Previous Article | Next Article 
Journal of Virology, September 1999, p. 7671-7677, Vol. 73, No. 9
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
An Inducible Human Immunodeficiency Virus Type 1 (HIV-1) Vector Which Effectively Suppresses HIV-1 Replication
Dong Sung
An,
Kouki
Morizono,
Qi-Xiang
Li,
Si Hua
Mao,
Stephanie
Lu, and
Irvin S. Y.
Chen*
Departments of Microbiology & Immunology and
Medicine, UCLA School of Medicine, Los Angeles, California 90095
Received 15 January 1999/Accepted 14 June 1999
 |
ABSTRACT |
Recently, gene therapy vectors based upon the human
immunodeficiency virus type 1 (HIV-1) genome have been developed. Here, we create an HIV-1 vector which is defective for all HIV-1 genes, but
which maintains cis-acting elements required for efficient packaging, infection, and expression. In T cells transduced by this
vector, vector expression is low but efficiently induced following
HIV-1 infection. Remarkably, although the HIV-1 vector does not contain
specific anti-HIV-1 therapeutic genes, the presence of the vector alone
is sufficient to inhibit the spread of HIV-1 infection. The mechanism
of inhibition is likely to be at the level of competition for limiting
substrates required for either efficient packaging or reverse
transcription, thereby selecting against propagation of wild-type
HIV-1. These results provide proof of a concept for potential
application of a novel HIV-1 vector in HIV-1 disease.
 |
INTRODUCTION |
Gene therapy approaches for the
treatment of human immunodeficiency virus type 1 (HIV-1) disease have
significant potential as a modality for treatment (5). In
theory, cells rendered resistant to the effects of HIV-1 should have a
selective advantage in repopulating the host immune system. However,
gene therapy applications in general have suffered from inadequate
expression and an inability to regulate the expression of therapeutic
genes (4, 12, 15, 39, 40). For HIV-1, this is a particularly serious issue, since HIV-1 infection of cells results in high levels of
sustained expression of viral genome and gene products. Therefore, for
any gene therapy approach to be effective, sufficient levels of
expression must be obtained in order to provide protection (32).
A number of groups have developed vectors based upon the HIV-1 genome
for various gene therapy applications (2, 6, 10, 19, 20, 25-27,
29, 30, 34, 35, 38). These vectors are capable of infecting
nondividing human cells such as macrophages, a target for HIV-1
infection. Many of the known HIV-1 genes are toxic to human cells
(8, 16, 17, 23, 24, 37); therefore, the construction of a
"safe" vector requires ablation of as many HIV-1 genes and
sequences as possible. Thus, the most widely used HIV-1 vector consists
of only the HIV-1 sequences required for packaging and infection, and
foreign genes are generally expressed through an internal heterologous
promoter (19, 20, 25, 26, 28, 29, 34). Since the
effectiveness of various promoters is dependent upon the cell type, we
reasoned that an effective vector for expression of genes directed
against HIV-1 should utilize the HIV-1 long terminal repeats (LTRs)
such that the levels and regulation of expression by the vector would
be comparable to those of wild-type HIV-1. Therefore, we constructed an
HIV-1 vector in which expression is dependent upon the activity of the
HIV-1 LTRs. All HIV-1 genes, including tat and
rev, required for efficient viral gene expression are
ablated; however, cis-acting sequences required for
packaging, infection, and expression are retained. Thus expression of
this vector is dependent upon coinfection with wild-type HIV-1 to
provide trans-acting factors required for efficient infection and expression.
We demonstrate that this vector can transduce human cells and can be
efficiently induced when the cells are infected by HIV-1. Remarkably,
the presence of this vector in cells efficiently inhibits the spread of
HIV-1, presumably by competition for limiting substrates required for replication.
 |
MATERIALS AND METHODS |
Construction of vectors.
The nucleotide position numbers
used here to describe vector constructions start at the 5' end of HIV-1
NL4-3 provirus (1). HIV-1-based vectors DAEGFP and
DAt1ruEGFP were derived from HIV-1NL4-3-lucenv(
) (31). To make DAEGFP, gag, pol,
vif, and vpr genes were removed between the
AvrII sites (no. 2012 to 5662). The luciferase gene was
replaced with the enhanced green fluorescent protein (EGFP) gene
(Clontech) by cloning EGFP between the XhoI and
MluI sites of HIV-1NL4-3-lucenv(
). To make
DAt1ruEGFP, a frameshift was introduced within the tat gene
by insertion of a linker sequence (5'-TTAGGTCTAGACCCGGGCGGCCGATCGATCC-3') into the
Sau1 site (no. 5954). A frameshift was introduced within the
rev gene at the BamHI site (no. 8466) by
treatment with Klenow fragment. Site-directed mutagenesis was performed
to create an NcoI site in the vpu gene (no. 6221 A to C and no. 6225 A to G), which was then treated with Klenow
fragment to create a frameshift in the vpu gene. An additional XmaI site was made by site-directed mutagenesis
(no. 7624 T to C and no. 7627 A to G).
An HIV-1 vector, pHR'CMVEGFP, was derived from pHR'-CMV-lucif
(29) by replacing the luciferase gene with EGFP. A murine retrovirus vector, SR
LEGFP, was derived from SR
Lthy
(3) by replacing the murine thy1.2 gene with EGFP.
A packaging plasmid for an HIV-1-based vector, pCMV

R8.2DVPR, was
derived from pCMV

R8.2 (
28) by deleting the
vpr
gene from
no. 5625 to 5731 by oligonucleotide-directed
mutagenesis.
A packaging plasmid for murine retrovirus vector,
pSV


env

MLV, was obtained from Dan R. Littman (
22).
A vesicular stomatitis virus protein G (VSVG) expression plasmid,
pHCMVG, was obtained from Jane C. Burns (
7).
Vector production and concentration.
All vector stocks were
generated by calcium phosphate-mediated transfection of 293T cells
(36). 293T cells were cultured in Dulbecco's modified Eagle
medium with 10% calf serum (CS), 100 U of penicillin per ml, and 100 µg of streptomycin per ml. 293T cells (2 × 107)
were plated on 175-cm2 flasks in 25 ml of the medium and
transfected the following day with 5 µg of pHCMVG, 12.5 µg of
pCMV
R8.2DVPR, and 12.5 µg of DAt1ruEGFP or HR'CMVEGFP for
HIV-1-based vectors. For the murine leukemia virus (MLV)-based vector,
5 µg of pHCMVG, 12.5 µg of pSV
env
MLV, and 12.5 µg of SR
LEGFP
were used.
At 8 h posttransfection, media were replaced with 35 ml of fresh
medium. At 36 and 60 h posttransfection, the medium was harvested,
centrifuged at 1,500 rpm for 5 min in a Sorvall RT 6000B (Sorvall,
Newtown, Conn.), and filtered through a 0.45-µm-pore-size filter.
Further vector concentration was achieved by ultracentrifugation
at
50,000 ×
g for 90 min at 4°C. The pellet was
resuspended in
Iscove's modified Dulbecco's medium with 10% FCS, 100 U of penicillin
per ml, and 100 µg of streptomycin per ml overnight
at 4°C. The
vectors were concentrated 100-fold and kept in liquid
nitrogen
until
use.
Transduction of VSVG-pseudotyped vectors.
CEMx174 cells or
SupT1 cells were cultured in Iscove's modified Dulbecco's medium with
10% FCS, 100 U of penicillin per ml, and 100 µg of streptomycin per
ml. Cells (5 × 105) were infected with
VSVG-pseudotyped DAt1ruEGFP, HR'CMVEGFP, or SR
LEGFP vector by
incubation with 1 ml of 10× concentrated vectors in the presence of
Polybrene (8 µg/ml) at 37°C for 2 h. Three days postinfection,
cells were analyzed for EGFP expression by flow cytometric analysis,
and cells expressing EGFP were sorted by fluorescence-activated cell
sorting (FACS) with a FACSstar cell sorter (Becton Dickinson).
EGFP-expressing sorted CEMx174 or SupT1 cells (vector-transduced cells)
were used for VSVG-pseudotyped HIV-1NL4-3thyenv(
)-vprX
(31) or NL-r-HSAS virus (18) infection.
Production and infection of VSVG-pseudotyped HIV-1 reporter
virus.
Stocks of VSVG-pseudotyped
HIV-1NL4-3thyenv(
)-vprX virus were made by calcium
phosphate-mediated transfection with 5 µg of pHCMVG and 10 µg of
NLthy
BglVprX plasmid (33) into 293T cells as described
for vector production and concentration. Stocks of VSVG-pseudotyped
HIV-1NL4-3thyenv(
)-vprX virus were titrated by infecting
HeLa cells (105) with various amounts of the virus and
analyzing them for murine Thy1.2 expression by flow cytometry on day 3 postinfection.
Mock-transduced and vector-transduced CEMx174 or SupT1 cells (2 × 10
5) were infected with VSVG-pseudotyped
HIV-1
NL4-3thyenv(

)-vprX
virus for 2 h at 37°C in
the presence of Polybrene (8 µg/ml) at
a multiplicity of infection
(MOI) of 0.5. After 2 h of infection,
cells were centrifuged at
1,500 rpm for 5 min and washed with
fresh medium twice and cultured for
3
days.
Monoclonal antibody staining and flow cytometric analysis of
murine Thy1.2.
At day 3 postinfection, cells were stained for
murine Thy1.2. Cells (2 × 105) were washed with
phosphate-buffered saline (PBS) (4°C) and stained with 100 µl of
monoclonal antibody to murine Thy1.2 directly conjugated to
phycoerythrin (PE) (Caltag, catalog no. MM2004), diluted 20-fold with
PBS containing 2% FCS, for 20 min on ice. The cells were then washed
with PBS (4°C) and resuspended in 0.5 ml of 1% formaldehyde in PBS.
Samples were run on a FACSscan flow cytometer (Becton Dickinson), and
data were analyzed with the Cell Quest program (Becton Dickinson). The
amount of p24gag in culture supernatants was
quantified by enzyme-linked immunosorbent assay (ELISA). (Coulter)
Production and infection of replication-competent HIV-1 reporter
virus.
Stocks of NL-r-HSAS virus were made by electroporation of
30 µg of infectious proviral NL-r-HSAS DNA into 107 CEM
cells, as previously described (18). Infectious units were determined by limiting dilution on SupT1 and CEMx174 cells, by using a
fivefold dilution of virus. Before infection, the NL-r-HSAS virus was
treated with RNase-free DNase (20 µg/ml; Worthington) for 30 min at
37°C in the presence of 0.01 M MgCl2.
Mock-transduced and vector-transduced CEMx174 cells or SupT1 cells
(7 × 10
5) were infected with replication-competent
NL-r-HSAS virus for
2 h at 37°C in the presence of Polybrene (8 µg/ml) at different
MOI (MOI of 0.01, 0.1, and 1 for CEMx174 and 0.01 and 0.1 for
SupT1 cell experiments). After 2 h of infection, cells
were centrifuged
at 1,500 rpm for 5 min, washed with fresh medium
twice, and cultured.
Every 3 or 4 days, the cultures were divided into
fifths, fresh
medium was added, and the cells were then cultured. The
remaining
culture was analyzed for murine heat-stable antigen (HSA)
expression
by flow cytometry, and the amount of p24 in the supernatant
was
analyzed by ELISA (Coulter). Cell counts were performed by mixing
cells with trypan blue, and live cells were
counted.
Monoclonal antibody staining and flow cytometric analysis of
murine HSA.
Monoclonal antibodies to murine HSA (Pharmingen,
catalog no. 01575A) directly conjugated with PE were diluted 500-fold
with PBS containing 2% FCS. Cells (2 × 105) were
washed with PBS (4°C) and resuspended in 100 µl of human AB serum
(4°C) (Omega Scientific, Inc., Tarzana, Calif.). The cells were mixed
with a diluted 100-µl concentration of monoclonal antibodies and
incubated for 15 min on ice. The cells were washed with PBS (4°C) and
resuspended in 0.5 ml of 1% formaldehyde in PBS. Samples were run on a
FACSscan flow cytometer (Becton Dickinson), and data were analyzed with
the Cell Quest program (Becton Dickinson).
RNA isolation from virions.
Cell culture supernatants (35 ml) from cultures of vector-transduced CEMx174 cells infected with
NL-r-HSAS at an MOI of 0.1 were harvested at day 7 postinfection and
subjected to ultracentrifugation through 5 ml of 20% sucrose cushion
at 50,000 × g for 90 min at 4°C. Virus pellets were
resuspended in 250 µl of TEN (0.1 M NaCl, 10 mM Tris-Cl [pH 8.0], 1 mM EDTA [pH 8.0]). RNAs isolated with Trizol LS reagent (Gibco BRL,
Grand Island, N.Y.).
Preparation of RNA standards for EGFP, HSA, and HIV-1 reverse
transcription-PCR (RT-PCR).
A BamHI-to-NotI
fragment containing 780 bp of EGFP cDNA from plasmid pEGFPN1 (Clontech,
Palo Alto, Calif.) was ligated into pGEM-11Zf(
) (Promega Corp.,
Madison, Wis.). A SacI-to-ApaI fragment (1.5 kb)
from the full-length HIV-1 molecular clone pYKJRCSF (21) was
ligated into pGEM-11Zf(
) (Promega Corp.). An
XbaI-to-EcoRI fragment containing 267 bp of HSA
cDNA from the recombinant HIV-1 molecular clone pNL-r-HSAS
(18) was ligated into pBluescriptII KS(+) (Stratagene, La
Jolla, Calif.). EGFP, HSA, and HIV-1 RNA standards were generated by in
vitro transcription with a MEGAscript kit (Ambion Inc., Austin, Tex.).
Copy numbers were determined by analysis of the amounts of RNAs by
using a spectrophotometer and determining the length of the RNAs on a
denaturing formaldehyde agarose gel. Serial half-log dilutions were
made in order to generate an EGFP, HSA, and HIV-1 standard curve
(range, 30 to 10,000 copies).
Quantitative RT-PCR.
RT-PCR assays for EGFP, HSA, or HIV-1
R/U5 sequences were performed by using a Gene Amp kit (Perkin-Elmer,
Branchburg, N.J.). In brief, purified RNAs from virions were amplified
by using a recombinant Thermus thermophilus (rTth) DNA
polymerase with RT in the presence of 0.75 µM an antisense primer,
200 µM deoxynucleoside triphosphates dNTPs, and 1 mM
MgCl2 at 70°C for 15 min, followed by 35 cycles of
amplification for EGFP or HSA PCR and 30 cycles of amplification for
HIV-1 R/U5 with 0.15 µM 32P-labeled sense primer. The
absence of DNA contamination was examined by omitting the RT step in a
duplicate sample, and the samples were analyzed in parallel. The
nucleotide sequences of the HSA primers used for HSA RT-PCR are as
follows: SE3, sense primer, 5'GGCTGGGGTTGCTGCTTCTGG3'; and
SE4, antisense primer, 5'CCCCTCTGGTGGTAGCGTTAC3'. The primer
pairs used for EGFP and HIV-1 R/U5 RT-PCR were GL5/GL6 and M667/AA55,
respectively. The primer sequences are described below.
Quantitative DNA PCR assay.
Cell culture supernatants were
harvested from cultures of vector-transduced CEMx174 cells infected
with NL-r-HSAS at day 4 (MOI of 1) and day 7 (MOI of 0.1). Supernatants
at day 7 (MOI of 0.1) were normalized by the p24 value (84.2 µg/ml)
for infection. Supernatants at day 4 (MOI of 1) were used for infection
without normalization. Before infection, the supernatants were treated with RNase-free DNase (20 µg/ml; Worthington) for 30 min at 37°C in
the presence of 0.01 M MgCl2. Fresh CEMx174 cells (5 × 105) were infected for 2 h with 1 ml of each of the
supernatants. After 2 h of infection, cells were centrifuged for
1,500 rpm for 5 min and washed with fresh medium twice and cultured.
Cells were harvested 12 h postinfection, and DNA was purified from
cells by a urea lysis method (41). The resulting reverse
transcriptase products for vectors and NL-r-HSAS were distinguished by
quantitative PCR for EGFP and HSA genes, respectively. The amount of
DNA used for quantitative PCR was adjusted by the copy number of HIV-1 5' LTR R/U5 obtained by quantitative HIV-1 5' LTR R/U5 PCR. PCR amplification was performed as previously described (41).
Briefly, to detect DAt1ruEGFP, HR'CMVEGFP, or SR
LEGFP vector DNA
sequence or NL-r-HSAS viral DNA sequence, one of the oligonucleotide
primers for each pair used was end labeled with 32P, and 25 ng of the 32P-labeled oligonucleotide primers was included
in the reaction mixture (usually 5 × 106 to 1 × 107 cpm). The second oligonucleotide primer for each pair
was not labeled, and 50 ng was incorporated into each reaction mixture. Each reaction mixture contained a 0.25 mM concentration of each of the
four dNTPs, 50 mM NaCl, 25 mM Tris-HCl (pH 8.0), 5 mM
MgCl2, 100 µg of bovine serum albumin per ml, and 1.25 U
of Taq DNA polymerase (Promega). The reaction mixture was
overlaid with 25 µl of mineral oil and then subjected to 1 cycle of
denaturation for 5 min at 94°C and then 25 cycles of denaturation for
1 min at 94°C and polymerization for 2 min at 65°C. For HSA PCR, 1 cycle of denaturation for 5 min at 94°C and then 30 cycles of
denaturation for 2 min at 94°C and polymerization for 3 min at 65°C
were used. The reaction was performed on a Perkin-Elmer thermocycler.
Amplified products resulting from the PCR were analyzed by
electrophoresis on 6% nondenaturing polyacrylamide gels and visualized
by direct autoradiography of the dried gels. Quantitative analysis of
the amplified products was performed with a PhosphorImager (Molecular
Dynamics), and data were analyzed with the Image QuaNT program
(Molecular Dynamics). The nucleotide sequences of the oligonucleotide
primers used for detecting DAt1ruEGFP and HR'CMVEGFP were derived from
the nucleotide sequence of the EGFP DNA and are as follows: GL5,
5'-ATGGTGAGCAAGGGCGAGGAGC-3'; and GL6,
5'GGGTCAGCTTGCCGTAGGTGGC-3'. The oligonucleotide primers used for detecting HSA sequence were derived from the nucleotide sequence of the NL-r-HSAS DNA and are as follows: CH1,
5'-GAACAAGCCCCAGAAGACC-3'; and CH2,
5'-GTAGGAGCAGTGCCAGAAGC-3'.
The nucleotide sequences of the M667 and AA55 oligonucleotide primers
used for detecting HIV-1 R/U5 of LTR DNA sequence were
previously
described (
41).
Quantitation of EGFP during PCR amplification was performed by
analyzing standard curves of linearized SR

LEGFP plasmid digested
with
HindIII. For HSA and HIV-1 R/U5 LTRs linearized
NL-r-HSAS
plasmid digested with
BamHI was used. The DNAs
described above
were diluted in human peripheral blood mononuclear cell
DNA (0.1
µg/µl). The copy numbers of the GFP or NL-r-HSAS and HIV-1
R/U5
LTRs included in the standard curve ranged from 7 to 1,800 and
from 3 to 1,000 copies,
respectively.
 |
RESULTS |
Construction of an inducible HIV-1 vector.
Our strategy to
construct an efficiently inducible HIV-1 vector was to first remove
essential HIV-1 genes encoding virion products, such as the
gag, pol, and env genes, as well as
genes not essential for in vitro replication, including vif,
vpr, and nef. This construction resulted in a
vector, termed DA, bearing an EGFP reporter gene (Fig.
1A) which required gag,
pol, and env provided in trans, but
which maintained efficient packaging and gene expression. An inducible
version (DAt1ru) was then constructed by ablation of tat and
rev, followed by ablation of an accessory gene,
vpu. It can be rescued into virions by cotransfection with HIV-1 packaging plasmids, which included gag,
pol, and env and transactivating genes
tat and rev. Infection of SupT1 cells resulted in
a population of cells which had low-level expression of EGFP expression
by flow cytometry, approximately 2 logs lower than that observed with
the parental vector, which was wild type for tat and
rev (data not shown), and approximately 1 log lower than that observed with HR'CMV EGFP, a vector which expresses EGFP by using
an internal cytomegalovirus (CMV) promoter and SR
LEGFP, a murine
retrovirus vector which expresses EGFP.


View larger version (53K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Maps of vectors. An HIV-1 vector, DAEGFP, contains
sequences from HIV-1 NL4-3 but lacks the gag,
pol, env, vif, vpr, and
nef genes, as described in Materials and Methods. The EGFP
gene was cloned in place of the nef gene, and is expressed
from HIV-1 LTR. The tat and rev genes are intact
for gene expression from HIV-1 LTR. An inducible HIV-1 vector,
DAt1ruEGFP, was constructed from DAEGFP by ablation of the
tat, rev, and vpu genes, as described
in Materials and Methods. All genes from HIV-1 were ablated in the
DAt1ruEGFP vector. An HIV-1 vector, pHR'CMVEGFP, lacks all HIV-1 genes
and expresses EGFP from the CMV internal promoter, as described in
Materials and Methods. A murine retrovirus vector, SR LEGFP, express
EGFP from the MLV LTR, as described in Materials and Methods. The LTR,
splice donor and acceptor sites (SD and SA, respectively), the
packaging signal ( ), the truncated gag sequence ( gag),
the frameshift mutation ( ), the rev-responsive element
(RRE), CMV, and MLV are indicated. (B) Induction of gene expression
from HIV-1 vectors by single-round infection with infectious HIV-1
reporter virus. Mock-transduced (CEMx174) and vector-transduced
(DAt1ruEGFP CEMx174, HR'CMVEGFP CEMx174, and SR LEGFP CEMx174)
CEMx174 cells (2 × 105) were infected with
VSVG-pseudotyped HIV-1NL4-3thyenv( )-vprX at an MOI of 0.5 (upper panels) or were mock infected (lower panels). At 3 days
postinfection, cells (2 × 105) were stained with a
monoclonal antibody to murine Thy1.2 conjugated with PE, and 5 × 103 cells were analyzed by flow cytometry for EGFP and
Thy1.2 expression. The x axis indicates EGFP fluorescence
intensity; the y axis indicates Thy1.2 expression. As
indicated, p24 production in cell supernatant was also measured by
ELISA at 3 days postinfection. %Thy1.2 indicates Thy1.2-positive
populations.
|
|
The inducibility of the DAt1ru proviral genome in transduced cells was
demonstrated by superinfection of the transduced cells
by HIV-1. CEMX
174 cells were subjected to FACS to isolate cells
which were expressing
low levels of EGFP. This population of cells
was then superinfected
with HIV-1 bearing the murine
thy1.2 reporter
gene
substituted in place of
nef [HIV-1
NL4-3
thyenv(

)-vprX] and
also defective for
env and
vpr (
33) (Fig.
1B). Due to the deletion
in
env, this virus requires envelope in
trans and
therefore permits
only a single round of infection. Following infection
with HIV-1,
each transduced population of cells expressed Thy1.2 on the
cell
surface and p24 in the supernatant at levels similar to those
of
mock-transduced cells. In the case of cells transduced with
DAt1ru, we
observed an approximately 2-log induction of EGFP expression
following
infection. The majority of the Thy1.2-positive population
was also EGFP
positive, indicating that superinfection of the
transduced cells was
responsible for the induction of EGFP expression.
As expected, cells
infected with the murine retrovirus vector
SR

LEGFP did not show any
additional induction of EGFP expression.
It is noteworthy that the
cells transduced with HR'CMVEGFP, although
expressing EGFP from an
internal CMV promoter, show still greater
levels of EGFP expression
following infection, possibly reflecting
a shift in utilization from
the CMV promoter to the HIV LTR of
the
vector.
Suppression of HIV-1 replication by an inducible HIV-1 vector.
The population of cells transduced with the inducible HIV-1 vector was
infected with replication-competent HIV-1 to determine the kinetics of
induction in a spreading infection (Fig.
2A). We utilized a replication-competent
HIV-1 virus (NL-r-HSAS) bearing the murine HSA gene as a reporter gene
substituted in place of the vpr gene (18).
CEMx174 cells mock transduced with the vector were rapidly infected, as
evidenced by an increasing percentage of HSA-positive cells over time.
By day 7, nearly all cells in the culture were HSA positive, and the
cultures showed large numbers of syncytia. Death of most of the cells
in the culture resulted between 1 and 2 weeks after infection,
depending on the initial MOI.


View larger version (61K):
[in this window]
[in a new window]
|
FIG. 2.
Kinetics of HSA expression, p24 production, and
cell count after infection of replication-competent HIV-1 reporter
virus. (A) Mock-transduced and vector-transduced CEMx174 cells
(DAt1ruEGFP CEMx174, HR'CMVEGFP CEMx174, and SR LEGFP CEMx174)
(7 × 105) were infected with replication-competent
NL-r-HSAS at MOI of 0.01, 0.1, and 1. Every 3 or 4 days, the cultures
were divided into fifths and recultured in fresh medium. The remaining
four-fifths was analyzed for HSA expression by flow cytometry (%HSA),
the amount of p24 in the supernatant was measured by ELISA (p24,
ng/ml), and the cells were counted (104), as described in
Materials and Methods. Due to the low number of cells in cultures at
day 11 postinfection at an MOI of 1, analyses of HSA expression and p24
were not performed at that time point. , DAt1ruEGFP CEMx174 cells
infected with NL-r-HSAS; , HR'CMVEGFP CEMx174 cells infected with
NL-r-HSAS; , SR LEGFP CEMx174 cells infected with NL-r-HSAS; ,
CEMx174 cells infected with NL-r-HSAS virus; ×, CEMx174 cells with no
NL-r-HSAS infection. (B) Mock-transduced and vector-transduced SupT1
cells (7 × 105) (DAt1ruEGFP SupT1, HR'CMVEGFP SupT1,
SR LEGFP SupT1) were infected with replication-competent NL-r-HSAS at
MOI of 0.01 and 0.1. The cultures were analyzed as described for panel
A. , DAt1ruEGFP SupT1 cells infected with NL-r-HSAS; , HR'CMVEGFP
SupT1 cells infected with NL-r-HSAS; , SR LEGFP SupT1 cells
infected with NL-r-HSAS; , SupT1 cells infected with NL-r-HSAS
virus; ×, SupT1 cells with no NL-r-HSAS infection.
|
|
Infection of DAt1ru-transduced cells resulted in induction of vector
EGFP expression (data not shown). The cells showed an
initial level of
HSA expression that plateaued and remained at
a low level for at least
25 days after infection. The results
observed by monitoring HSA
expression were paralleled by monitoring
p24 production in culture
supernatants over time. These cultures
showed significantly less
syncytia than mock-transduced cells
and were significantly protected
from cell death. CEMx174 cells
transduced with a murine retrovirus
vector (SR

LEGFP) and sorted
for EGFP expression were infected with
NL-r-HSAS and died with
kinetics equivalent to that of mock-transduced
CEMx174 cells.
The constitutively EGFP-expressing HIV-1 vector
(HR'CMVEGFP) also
showed some inhibition of HIV replication, but was
generally nonprotective.
At the highest MOI, most cells transduced with
this vector died
by 11 days after infection, but some cells recovered
that expressed
HSA but low levels of p24, likely representing selection
for resistant
survivors containing defective HIV-1. Similar inhibition
of HIV-1
replication was observed by utilizing wild-type HIV-1 NL4-3 at
an MOI of 0.01. p24 levels comparable to those of NL-r-HSAS were
observed, and cells were protected from death; however, more cell
death
was observed than in infection with NL-r-HSAS, most likely
as a result
of the presence of the functional
vpr gene product,
deleted
from NL-r-HSAS.
Results similar to those described above were observed with SupT1 cells
(Fig.
2B). The kinetics of infection of SupT1 cells
is slower than that
of CEMx174 cells. Death of most cells in the
culture occurred by 3 to 4 weeks for all vectors, except the DAt1ru-inducible
vector, which showed
suppression of HIV-1 replication and protection
from cell death for at
least 38 days after infection. We also
observed some inhibition of
HIV-1 spread in cells transduced with
the HR'CMVEGFP vector, but not to
the same extent as with DAt1ru,
and cells died with kinetics similar to
those of mock and murine
retrovirus vector-transduced cells. These
differences could not
be explained by differences in proviral copy
numbers in the populations
of transduced cells, since both populations
had similar levels
of provirus (approximately one per cell), as
measured by quantitative
DNA PCR (data not
shown).
Packaging and RT of vector.
The experiments described above
utilizing single-step infection with Thy1.2 cells bearing
replication-defective HIV-1 (Fig. 1B) indicated that the mechanism of
suppression is not a result of competition for tat or
rev activity, since cells transduced with the
DAt1ru-inducible vector expressed Thy1.2 and p24 with efficiency
comparable to that of mock-transduced cells and cells transduced with
other vectors. Since inhibition was observed in a spreading infection,
but not in the single-step infection, we determined whether HIV-1
produced from DAt1ru-transduced cells was less efficient at
establishing infection. Our results show that virus harvested from
DAt1ru-transduced cells was less efficient at infecting fresh cells, as
monitored by HSA expression 4 and 7 days postinfection (Table
1). One possibility was that the genomic
RNA of the vector was packaged and/or reverse transcribed with greater
efficiency than that of the replication-competent HIV-1, thereby
providing a selective advantage to the vector in a spreading infection.
We examined the relative ability of DAt1ru vector and NL-r-HSAS genomic
RNAs to be incorporated into virions by measuring
EGFP and HSA RNA
sequences by quantitative RT-PCR (Table
2).
Our results indicate that the DAt1ru
RNA genome is packaged at
amounts comparable to those of the NL-r-HSAS
RNA genome. Therefore,
it is unlikely that competition for packaging
could account for
the suppression of HIV-1 replication observed. In
contrast to
virions produced from DAt1ru-transduced cells, virions
produced
from HR'CMVEGFP-transduced cells had less EGFP-containing
vector
RNA than HSA-containing replication-competent HIV-1 RNA. The
reason
for this is unclear, but may reflect the presence of the
internal
CMV promoter transcribing RNA which would not contain
packaging
signals suitable for incorporation into virions.
Reverse transcriptase products synthesized 12 h after infection
for the DAt1ru vector and NL-r-HSAS were distinguished by
quantitative
PCR for EGFP- and HSA-containing genomes, respectively
(Fig.
3). The DAt1ru vector DNA genome was
present at approximately
two- to fivefold-greater levels than the
NL-r-HSAS virus genome.
In contrast, the ratios of HR'CMVEGFP vector
DNA to NL-r-HSAS
were 0.31 and 0.63 for samples A and B, respectively.
These results
indicate that the inhibition of HIV-1 infection occurs at
least
in part at a step of the viral life cycle during RT.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 3.
Quantitative analysis of de novo-synthesized vector and
viral DNA from cells harboring both replication-competent HIV-1 and
vectors. Cell culture supernatants were harvested from cultures of
vector-transduced CEMx174 cells infected with NL-r-HSAS at day 4 (MOI
of 1 [sample A]) and day 7 (MOI of 0.1 [sample B]). The p24 values
of each of the supernatants of sample A were as follows: 1,180 ng/ml
for the NL-r-HSAS-infected DAt1ruEGFP-transduced cells, 1,950 ng/ml for
NL-r-HSAS-infected HR'CMVEGFP-transduced cells, 1,120 ng/ml for
NL-r-HSAS-infected SR LEGFP-transduced cells, 920 ng/ml for
NL-r-HSAS-infected no-vector-transduced cells, and <0.08 ng/ml for
mock-infected no-vector-transduced cells). The p24 values of each of
the supernatants of sample B were as follows: 84.2 ng/ml for
NL-r-HSAS-infected DAt1ruEGFP-transduced cells, 1,390 ng/ml for
NL-r-HSAS-infected HR'CMVEGFP-transduced cells, 1,220 ng/ml for
NL-r-HSAS-infected SR LEGFP-transduced cells, 1,440 ng/ml for
NL-r-HSAS-infected no-vector-transduced cells, and <0.08 ng/ml for
mock-infected no-vector-transduced cells). Supernatants of sample B
were normalized by the p24 value (84.2 µg/ml) for infection.
Supernatants of sample A were used for infection without normalization.
Supernatants were treated with DNase before infection, as described in
Materials and Methods. Fresh CEMx174 cells (5 × 105)
were infected for 2 h with 1 ml of each supernatant. At 12 h
postinfection, DNA was purified from cells and subjected to
quantitative PCR for EGFP gene, HSA gene, and HIV-1 R/U5 LTR sequences,
as described in Materials and Methods. tRNA (0.1 µg/ml) was used as a
negative control for PCR. Quantitative EGFP, HSA, and HIV-1 LTR (R/U5)
DNA standards (std) were assayed in parallel. The EGFP- and
HSA-specific signals were compared with that of the amplified HIV-1 LTR
(R/U5) sequence to determine the percentages of EGFP/HIV-1 LTR and
HSA/HIV-1 LTR, respectively. The data are representative of two
independent PCR analyses.
|
|
 |
DISCUSSION |
These results represent proof of a concept for modeling a novel
gene therapeutic strategy for HIV-1 disease. Similar to other therapeutic strategies, such as the use of protease inhibitors and gene
therapeutic strategies, such as those involving ribozymes and
dominant-negative HIV-1 proteins, this strategy would not inhibit the
initial establishment of HIV-1 infection within a target cell; however,
the DAt1ru vector would act to inhibit subsequent rounds of viral
infection. Furthermore, the relatively low levels of gene transduction
and reconstitution currently achievable may not be as severe
limitations as they are for most gene therapeutic applications, since
the HIV-1-based vector is packaged and reverse transcribed and would
likely be mobilized and passed to other uninfected target cells, thus
amplifying the pool of cells which could serve to limit the spread of
infectious HIV-1.
We have not yet elucidated the specific step in the viral life cycle
which is affected by this vector, although it appears to occur at least
in part during RT. In cotransfection studies, other investigators have
proposed that competition for tat or rev may be
involved (11). In our experiments, we have seen no effect
upon establishment of the initial infection and gene expression dependent upon tat and rev. A smaller genome size
of the vector resulting in more efficient packaging or RT cannot solely
explain the interference observed, since HR'CMVEGFP is smaller than
DAt1ru (4.2 versus 6.1 kb), yet does not result in as significant a
degree of suppression. Further genetic mapping of viral genetic
elements required for suppression would allow us to more optimally
design a vector which should have even greater suppressive
capabilities. In addition, since this vector is packaged together with
the wild-type genome into virions, it would be conceivable that this
vector can be further modified to contain genetic elements, such as
ribozymes or antisense RNAs, that may act upon wild-type RNA copackaged in the same virion (9, 13, 14). Further understanding of the
mechanism of action and optimization of its effects will be critical
for consideration of the use of such a vector in clinical applications.
 |
ACKNOWLEDGMENTS |
We thank Beth Jamieson, Betty Poon, and Kathie Grovit-Ferbas for
reagents, Matthew Leibowitz for technical assistance, and Liz Duarte
and Rosie Taweesup for manuscript preparation.
This work was supported by UCLA CFAR grants I AI39975 and AI36555.
 |
ADDENDUM IN PROOF |
Recently Bukovsky et al. (A. A. Bukovsky, J.-P. Song, and L. Naldini, J. Virol. 73:7087-7092, 1999) used a vector
similar to HR'CMVEGFP that we found to only weakly suppress HIV-1.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Departments of
Microbiology & Immunology and Medicine, UCLA School of Medicine, Los Angeles, CA 90095-1678. Phone: (310) 825-4793. Fax: (310) 794-7682. E-mail: rtaweesu{at}ucla.edu.
 |
REFERENCES |
| 1.
|
Adachi, A.,
H. E. Gendelman,
S. Koenig,
T. Folks,
R. Willey,
A. Rabson, and M. A. Martin.
1986.
Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone.
J. Virol.
59:284-291[Abstract/Free Full Text].
|
| 2.
|
Akkina, R. K.,
R. M. Walton,
M. L. Chen,
Q.-X. Li,
V. Planelles, and I. S. Y. Chen.
1996.
High-efficiency gene transfer into CD34+ cells with a human immunodeficiency virus type 1-based retroviral vector pseudotyped with vesicular stomatitis virus envelope glycoprotein G.
J. Virol.
70:2581-2585[Abstract].
|
| 3.
|
An, D. S.,
Y. Koyanagi,
J.-Q. Zhao,
R. Akkina,
G. Bristol,
N. Yamamoto,
J. A. Zack, and I. S. Y. Chen.
1997.
High-efficiency transduction of human lymphoid progenitor cells and expression in differentiated T cells.
J. Virol.
71:1397-1404[Abstract].
|
| 4.
|
Anderson, W. F.
1998.
Human gene therapy.
Nature
392:25-30[Medline].
|
| 5.
|
Baltimore, D.
1988.
Intracellular immunization.
Nature
335:395-396[Medline].
|
| 6.
|
Buchschacher, G. L., Jr., and A. T. Panganiban.
1992.
Human immunodeficiency virus vectors for inducible expression of foreign genes.
J. Virol.
66:2731-2739[Abstract/Free Full Text].
|
| 7.
|
Burns, J. C.,
T. Friedmann,
W. Driever,
M. Burrascano, and J.-K. Yee.
1993.
Vesicular stomatitis virus G glycoprotein pseudotyped retroviral vectors: concentration to very high titer and efficient gene transfer into mammalian and nonmammalian cells.
Proc. Natl. Acad. Sci. USA
90:8033-8037[Abstract/Free Full Text].
|
| 8.
|
Cao, J.,
I.-W. Park,
A. Cooper, and J. Sodroski.
1996.
Molecular determinants of acute single-cell lysis by human immunodeficiency virus type 1.
J. Virol.
70:1340-1354[Abstract].
|
| 9.
|
Cara, A.,
S. M. Rybak,
D. L. Newton,
R. Crowley,
S. E. Rottschafer,
M. S. Reitz, Jr., and G. L. Gusella.
1998.
Inhibition of HIV-1 replication by combined expression of gag dominant negative mutant and a human ribonuclease in a tightly controlled HIV-1 inducible vector.
Gene Ther.
5:65-75[Medline].
|
| 10.
|
Corbeau, P.,
G. Kraus, and F. Wong-Staal.
1998.
Transduction of human macrophages using a stable HIV-1/HIV-2-derived gene delivery system.
Gene Ther.
5:99-104[Medline].
|
| 11.
|
Corbeau, P., and F. Wong-Staal.
1998.
Anti-HIV effects of HIV vectors.
Virology
243:268-274[Medline].
|
| 12.
|
Crystal, R. G.
1995.
Transfer of genes to humans: early lessons and obstacles to success.
Science
270:404-410[Abstract/Free Full Text].
|
| 13.
|
Ding, S. F.,
J. Noronha, and S. Joshi.
1998.
Co-packaging of sense and antisense RNAs: a novel strategy for blocking HIV-1 replication.
Nucleic Acids Res.
26:3270-3278[Abstract/Free Full Text].
|
| 14.
|
Dropulic, B.,
M. Hermankova, and P. M. Pitha.
1996.
A conditionally replicating HIV-1 vector interferes with wild-type HIV-1 replication and spread.
Proc. Natl. Acad. Sci. USA
93:11103-11108[Abstract/Free Full Text].
|
| 15.
|
Friedmann, T.
1996.
Human gene therapy an immature genie, but certainly out of the bottle.
Nat. Med.
2:144-147[Medline].
|
| 16.
|
Gibbs, J. S.,
A. A. Lackner,
S. M. Lang,
M. A. Simon,
P. K. Sehgal,
M. D. Daniel, and R. C. Desrosiers.
1995.
Progression to AIDS in the absence of a gene for vpr or vpx.
J. Virol.
69:2378-2383[Abstract].
|
| 17.
|
Hanna, Z.,
D. G. Kay,
N. Rebai,
A. Guimond,
S. Jothy, and P. Jolicoeur.
1998.
Nef harbors a major determinant of pathogenicity for an AIDS-like disease induced by HIV-1 in transgenic mice.
Cell
95:163-175[Medline].
|
| 18.
|
Jamieson, B. D., and J. A. Zack.
1998.
In vivo pathogenesis of a human immunodeficiency virus type 1 reporter virus.
J. Virol.
72:6520-6526[Abstract/Free Full Text].
|
| 19.
|
Kafri, T.,
U. Blomer,
D. A. Peterson,
F. H. Gage, and I. M. Verma.
1997.
Sustained expression of genes delivered directly into liver and muscle by lentiviral vectors.
Nat. Genet.
17:314-317[Medline].
|
| 20.
|
Kim, V. N.,
K. Mitrophanous,
S. M. Kingsman, and A. J. Kingsman.
1998.
Minimal requirement for a lentivirus vector based on human immunodeficiency virus type 1.
J. Virol.
72:811-816[Abstract/Free Full Text].
|
| 21.
|
Koyanagi, Y.,
S. Miles,
R. T. Mitsuyasu,
J. E. Merril,
H. V. Vinters, and I. S. Y. Chen.
1987.
Dual infection of the central nervous system by AIDS viruses with distinct cellular tropisms.
Science
236:819-822[Abstract/Free Full Text].
|
| 22.
|
Landau, N. R., and D. R. Littman.
1992.
Packaging system for rapid production of murine leukemia virus vectors with variable tropism.
J. Virol.
66:5110-5113[Abstract/Free Full Text].
|
| 23.
|
Li, C. J.,
D. J. Friedman,
C. Wang,
V. Metelev, and A. B. Pardee.
1995.
Induction of apoptosis in uninfected lymphocytes by HIV-1 tat protein.
Science
268:429-431[Abstract/Free Full Text].
|
| 24.
|
Lu, Y.-Y.,
Y. Koga,
K. Tanaka,
M. Sasaki,
G. Kimura, and K. Nomoto.
1994.
Apoptosis induced in CD4+ cells expressing gp160 of human immunodeficiency virus type 1.
J. Virol.
68:390-399[Abstract/Free Full Text].
|
| 25.
|
Miyoshi, H.,
U. Blömer,
M. Takahashi,
F. H. Gage, and I. M. Verma.
1998.
Development of a self-inactivating lentivirus vector.
J. Virol.
72:8150-8157[Abstract/Free Full Text].
|
| 26.
|
Miyoshi, H.,
M. Takahashi,
F. H. Gage, and I. M. Verma.
1997.
Stable and efficient gene transfer into the retina using an HIV-based lentiviral vector.
Proc. Natl. Acad. Sci. USA
94:10319-10323[Abstract/Free Full Text].
|
| 27.
|
Mochizuki, H.,
J. P. Schwartz,
K. Tanaka,
R. O. Brady, and J. Reiser.
1998.
High-titer human immunodeficiency virus type 1-based vector systems for gene delivery into nondividing cells.
J. Virol.
72:8873-8883[Abstract/Free Full Text].
|
| 28.
|
Naldini, L.,
U. Blomer,
F. H. Gage,
D. Trono, and I. M. Verma.
1996.
Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector.
Proc. Natl. Acad. Sci. USA
93:11382-11388[Abstract/Free Full Text].
|
| 29.
|
Naldini, L.,
U. Blomer,
P. Gallay,
D. Ory,
R. Mulligan,
F. H. Gage,
I. M. Verma, and D. Trono.
1996.
In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector.
Science
272:263-266[Abstract].
|
| 30.
|
Parolin, C.,
T. Dorfman,
G. Palú,
H. Göttlinger, and J. Sodroski.
1994.
Analysis in human immunodeficiency virus type 1 vectors of cis-acting sequences that affect gene transfer into human lymphocytes.
J. Virol.
68:3888-3895[Abstract/Free Full Text].
|
| 31.
|
Planelles, V.,
F. Bachelerie,
J. B. M. Jowett,
A. Haislip,
Y. Xie,
P. Banooni,
T. Masuda, and I. S. Y. Chen.
1995.
Fate of the human immunodeficiency virus type 1 provirus in infected cells: a role for vpr.
J. Virol.
69:5883-5889[Abstract].
|
| 32.
|
Plavec, I.,
M. Agarwal,
K. Ho,
M. Pineda,
J. Auten,
J. Baker,
H. Matsuzaki,
S. Escaich,
M. Bonyhadi, and E. Bohnlein.
1997.
High transdominant RevM10 protein levels are required to inhibit HIV-1 replication in cell lines and primary T cells: implication for gene therapy of AIDS.
Gene Ther.
4:128-139[Medline].
|
| 33.
|
Poon, B.,
J. B. M. Jowett,
S. A. Stewart,
R. W. Armstrong,
G. M. Rishton, and I. S. Y. Chen.
1997.
Human immunodeficiency virus type 1 vpr gene induces phenotypic effects similar to those of the DNA alkylating agent, nitrogen mustard.
J. Virol.
71:3961-3971[Abstract].
|
| 34.
|
Poznansky, M.,
A. Lever,
L. Bergeron,
W. Haseltine, and J. Sodroski.
1991.
Gene transfer into human lymphocytes by a defective human immunodeficiency virus type 1 vector.
J. Virol.
65:532-536[Abstract/Free Full Text].
|
| 35.
|
Reiser, J.,
G. Harmison,
S. Kluepfel-Stahl,
R. O. Brady,
S. Karlsson, and M. Schubert.
1996.
Transduction of nondividing cells using pseudotyped defective high-titer HIV type 1 particles.
Proc. Natl. Acad. Sci. USA
93:15266-15271[Abstract/Free Full Text].
|
| 36.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed., p. 16.32-16.34.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 37.
|
Stewart, S. A.,
B. Poon,
J. B. M. Jowett, and I. S. Y. Chen.
1997.
Human immunodeficiency virus type 1 Vpr induces apoptosis following cell cycle arrest.
J. Virol.
71:5579-5592[Abstract].
|
| 38.
|
Sutton, R. E.,
H. T. M. Wu,
R. Rigg,
E. Böhnlein, and P. O. Brown.
1998.
Human immunodeficiency virus type 1 vectors efficiently transduce human hematopoietic stem cells.
J. Virol.
72:5781-5788[Abstract/Free Full Text].
|
| 39.
|
Verma, I. M.
1994.
Gene therapy: hopes, hypes, and hurdles.
Mol. Med.
1:2-3[Medline].
|
| 40.
|
Verma, I. M., and N. Somia.
1997.
Gene therapy promises, problems and prospects.
Nature
389:239-242[Medline].
|
| 41.
|
Zack, J. A.,
S. J. Arrigo,
S. R. Weitsman,
A. S. Go,
A. Haislip, and I. S. Y. Chen.
1990.
HIV-1 entry into quiescent primary lymphocytes: molecular analysis reveals a labile, latent viral structure.
Cell
61:213-222[Medline].
|
Journal of Virology, September 1999, p. 7671-7677, Vol. 73, No. 9
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Krishnamachary, B., Glunde, K., Wildes, F., Mori, N., Takagi, T., Raman, V., Bhujwalla, Z. M.
(2009). Noninvasive Detection of Lentiviral-Mediated Choline Kinase Targeting in a Human Breast Cancer Xenograft. Cancer Res.
69: 3464-3471
[Abstract]
[Full Text]
-
Walsh, C. T., Radeff-Huang, J., Matteo, R., Hsiao, A., Subramaniam, S., Stupack, D., Brown, J. H.
(2008). Thrombin receptor and RhoA mediate cell proliferation through integrins and cysteine-rich protein 61. FASEB J.
22: 4011-4021
[Abstract]
[Full Text]
-
Skasko, M., Kim, B.
(2008). Compensatory Role of Human Immunodeficiency Virus Central Polypurine Tract Sequence in Kinetically Disrupted Reverse Transcription. J. Virol.
82: 7716-7720
[Abstract]
[Full Text]
-
Kitayama, H., Miura, Y., Ando, Y., Hoshino, S., Ishizaka, Y., Koyanagi, Y.
(2008). Human Immunodeficiency Virus Type 1 Vpr Inhibits Axonal Outgrowth through Induction of Mitochondrial Dysfunction. J. Virol.
82: 2528-2542
[Abstract]
[Full Text]
-
Poon, B., Chang, M. A., Chen, I. S. Y.
(2007). Vpr Is Required for Efficient Nef Expression from Unintegrated Human Immunodeficiency Virus Type 1 DNA. J. Virol.
81: 10515-10523
[Abstract]
[Full Text]
-
Burke, B., Brown, H. J., Marsden, M. D., Bristol, G., Vatakis, D. N., Zack, J. A.
(2007). Primary Cell Model for Activation-Inducible Human Immunodeficiency Virus. J. Virol.
81: 7424-7434
[Abstract]
[Full Text]
-
Sander, W. E., Metzger, M. E., Morizono, K., Bonifacino, A., Penzak, S. R., Xie, Y.-M., Chen, I. S.Y., Bacon, J., Sestrich, S. G., Szajek, L. P., Donahue, R. E.
(2006). Noninvasive Molecular Imaging to Detect Transgene Expression of Lentiviral Vector in Nonhuman Primates. JNM
47: 1212-1219
[Abstract]
[Full Text]
-
Ardon, O., Zimmerman, E. S., Andersen, J. L., DeHart, J. L., Blackett, J., Planelles, V.
(2006). Induction of g2 arrest and binding to cyclophilin a are independent phenotypes of human immunodeficiency virus type 1 vpr.. J. Virol.
80: 3694-3700
[Abstract]
[Full Text]
-
DeHart, J. L., Andersen, J. L., Zimmerman, E. S., Ardon, O., An, D. S., Blackett, J., Kim, B., Planelles, V.
(2005). The Ataxia Telangiectasia-Mutated and Rad3-Related Protein Is Dispensable for Retroviral Integration. J. Virol.
79: 1389-1396
[Abstract]
[Full Text]
-
Zimmerman, E. S., Chen, J., Andersen, J. L., Ardon, O., DeHart, J. L., Blackett, J., Choudhary, S. K., Camerini, D., Nghiem, P., Planelles, V.
(2004). Human Immunodeficiency Virus Type 1 Vpr-Mediated G2 Arrest Requires Rad17 and Hus1 and Induces Nuclear BRCA1 and {gamma}-H2AX Focus Formation. Mol. Cell. Biol.
24: 9286-9294
[Abstract]
[Full Text]
-
Weinberger, L. S., Schaffer, D. V., Arkin, A. P.
(2003). Theoretical Design of a Gene Therapy To Prevent AIDS but Not Human Immunodeficiency Virus Type 1 Infection. J. Virol.
77: 10028-10036
[Abstract]
[Full Text]
-
Roshal, M., Kim, B., Zhu, Y., Nghiem, P., Planelles, V.
(2003). Activation of the ATR-mediated DNA Damage Response by the HIV-1 Viral Protein R. J. Biol. Chem.
278: 25879-25886
[Abstract]
[Full Text]
-
STEWART, S. A., DYKXHOORN, D. M., PALLISER, D., MIZUNO, H., YU, E. Y., AN, D. S., SABATINI, D. M., CHEN, I. S.Y., HAHN, W. C., SHARP, P. A., WEINBERG, R. A., NOVINA, C. D.
(2003). Lentivirus-delivered stable gene silencing by RNAi in primary cells. RNA
9: 493-501
[Abstract]
[Full Text]
-
Poon, B., Chen, I. S. Y.
(2003). Human Immunodeficiency Virus Type 1 (HIV-1) Vpr Enhances Expression from Unintegrated HIV-1 DNA. J. Virol.
77: 3962-3972
[Abstract]
[Full Text]
-
Morizono, K., Bristol, G., Xie, Y.-m., Kung, S. K.-P., Chen, I. S. Y.
(2001). Antibody-Directed Targeting of Retroviral Vectors via Cell Surface Antigens. J. Virol.
75: 8016-8020
[Abstract]
[Full Text]
-
An, D. S., Kung, S. K. P., Bonifacino, A., Wersto, R. P., Metzger, M. E., Agricola, B. A., Mao, S. H., Chen, I. S. Y., Donahue, R. E.
(2001). Lentivirus Vector-Mediated Hematopoietic Stem Cell Gene Transfer of Common Gamma-Chain Cytokine Receptor in Rhesus Macaques. J. Virol.
75: 3547-3555
[Abstract]
[Full Text]
-
Mautino, M. R., Keiser, N., Morgan, R. A.
(2001). Inhibition of Human Immunodeficiency Virus Type 1 (HIV-1) Replication by HIV-1-Based Lentivirus Vectors Expressing Transdominant Rev. J. Virol.
75: 3590-3599
[Abstract]
[Full Text]
-
Zhu, Y., Gelbard, H. A., Roshal, M., Pursell, S., Jamieson, B. D., Planelles, V.
(2001). Comparison of Cell Cycle Arrest, Transactivation, and Apoptosis Induced by the Simian Immunodeficiency Virus SIVagm and Human Immunodeficiency Virus Type 1 vpr Genes. J. Virol.
75: 3791-3801
[Abstract]
[Full Text]
-
Reiser, J., Lai, Z., Zhang, X.-Y., Brady, R. O.
(2000). Development of Multigene and Regulated Lentivirus Vectors. J. Virol.
74: 10589-10599
[Abstract]
[Full Text]
-
Kung, S. K. P., An, D. S., Chen, I. S. Y.
(2000). A Murine Leukemia Virus (MuLV) Long Terminal Repeat Derived from Rhesus Macaques in the Context of a Lentivirus Vector and MuLV gag Sequence Results in High-Level Gene Expression in Human T Lymphocytes. J. Virol.
74: 3668-3681
[Abstract]
[Full Text]
-
Stewart, S. A., Poon, B., Song, J. Y., Chen, I. S. Y.
(2000). Human Immunodeficiency Virus Type 1 Vpr Induces Apoptosis through Caspase Activation. J. Virol.
74: 3105-3111
[Abstract]
[Full Text]
-
An, D. S., Wersto, R. P., Agricola, B. A., Metzger, M. E., Lu, S., Amado, R. G., Chen, I. S. Y., Donahue, R. E.
(2000). Marking and Gene Expression by a Lentivirus Vector in Transplanted Human and Nonhuman Primate CD34+ Cells. J. Virol.
74: 1286-1295
[Abstract]
[Full Text]