains in vitro cleavage
activity and is expressed in SMC infected with the virus (Fig. 1).
Infection of cultured SMC with Ad/U6+27Rz inhibited serum
stimulated proliferation of these cells twofold over infection with
control virus in a 3-day Syto 13 assay (Table 1) and by as much as 50%
in a 1-day BrdU incorporation assay (Fig. 2). The degree of inhibition
observed following infection with Ad/U6+27Rz was comparable to that
of AdRb, a recombinant adenovirus that expresses a
nonphosphorylatable analogue of RB which has been shown previously to
inhibit SMC proliferation in vitro and in vivo (3). In
addition, the inhibition due to Ad/U6+27Rz infection was similar to
that reported previously with a synthetic ribozyme to the same site
(9).
The inhibition of proliferation in cell culture was not observed in SMC
infected with Ad/U6+27RzM, an adenovirus encoding a ribozyme with
diminished cleavage activity (Fig. 3A). In addition, a >90% reduction
in targeted c-myb mRNA was detected in infected SMC compared
to uninfected SMC (Fig. 3B). These observations lead us to conclude
that ribozyme activity is the mechanism that inhibits SMC
proliferation and is a rate-limiting step in cell culture.
It is not surprising that although the specific c-myb RNA
target was reduced by >90% upon treatment with Ad/U6+27Rz,
SMC proliferation was inhibited by only 30 to 70% (Table 1 and
Fig. 2). Proliferation is a multicomponent process, of which
c-myb is one factor. Similarly, when c-myb RNA
was reduced by ~80% with a chemically synthesized anti-c-myb ribozyme, proliferation was inhibited by ~50%
(9). Moreover, overexpression of the cyclin/cyclin-dependent
kinase inhibitor, p21, completely blocked RB phosphorylation and
resulted in ~60% inhibition of proliferation (2). The
complete inhibition of SMC proliferation may require targeting a number
of factors involved in cell cycle progression.
Because adenovirus has been shown to infect medial SMC in vivo
following balloon injury of rat carotid arteries, we tested the ability
of Ad/U6+27Rz to mediate inhibition of SMC proliferation in such a
model. Neointima formation in a rat carotid model of balloon
angioplasty was inhibited by ~50% in arteries treated with
Ad/U6+27Rz compared to arteries treated with vehicle or a control
virus (Fig. 4). Although a fully active ribozyme core was needed to
achieve a maximal response in cell culture, ribozyme with diminished
cleavage activity also inhibited neointima formation in a rat carotid
model (Fig. 4C). One explanation for the difference in vitro and in
vivo may be that cleavage activity is not the rate-limiting step in
vivo. It is possible that the diminished cleavage activity of
Ad/U6+27RzM is sufficient to mediate inhibition in a 14-day animal
model but not robust enough in a 1-day cell culture model. Although
these results are still consistent with a ribozyme mechanism,
generation and testing of a recombinant virus encoding a completely
inactive ribozyme core and a more extensive virus dosing study would be
required to fully elucidate the mechanism of action in vivo.
The degree of inhibition observed in vivo with Ad/U6+27Rz is
comparable to other reported recombinant adenovirus-mediated strategies, such as expression of herpes simplex thymidine kinase in
the presence of ganciclovir (8, 17), expression of a
constitutively active form of the retinoblastoma gene product
(3), or overexpression of the cyclin/cyclin-dependent kinase
inhibitor p21 (2). This study supports the use of ribozymes
in gene therapy targeting vascular disease such as restenosis. However,
the disease in humans appears to be much more complex than that modeled
in the rat. The human restenotic lesion contains other cell types in
addition to SMC and involves additional processes, such as thrombus
formation, matrix deposition and vessel remodeling. Although neointimal
SMC may contribute to these additional factors, and potential SMC inhibitors can be screened in the rat model, these inhibitors (such as
Ad/U6+27Rz described here) require further testing before their
applicability in human vascular disease can be determined.
Although there are numerous examples of vector-encoded ribozyme
efficacy in cell culture and ex vivo (4, 5), there are only
a few examples of therapeutic applications of ribozymes in vivo.
Exogenous delivery of chemically synthesized antistromelysin ribozymes
in a rabbit model of interleukin-1-induced arthritis results in
reduction of stromelysin mRNA in synovial cells (6). Adenovirus-mediated gene therapy of a ribozyme results in inhibition of
a reporter target (human growth hormone) in transgenic mice (14). In addition, adeno-associated virus-mediated
expression of ribozymes targeting a mutated rhodopsin mRNA was shown to
slow the rate of photoreceptor degeneration in a transgenic rat model (13). Although the mechanism of action in vivo is not
identified, this study nonetheless demonstrates that a nonintegrating
gene therapy-mediated application of a ribozyme can be efficacious against a disease process in an animal model.
| |
ACKNOWLEDGMENTS |
We thank Jim Dahlberg for providing the mouse U6 gene. We are
grateful to Tom Parry for his efforts to ensure that the rat carotid
model used by Coromed, Inc., was the same as the one at the University
of Chicago. We also thank Pam Pavco and Nassim Usman for critical
reading of the manuscript.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: 2950 Wilderness
Place, Boulder, CO 80301. Phone: (303) 546-8153. Fax: (303) 449-6500. E-mail: macejad{at}rpi.com.
Present address: City of Hope National Medical Center, Duarte, CA 91010.
| |
REFERENCES |
| 1.
|
Beigelman, L.,
J. A. McSwiggen,
K. G. Draper,
C. Gonzalez,
K. Jensen,
A. M. Karpeisky,
A. S. Modak,
J. Matulic-Adamic,
A. B. DiRenzo, et al.
1995.
Chemical modification of hammerhead ribozymes. Catalytic activity and nuclease resistance.
J. Biol. Chem.
270:25702-25708[Abstract/Free Full Text].
|
| 2.
|
Chang, M. W.,
E. Barr,
M. M. Lu,
K. Barton, and J. M. Leiden.
1995.
Adenovirus-mediated over-expression of the cyclin/cyclin-dependent kinase inhibitor, p21 inhibits vascular smooth muscle cell proliferation and neointima formation in the rat carotid artery model of balloon angioplasty.
J. Clin. Investig.
96:2260-2268.
|
| 3.
|
Chang, M. W.,
E. Barr,
J. Seltzer,
Y.-Q. Jiang,
G. J. Nabel,
E. G. Nabel,
M. S. Parmacek, and J. M. Leiden.
1995.
Cytostatic gene therapy for vascular proliferative disorders with a constitutively active form of the retinoblastoma gene product.
Science
267:518-522[Abstract/Free Full Text].
|
| 4.
|
Christoffersen, R. E., and J. J. Marr.
1995.
Ribozymes as human therapeutic agents.
J. Med. Chem.
38:2023-2037[Medline].
|
| 5.
|
Couture, L. A., and D. T. Stinchcomb.
1996.
Anti-gene therapy: the use of ribozymes to inhibit gene function.
Trends Genet.
12:510-515[Medline].
|
| 6.
|
Flory, C. M.,
P. A. Pavco,
T. C. Jarvis,
M. E. Lesch,
F. E. Wincott,
L. Biegelman,
S. W. Hunt III, and D. J. Schrier.
1996.
Nuclease-resistant ribozymes decrease stromelysin mRNA levels in rabbit synovium following exogenous delivery to the knee joint.
Proc. Natl. Acad. Sci. USA
93:754-758[Abstract/Free Full Text].
|
| 7.
|
Forrester, J. S.,
M. Fishbein,
R. Helfant, and J. Fagin.
1991.
A paradigm for restenosis based on cell biology: clues for the development of new preventative therapies.
J. Am. Coll. Cardiol.
17:758-769[Abstract].
|
| 8.
|
Guzman, R. J.,
E. A. Hirschowitz,
S. L. Brody,
R. G. Crystal,
S. E. Epstein, and T. Finkel.
1994.
In vivo suppression of injury-induced vascular smooth muscle cell accumulation using adenovirus-mediated transfer of the herpes simplex virus thymidine kinase gene.
Proc. Natl. Acad. Sci. USA
91:10732-10736[Abstract/Free Full Text].
|
| 9.
|
Jarvis, T. C.,
L. J. Alby,
A. A. Beaudry,
F. E. Wincott,
L. Beigelman,
J. A. McSwiggen,
N. Usman, and D. T. Stinchcomb.
1996.
Inhibition of vascular smooth muscle cell proliferation by ribozymes that cleave c-myb mRNA.
RNA
2:419-428[Abstract].
|
| 10.
| Jensen, K. L., and D. M. Macejak.
Unpublished data.
|
| 11.
|
Kearney, M.,
A. Pieczek,
L. Haley,
D. W. Losordo,
V. Andres,
R. Schainfeld,
K. Rosenfield, and J. M. Isner.
1997.
Histopathology of in-stent restenosis in patients with peripheral artery disease.
Circulation
95:1998-2002[Abstract/Free Full Text].
|
| 12.
|
Kunkel, G. R., and T. Pederson.
1989.
Transcription of a human U6 small nuclear RNA gene in vivo withstands deletion of intragenic sequences but not of an upstream TATATA box.
Nucleic Acids Res.
17:7371-7379[Abstract/Free Full Text].
|
| 13.
|
Lewin, A. S.,
K. A. Drenser,
W. W. Hauswirth,
S. Nishikawa,
D. Yasumura,
J. G. Flannery, and M. M. LaVail.
1998.
Ribozyme rescue of photoreceptor cells in a transgenic rat model of autosomal dominant retinitis pigmentosa.
Nat. Med.
4:967-971[Medline].
|
| 14.
|
Lieber, A., and M. A. Kay.
1996.
Adenovirus-mediated expression of ribozymes in mice.
J. Virol.
70:3153-3158[Abstract].
|
| 15.
|
Liu, M. W.,
G. S. Roubin, and S. B. King.
1989.
Restenosis after coronary angioplasty: potential biologic determinants and role of intimal hyperplasia.
Circulation
79:1374-1386[Abstract/Free Full Text].
|
| 16.
|
Morishita, R.,
G. Gibbons,
K. Ellison,
M. Nakajima,
L. Zhang,
Y. Kaneda,
T. Ogihara, and V. Dzau.
1993.
Single intraluminal delivery of antisense cdc2 kinase and proliferating-cell nuclear antigen oligonucleotides results in chronic inhibition of neointimal hyperplasia.
Proc. Natl. Acad. Sci. USA
90:8474-8478[Abstract/Free Full Text].
|
| 17.
|
Ohno, T.,
D. Gordon,
H. San,
V. J. Pompili,
M. J. Imperiale,
G. J. Nabel, and E. G. Nabel.
1994.
Gene therapy for vascular smooth muscle cell proliferation after arterial injury.
Science
265:781-784[Abstract/Free Full Text].
|
| 18.
|
Rich, D. P.,
L. A. Couture,
L. M. Cardoza,
V. M. Guiggio,
D. Armentano,
P. C. Espino,
K. Hehir,
M. J. Welsh,
A. E. Smith, and R. J. Gregory.
1993.
Development and analysis of recombinant adenovirus for gene therapy of cystic fibrosis.
Hum. Gene Ther.
4:461-476[Medline].
|
| 19.
|
Shumyatsky, G.,
D. Wright, and R. Reddy.
1993.
Methylphosphate cap structure increases the stability of 7SK, B2, and U6 small RNAs in Xenopus oocytes.
Nucleic Acids Res.
21:4756-4761[Abstract/Free Full Text].
|
| 20.
|
Simons, M.,
E. R. Edelman,
J. DeKeyser,
R. Langer, and R. D. Rosenberg.
1992.
Antisense c-myb oligonucleotides inhibit intimal arterial smooth muscle cell accumulation in vivo.
Nature
359:67-70[Medline].
|
| 21.
|
Thompson, J. D.,
D. F. Ayers,
T. A. Malmstrom,
T. L. McKenzie,
L. Ganousis,
B. M. Chowrira,
L. Couture, and D. T. Stinchcomb.
1995.
Improved accumulation and activity of ribozymes expressed from a tRNA-based RNA polymerase III promoter.
Nucleic Acids Res.
23:2259-2268[Abstract/Free Full Text].
|
Journal of Virology, September 1999, p. 7745-7751, Vol. 73, No. 9
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Remillard, C. V., Tigno, D. D., Platoshyn, O., Burg, E. D., Brevnova, E. E., Conger, D., Nicholson, A., Rana, B. K., Channick, R. N., Rubin, L. J., O'Connor, D. T., Yuan, J. X.-J.
(2007). Function of Kv1.5 channels and genetic variations of KCNA5 in patients with idiopathic pulmonary arterial hypertension. Am. J. Physiol. Cell Physiol.
292: C1837-C1853
[Abstract]
[Full Text]
-
You, X.-M., Mungrue, I. N., Kalair, W., Afroze, T., Ravi, B., Sadi, A. M., Gros, R., Husain, M.
(2003). Conditional Expression of a Dominant-Negative c-Myb in Vascular Smooth Muscle Cells Inhibits Arterial Remodeling After Injury. Circ. Res.
92: 314-321
[Abstract]
[Full Text]
-
Kotani, M., Fukuda, N., Ando, H., Hu, W.-Y., Kunimoto, S., Saito, S., Kanmatsuse, K.
(2003). Chimeric DNA-RNA hammerhead ribozyme targeting PDGF A-chain mRNA specifically inhibits neointima formation in rat carotid artery after balloon injury. Cardiovasc Res
57: 265-276
[Abstract]
[Full Text]
-
Jiang, H. Y., Petrovas, C., Sonenshein, G. E.
(2002). RelB-p50 NF-{kappa}B Complexes Are Selectively Induced by Cytomegalovirus Immediate-Early Protein 1: Differential Regulation of Bcl-xL Promoter Activity by NF-{kappa}B Family Members. J. Virol.
76: 5737-5747
[Abstract]
[Full Text]
-
Lowe, H. C., Oesterle, S. N., Khachigian, L. M.
(2002). Coronary in-stent restenosis: Current status and future strategies. J Am Coll Cardiol
39: 183-193
[Abstract]
[Full Text]
-
Sriram, V., Patterson, C.
(2001). Cell Cycle in Vasculoproliferative Diseases : Potential Interventions and Routes of Delivery. Circulation
103: 2414-2419
[Abstract]
[Full Text]
-
Gu, J.-L., Pei, H., Thomas, L., Nadler, J. L., Rossi, J. J., Lanting, L., Natarajan, R.
(2001). Ribozyme-Mediated Inhibition of Rat Leukocyte-Type 12-Lipoxygenase Prevents Intimal Hyperplasia in Balloon-Injured Rat Carotid Arteries. Circulation
103: 1446-1452
[Abstract]
[Full Text]
-
LaVail, M. M., Yasumura, D., Matthes, M. T., Drenser, K. A., Flannery, J. G., Lewin, A. S., Hauswirth, W. W.
(2000). Ribozyme rescue of photoreceptor cells in P23H transgenic rats: Long-term survival and late-stage therapy. Proc. Natl. Acad. Sci. USA
10.1073/pnas.210319397v1
[Abstract]
[Full Text]
-
LaVail, M. M., Yasumura, D., Matthes, M. T., Drenser, K. A., Flannery, J. G., Lewin, A. S., Hauswirth, W. W.
(2000). Ribozyme rescue of photoreceptor cells in P23H transgenic rats: Long-term survival and late-stage therapy. Proc. Natl. Acad. Sci. USA
97: 11488-11493
[Abstract]
[Full Text]
-
Patricia, M. K., Natarajan, R., Dooley, A. N., Hernandez, F., Gu, J.-L., Berliner, J. A., Rossi, J. J., Nadler, J. L., Meidell, R. S., Hedrick, C. C.
(2001). Adenoviral Delivery of a Leukocyte-Type 12 Lipoxygenase Ribozyme Inhibits Effects of Glucose and Platelet-Derived Growth Factor in Vascular Endothelial and Smooth Muscle Cells. Circ. Res.
88: 659-665
[Abstract]
[Full Text]
-
Qian, H. S., Channon, K., Neplioueva, V., Wang, Q., Finer, M., Tsui, L., George, S. E., McArthur, J.
(2001). Improved Adenoviral Vector for Vascular Gene Therapy : Beneficial Effects on Vascular Function and Inflammation. Circ. Res.
88: 911-917
[Abstract]
[Full Text]
-
FRANCIS, S. C., RAIZADA, M. K., MANGI, A. A., MELO, L. G., DZAU, V. J., VALE, P. R., ISNER, J. M., LOSORDO, D. W., CHAO, J., KATOVICH, M. J., BERECEK, K. H.
(2001). Genetic targeting for cardiovascular therapeutics: are we near the summit or just beginning the climb?. Physiol. Genomics
7: 79-94
[Abstract]
[Full Text]
Top
Abstract
Introduction
