This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cohen, J. I.
Right arrow Articles by Lekstrom, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cohen, J. I.
Right arrow Articles by Lekstrom, K.

 Previous Article  |  Next Article 

Journal of Virology, September 1999, p. 7627-7632, Vol. 73, No. 9
0022-538X/99/$04.00+0

Epstein-Barr Virus BARF1 Protein Is Dispensable for B-Cell Transformation and Inhibits Alpha Interferon Secretion from Mononuclear Cells

Jeffrey I. Cohen* and Kristen Lekstrom

Medical Virology Section, Laboratory of Clinical Investigation, National Institute of Allergy and Infectious Diseases, Bethesda, Maryland 20892

Received 24 March 1999/Accepted 14 June 1999


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The Epstein-Barr virus (EBV) BARF1 gene encodes a soluble colony-stimulating factor 1 (CSF-1) receptor that neutralizes the effects of CSF-1 in vitro. To study the effect of BARF1 on EBV-induced transformation, we added recombinant BARF1 to B cells in the presence of EBV. BARF1 did not enhance transformation of B cells by EBV in vitro. To study the role of BARF1 in the context of EBV infection, we constructed a recombinant EBV mutant with a large deletion followed by stop codons in the BARF1 gene as well as a recombinant virus with a wild-type BARF1 gene. While BARF1 has previously been shown to act as an oncogene in several cell lines, the EBV BARF1 deletion mutant transformed B cells and initiated latent infection, and the B cells transformed with the BARF1 mutant virus induced tumors in SCID mice with an efficiency similar to that of the wild-type recombinant virus. Since human CSF-1 stimulates secretion of alpha interferon from mononuclear cells and BARF1 encodes a soluble CSF-1 receptor, we examined whether recombinant BARF1 or BARF1 derived from EBV-infected B cells could inhibit alpha interferon secretion. Recombinant BARF1 inhibited alpha interferon secretion by mononuclear cells in a dose-dependent fashion. The B cells transformed with mutant BARF1 EBV showed reduced inhibition of alpha interferon secretion by human mononuclear cells when compared with the B cells transformed with wild-type recombinant virus. These experiments indicate that BARF1 expressed from the EBV genome directly inhibits alpha interferon secretion, which may modulate the innate host response to the virus.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Herpesviruses encode several proteins that modulate the immune system. Herpes simplex virus, varicella-zoster virus, and cytomegalovirus downregulate surface expression of class I major histocompatibility complex (MHC) antigens (1, 9, 18). The cytomegalovirus pp65 protein inhibits presentation of the immediate-early protein to cytotoxic T cells (16), and the UL18 protein is an MHC class I homolog that inhibits natural killer (NK) cell killing of virus-infected cells (27). The Epstein-Barr virus (EBV) EBNA-1 protein has glycine-alanine repeats that interfere with proteolysis of the protein by proteosomes (21).

Herpesviruses also encode homologs of cytokines, chemokines, and their receptors. Kaposi's sarcoma-associated herpesvirus (KSHV) encodes a homolog of interleukin-6 (IL-6) (25), EBV encodes an IL-10 homolog (19), and herpesvirus saimiri encodes an IL-17 homolog (44). KSHV encodes three chemokines, two homologous to the macrophage inflammatory protein 1-alpha and one in the CC chemokine family (30). Human cytomegalovirus, KSHV, and herpesvirus saimiri encode chemokine receptors (2, 3, 14). While EBV appears to encode fewer cellular homologs than other gamma herpesviruses, EBV induces expression of IL-6 (36) and a chemokine receptor (5).

Recently, we have shown that the EBV BARF1 protein functions as a soluble receptor for human colony-stimulating factor 1 (CSF-1) (32). Recombinant BARF1 inhibits the ability of CSF-1 to induce proliferation of bone marrow macrophage progenitor cells. CSF-1 is known to have a number of other activities, including induction of mononuclear cells to release cytokines, such as alpha interferon, tumor necrosis factor alpha, granulocyte colony-stimulating factor, and IL-1 (29). Thus, the ability of EBV BARF1 to block CSF-1 activity might impair cytokine release from mononuclear cells and thereby reduce the cellular immune response to EBV.

Prior studies showed that BARF1 acts as an oncogene when stably expressed in mouse fibroblasts, monkey kidney cells, or B-lymphoma cells (41-43). BARF1 induces expression of the c-myc proto-oncogene and B-cell activation antigens CD21 and CD23 (41). While BARF1 is classified as an early gene (45) that is not expressed during latent virus infection (37), it might have a role in initiating EBV transformation of B cells.

To better determine the role of BARF1 in EBV infection, we constructed a mutant virus with a deletion in the BARF1 gene and compared its activities with those of a recombinant virus with a wild-type BARF1 sequence. The BARF1 mutant virus had a similar activity in initiating latent infection, transforming B cells, and inducing tumors in SCID mice as the recombinant virus with wild-type BARF1. However, when compared with the wild-type virus, the BARF1 mutant virus was impaired in its ability to inhibit alpha interferon production by mononuclear cells. Thus, BARF1 may be important for modulation of the innate immune response to EBV.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Cell lines, virus, and cosmid DNA. The P3HR-1 cell line is derived from a Burkitt's lymphoma cell line that lacks the EBNA-2 gene. EBV cosmids EcoRI-A and SnaBI-B contain large portions of the B95-8 genome cloned into cosmid pDVcosA2 (38). The BARF1 gene contains EBV nucleotides 165504 to 166166 (4). To produce a cosmid with a deletion and stop codons in BARF1, cosmid EcoRI-Dhet (13) was cut with PmeI and NsiI at EBV nucleotides 165650 and 165953. The large fragment was blunted with T4 DNA polymerase and an oligonucleotide, CTAGTTAATTAACTAG, containing stop codons in all three open reading frames, and a PacI site was inserted (Fig. 1). Since BARF1 is predicted to have a signal sequence that is cleaved after amino acid 20, the resulting cosmid EcoRI-Dhet-BARF1D is predicted to have stop codons inserted after the first 29 amino acids of the mature protein. The deletion of the last 172 amino acids of the protein includes the region which is conserved with the human CSF-1 receptor (32). Plasmid SVNaeIBamZ (10) contains the EBV BZLF1 gene inserted into expression plasmid pSG5 (Stratagene, La Jolla, Calif.).


View larger version (18K):
[in this window]
[in a new window]
 
FIG. 1.   Construction of EBV with stop codons in BARF1. The EBV genome consists of 172,282 bp of circular DNA, a portion of which is shown (line 1). Cosmids SnaBI-B, EcoRI-A, and EcoRI-Dhet were used to transfect P3HR-1 cells to produce EBV with a wild-type BARF1 gene. The EcoRI-Dhet cosmid was cut with PmeI and NsiI, and an oligonucleotide was inserted to construct cosmid EcoRI-Dhet-BARF1D. The BARF1 gene in this cosmid has a deletion of amino acids (aa) 50 to 150 followed by stop codons.

Transfections and infections. To produce recombinant EBV, P3HR-1 cells were transfected by electroporation (10). A total of 10 µg of cosmid EcoRI-A, 20 µg of cosmid SnaBI-B, 20 µg of cosmid EcoRI-Dhet or EcoRI-Dhet-BARF1D, and 30 µg of plasmid SVNaeIBamZ were used to transfect P3HR-1 cells. Three days after transfection, virus was harvested and primary human B lymphocytes were infected as described previously (10). Passage of EBV from virus-transformed lymphoblastoid cell lines to B cells was performed as described previously (35). Briefly, cells were treated with phorbol myristate acetate (PMA) to induce EBV replication, lethally irradiated with 90 Gy, and incubated with B cells in 96-well plates; the number of wells containing transformed cells was counted.

Transformation assays with BARF1. BARF1.Fc is a fusion protein containing the BARF1 gene fused to the Fc portion of human immunoglobulin G1 (32). To assay for enhancement of EBV-induced B-cell transformation by BARF1, serial dilutions of the EBV Akata strain were added to BARF1.Fc, control Fc protein (vaccinia virus p7.5.Fc), or media, and 2 × 106 human peripheral blood mononuclear cells (PBMC) were added and plated into eight wells of a microtiter plate. The medium was changed weekly, and the number of wells containing transformants was counted at 6 weeks.

PCR and reverse transcriptase PCR. PCR was performed with total cellular DNA obtained from lymphoblastoid cells. Oligonucleotides CACCGCTTTCTTGGGTGAGC and CCCTCGGGCATGAGCCACTG, corresponding to EBV nucleotides 165566 to 165585 and 165991 to 165972, respectively, were used in the PCR.

For reverse transcriptase PCR, RNA was isolated from lymphoblastoid cells and treated with RNase-free DNase I, and cDNA was produced by using oligo-dT and Moloney murine leukemia virus reverse transcriptase and was amplified by PCR as described above.

SCID mice assays. SCID mice (CB17/IcrHsd-scid) were screened to identify those that do not produce murine immunoglobulin and therefore have no residual B-cell function. Mice were injected intraperitoneally with 4 × 106 EBV-transformed cells containing wild-type or mutant BARF1 genomes. Animals were monitored for the development of tumors and sacrificed when moribund or at 105 days. Histopathologic analysis of liver, spleen, and tumor tissues was performed. The distributions of the animals surviving were compared by the Wilcoxon 2 sample test. Also, Kaplan-Meier survival curves were compared by the log-rank test. P values were adjusted for multiple comparisons by the Bonferroni method.

Alpha interferon assays. Adherent human mononuclear cells were obtained by incubating 2.5 × 106 PBMC into each well of a 24-well plate for 2 h and removing the nonadherent cells by washing them twice with serum-free media. Recombinant human CSF-1 (10 ng/ml; R & D Systems, Minneapolis, Minn.) and BARF1.Fc (0.01 to 5 µg/ml), vaccinia virus p7.5.Fc (0.01 to 5 µg/ml), or medium was added. After 3 days, the medium was removed, the cells were washed with phosphate-buffered saline, and poly(I · C) (Sigma, Chicago, Ill.) was added to 50 µg/ml, and 2 days later the supernatant was assayed for alpha interferon by enzyme-linked immunosorbent assay (ELISA) (Biosource International, Camarillo, Calif.).

To assay the effect of BARF1 secreted from EBV-infected B cells on alpha interferon production, lymphoblastoid cells containing wild-type or mutant BARF1 EBV genomes were treated with 20 ng of PMA per ml to induce EBV replication. Three days later, the cells were irradiated with 90 Gy and washed twice in medium, and 4 × 104 cells were added to adherent human PBMC in 1 ml of a 24-well plate with human CSF-1 (10 ng/ml). Three days later, the cells were washed and poly(I · C) was added, and after 2 days, the supernatants were assayed for alpha interferon as described above.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Recombinant BARF1.Fc does not enhance EBV transformation of human B cells in vitro. To determine whether BARF1 could enhance transformation of B cells by EBV, serial dilutions of virus were incubated with BARF1.Fc (1.5 µg/ml), control Fc protein, or medium. PBMC were then added, and wells containing transformants were counted. BARF1.Fc did not enhance transformation (Table 1). To further confirm that BARF1 does not enhance transformation, the amount of EBV was kept constant, different dilutions of BARF1.Fc (4 to 50 µg/ml), control Fc protein, or medium were added to PBMC, and the number of wells containing transformants was assayed. BARF1.Fc and the control Fc protein had no effect on EBV transformation (12).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Soluble BARF1 does not enhance EBV transformation of B cells

Construction of recombinant EBV that is unable to express BARF1. P3HR-1 cells contain an EBV genome with a deletion in the EBNA-2 gene that can replicate viral DNA but cannot transform B cells. Transfection of P3HR-1 cells with DNA containing the EBNA-2 gene results in production of transformation-competent recombinant EBV in which the EBNA-2 gene has been restored by homologous recombination (10). If P3HR-1 cells are transfected with the EBNA-2 gene and a second DNA containing a mutated EBV gene, homologous recombination can occur, resulting in an EBV genome with a full-length EBNA-2 gene and a mutation at the second site (35).

To produce recombinant EBV that is unable to express BARF1, cosmid EcoRI-Dhet-BARF1D was constructed that contains the EBV BARF1 gene with a large deletion followed by stop codons. P3HR-1 cells were transfected with EBV cosmids EcoRI-Dhet-BARF1D, EcoRI-A (which contains EBNA-2), and SnaBI-B (Fig. 1). Cosmid SnaBI-B spans the gap between EBNA-2 and the BARF1 mutation, thereby increasing the likelihood that recombinants will have both a restored EBNA-2 gene and a mutation in BARF1. Primary B cells were infected with virus obtained from the transfected cells, and transformants were screened by PCR for the BARF1 deletion. All transformants contained either the wild-type BARF1 gene or both the wild-type and mutant BARF1 genes. These cell lines were probably due to coinfection with P3HR-1 virus, which contains wild-type BARF1, and recombinant P3HR-1 with mutant BARF1.

To isolate cell lines with only EBV genomes from which BARF1 was deleted, cells coinfected with wild-type BARF1 EBV and mutant BARF1 EBV were induced to undergo lytic replication, and the resultant virus was used to transform primary B cells. Analysis of the mutants by PCR showed that a number of the cell lines contained EBV genomes with only mutant BARF1. Cells containing only wild-type BARF1 were also induced in parallel to obtain cell lines from the same donors that contain only wild-type BARF1. Southern blotting of DNA with a SmaI fragment containing the BARF1 gene confirmed that several cell lines contained EBV genomes with only mutant BARF1 (Fig. 2).


View larger version (44K):
[in this window]
[in a new window]
 
FIG. 2.   Southern blot of recombinant EBV with deletion in BARF1. Lymphoblastoid cell lines containing EBV with only the mutant BARF1 gene (lanes 1 to 6 and 8) or wild-type BARF1 gene (lane 7) and P3HR-1 cells that contain wild-type BARF1 (lane 9) are shown. The deletion in the BARF1 gene removes 0.3 kb of DNA. Markers indicate DNA sizes in kilobases.

Expression of BARF1 RNA in cells infected with recombinant EBV containing wild-type or mutant BARF1. While BARF1 has been detected in cell lines that are highly permissive for viral replication (32, 37), the protein has not been detected in lymphoblastoid cell lines after induction of lytic replication (12, 37). To verify that BARF1 RNA is expressed in lymphoblastoid cells infected with recombinant EBV, viral replication was induced in cells containing wild-type or mutant BARF1, total RNA was isolated, cDNA was made, and a portion of the BARF1 gene was amplified by PCR. Cells containing wild-type BARF1 had a 426-bp band, while cells with mutant BARF1 had a 107-bp band, due to the deletion in BARF1 (Fig. 3A). No PCR product was detected in the absence of reverse transcriptase, indicating that the PCR product was from cDNA and not viral DNA contaminating the RNA (Fig. 3B).


View larger version (41K):
[in this window]
[in a new window]
 
FIG. 3.   PCR amplification of cDNA obtained from BARF1 RNA from cell lines containing recombinant EBV with wild-type or mutant BARF1 genomes. (A) PCR amplification of cDNA obtained from RNA isolated from EBV-transformed cells containing wild-type (lanes 1 to 4) or mutant BARF1 (lanes 5 to 8). Cell lines are designated at the top of each lane. PCR amplification of DNA from a cosmid containing wild-type BARF1 (lane 9) or the BARF1 deletion mutant (lane 10) serves as a control. (B) Selected RNAs used in panel A were left untreated (-) or were treated (+) with reverse transcriptase (RT) before PCR to verify that the DNase I digestion was adequate. PCR amplification of DNA from wild-type or deleted BARF1 genes are shown. Markers indicate DNA sizes in kilobases.

EBV that is unable to express BARF1 is not impaired for B-cell transformation or initiation of lytic infection in vitro. To determine whether BARF1 has a role in initiating lytic infection, cell lines containing only wild-type or mutant BARF1 EBV genomes were induced to undergo lytic replication, and protein lysates from induced cells were analyzed on Western blots with human serum that recognizes EBV lytic genes. While the levels of lytic proteins varied between cell lines, there was no consistent difference in the level of EBV lytic proteins in cells containing wild-type and mutant BARF1 EBV genomes (Fig. 4).


View larger version (46K):
[in this window]
[in a new window]
 
FIG. 4.   Lytic replication by lymphoblastoid cells containing recombinant EBV with either mutant (A) or wild-type (B) BARF1. Protein lysates from cells induced to undergo lytic replication were analyzed by Western blot analysis with human serum that recognizes early replicative antigens. Markers indicate protein sizes in kilodaltons.

BARF1 has previously been shown to have oncogenic activity in B-lymphoma cells (41). To determine whether BARF1 might have a direct role in B-cell transformation, cells containing only mutant or wild-type BARF1 EBV genomes that expressed comparable levels of lytic viral proteins were induced to undergo lytic replication and were lethally irradiated, and the resultant viruses were used to transform human B cells. Similar numbers of transformants were obtained from cells containing either wild-type or mutant BARF1 EBV genomes (Table 2) (Wilcoxon rank sum score, P = 0.25).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   Transformation by recombinant EBV with wild-type or mutant BARF1 genea

Cells transformed with EBV that are unable to express BARF1 are not impaired for induction of B-cell tumors in SCID mice. Inoculation of SCID mice with EBV-transformed B cells results in EBV-containing lymphomas, and certain EBV mutants show different transforming phenotypes in vivo (11). To determine whether BARF1 has a role in transformation in vivo, SCID mice were inoculated intraperitoneally with EBV-transformed B cells containing either wild-type or mutant BARF1 genes. Four different cell lines containing each virus were used, and at least four mice were inoculated with each cell line. Animals were sacrificed when moribund or at 105 days. The experiment was done twice, with similar results, and the data were pooled (Fig. 5). There was no significant difference in survival of animals receiving cells containing wild-type or mutant BARF1 EBV (P > 0.5). The median time to death in animals receiving wild-type BARF1 recombinant virus (58 days, confidence interval 53 to 76) was similar to that in animals receiving BARF1 mutant virus (58 days, confidence interval 54 to 69). High-grade lymphoblastic lymphomas were present in the lymph nodes, liver, spleen, and abdominal wall, with spread to the skin, pancreas, stomach, and large and small intestines in animals receiving cells containing either wild-type or mutant BARF EBV.


View larger version (11K):
[in this window]
[in a new window]
 
FIG. 5.   Kaplan-Meier survival curve for SCID mice receiving transformed B cells containing wild-type or mutant BARF1. The experiment was performed twice, and the pooled data are shown.

Inhibition of alpha interferon secretion from human mononuclear cells by BARF1. BARF1 was previously shown to encode a soluble CSF-1 receptor. Since CSF-1 induces alpha interferon production by mononuclear cells (40), BARF1 might block the ability of CSF-1 to induce alpha interferon. Prior experiments by ourselves and others (12, 40) showed that addition of poly(I · C) and CSF-1 to monocytes was required for alpha interferon secretion. Recombinant human CSF-1 and BARF1.Fc or a control Fc protein was added to human mononuclear cells, followed by poly(I · C), and the supernatants were assayed for alpha interferon. BARF1.Fc inhibited alpha interferon secretion by mononuclear cells with a dose-dependent response, while control Fc protein had little effect on alpha interferon (Fig. 6A).


View larger version (13K):
[in this window]
[in a new window]
 
FIG. 6.   BARF1 inhibits secretion of alpha interferon. (A) Secretion of alpha interferon from human mononuclear cells in the presence of recombinant BARF1.Fc or control Fc fusion protein. (B) Secretion of alpha interferon from human mononuclear cells in the presence of BARF1 expressed by EBV-transformed B cells. Lymphoblastoid cell lines transformed with EBV containing wild-type (BARF1 +) or mutant (BARF1 -) BARF1 were induced to lytic replication, irradiated, and incubated with mononuclear cells, and alpha interferon was assayed. Each point represents a different lymphoblastoid cell line.

To determine whether EBV-produced BARF1 has an effect similar to that of BARF1.Fc on the inhibition of alpha interferon production by mononuclear cells, cell lines were selected from different donors that were transformed with recombinant wild-type or mutant BARF1 EBV that showed similar levels of lytic protein expression. The cells were induced for lytic replication, irradiated, and added to mononuclear cells with CSF-1. Poly(I · C) was added and alpha interferon was measured in the supernatants. Cells containing wild-type BARF1 EBV genomes inhibited alpha interferon secretion by mononuclear cells to a greater extent than cells containing mutant BARF1 (Fig. 6B), although there was overlap between the two groups. When the results of assays performed in 16 separate experiments with different donors were analyzed together, the median level of alpha interferon produced in monocytes after exposure to cells containing wild-type BARF1 EBV genomes (77 pg/ml) was about one-half that (166 pg/ml) after exposure to cells containing mutant BARF1. The difference in alpha interferon levels between the cell groups was highly significant (Wilcoxon 2 sample test, P = 0.004).


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

We have shown that both recombinant BARF1 and EBV-produced BARF1 inhibit alpha interferon production by human monocytes. The levels of alpha interferon secreted from these cells (50 to 100 pg/ml) are similar to the levels of alpha interferon that have been shown to inhibit the outgrowth of EBV-transformed B cells (15). Therefore, BARF1 may play an important role in modulating the innate host response to promote survival of virus-infected cells in vivo. BARF1 could protect virus-infected cells by inhibiting innate host responses when it is expressed in the lytic cycle during acute EBV infection of epithelial cells or during virus reactivation in B cells.

Alpha interferon is one of the first cytokines produced in response to virus infection. Alpha interferon activates NK cell cytotoxicity and lysis of virus-infected cells and is necessary for both NK cell blastogenesis and cytotoxicity during murine cytomegalovirus infection (6). While cytotoxic T cells are critical for controlling persistent EBV infection, NK cells are important during the initial stages of EBV infection. Increased numbers of NK cells are present within weeks after primary infection with EBV (24). Impaired NK cell cytotoxic activity has been associated with severe human herpesvirus infections (7), including EBV infections (20, 34).

Alpha interferon has been shown to have a role during EBV infection in vivo. Alpha interferon decreases EBV shedding in immunosuppressed patients (8), and the cytokine has been used successfully to treat some cases of EBV-associated lymphoproliferative disease (31). Circulating alpha interferon levels are decreased during acute infectious mononucleosis (26) at a time of active EBV replication when BARF1 should be expressed. Alpha interferon has a number of other activities that can enhance the cellular arm of the immune system, including upregulation of the expression of the IL-12 receptor to induce TH1 development (28), induction of the expression of MHC class I molecules (23), and enhancement in the generation and maintenance of memory T cells (39). Thus, inhibition of alpha interferon production by EBV may allow virus-infected cells to avoid destruction by the immune system.

While BARF1 has been shown to act as an oncogene in stably transfected B-lymphoma cells (41), EBV that is unable to express BARF1 was not impaired for B-cell transformation. In addition, we did not detect a difference in induction of B-cell tumors in mice with wild-type BARF1 and mutant BARF1 recombinant EBV. In stably transfected B-lymphoma cells, BARF1 protein could be detected directly by immunofluorescence and BARF1 RNA could be detected by Northern blot analysis (41); however, in EBV-transformed B cells, BARF1 RNA was detected only by reverse transcriptase PCR after induction of lytic replication of the cells and the gene was not expressed during latent infection. Thus, BARF1 apparently does not have a role in B-cell transformation when expressed at the levels obtained during EBV infection of primary B cells. While recombinant BARF1 did not stimulate virus-induced B-cell transformation, EBV contains another gene, viral IL-10, which has been shown to enhance EBV transformation of B cells directly (33).

In addition to capturing a CSF-1 receptor that inhibits the release of alpha interferon, EBV has also captured IL-10, which inhibits the release of gamma interferon from PBMC (19, 35). Like alpha interferon, gamma interferon has also been shown to inhibit the outgrowth of EBV-transformed B cells (17). Interestingly, alpha interferon and gamma interferon can inhibit EBV-induced B-cell transformation in a synergistic fashion (22). The somewhat modest inhibition of alpha interferon production by cells containing wild-type versus mutant BARF1 EBV may be amplified by the synergistic action of viral IL-10 in inhibiting gamma interferon. Thus, EBV has pirated two genes from the cellular genome to modulate interferon production during virus infection.


    ACKNOWLEDGMENTS

We thank B. Tomkinson and E. Kieff for EBV cosmids and plasmids, L. Pesnicak for assistance with animal experiments, L. Olsen for help with analysis of tumor tissue, C. Hallahan for assistance with statistics, M. Spriggs for Fc fusion proteins and helpful discussions, and S. Straus for reviewing the manuscript.


    FOOTNOTES

* Corresponding author. Mailing address: Laboratory of Clinical Investigation, Bldg. 10, Rm. 11N214, National Institutes of Health, Bethesda, MD 20892. Phone: (301) 496-5221. Fax: (301) 496-7383. E-mail: jcohen{at}niaid.nih.gov.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Ahn, K., A. Gruhler, B. Galochia, T. R. Jones, E. J. H. J. Wiertz, H. L. Ploegh, P. A. Peterson, Y. Yang, and K. Fruh. 1997. The ER-luminal domain of the HCMV glycoprotein US6 inhibits peptide translocation by TAP. Immunity 6:613-621[Medline].
2. Ahuja, S. K., and P. M. Murphy. 1993. Molecular piracy of mammalian interleukin-8 receptor type B by herpesvirus saimiri. J. Biol. Chem. 268:20691-20694[Abstract/Free Full Text].
3. Arvanitakis, L., E. Geras-Raaka, A. Varma, M. C. Gershengorn, and E. Cesarman. 1997. Human herpesvirus KSHV encodes a constitutively active G-protein-coupled receptor linked to cell proliferation. Nature 385:347-350[Medline].
4. Baer, R., A. T. Bankier, M. D. Biggin, P. L. Deininger, P. J. Farrell, T. J. Gibson, G. Hatfull, G. S. Hudson, S. C. Satchwell, C. Seguin, P. S. Tuffnell, and B. G. Barrell. 1984. DNA sequence and expression of the B95-8 Epstein-Barr virus genome. Nature 310:207-211[Medline].
5. Birkenbach, M., K. Josefsen, R. Yalamanchili, G. Lenoir, and E. Kieff. 1993. Epstein-Barr virus-induced genes: first lymphocyte-specific G protein-coupled peptide receptors. J. Virol. 67:2209-2220[Abstract/Free Full Text].
6. Biron, C. A. 1997. Activation and function of natural killer cell responses during viral infections. Curr. Opin. Immunol. 9:24-34[Medline].
7. Biron, C. A., K. S. Byron, and J. L. Sullivan. 1989. Severe herpesvirus infections in an adolescent without natural killer cells. N. Engl. J. Med. 320:1731-1735[Medline].
8. Cheeseman, S. H., W. Henle, R. H. Rubin, N. E. Tolkoff-Rubin, B. Cosimi, K. Cantell, S. Winkle, J. T. Herrin, P. H. Black, P. S. Russell, and M. S. Hirsch. 1980. Epstein-Barr virus infection in renal transplant recipients: effects of antithymocyte globulin and interferon. Ann. Intern. Med. 93:39-42.
9. Cohen, J. I. 1998. Infection of cells with varicella-zoster virus down-regulates surface expression of class I major histocompatibility complex antigens. J. Infect. Dis. 177:1390-1393[Medline].
10. Cohen, J. I., F. Wang, and E. Kieff. 1991. Epstein-Barr virus nuclear protein 2 mutations define essential domains for transformation and transactivation. J. Virol. 65:2545-2554[Abstract/Free Full Text].
11. Cohen, J. I., G. R. Picchio, and D. E. Mosier. 1992. Epstein-Barr virus nuclear protein 2 is a critical determinant for tumor growth in SCID mice and for transformation in vitro. J. Virol. 66:7555-7559[Abstract/Free Full Text].
12. Cohen, J. I., and K. Lekstrom. Unpublished data.
13. Dambaugh, T., C. Beisel, M. Hummel, W. King, S. Fennewald, A. Cheung, M. Heller, N. Raab-Traub, and E. Kieff. 1980. Epstein-Barr virus (B95-8) DNA VII: molecular cloning and detailed mapping. Proc. Natl. Acad. Sci. USA 77:2999-3003[Abstract/Free Full Text].
14. Gao, J.-L., and P. M. Murphy. 1994. Human cytomegalovirus open reading frame US28 encodes a functional beta chemokine receptor. J. Biol. Chem. 269:28539-28542[Abstract/Free Full Text].
15. Garner, J. G., M. S. Hirsch, and R. T. Schooley. 1984. Prevention of Epstein-Barr virus-induced B-cell outgrowth by interferon alpha. Infect. Immun. 43:920-924[Abstract/Free Full Text].
16. Gilbert, M. J., S. R. Riddell, B. Plachter, and P. D. Greenberg. 1996. Cytomegalovirus selectively blocks antigen processing and presentation of its immediate-early gene product. Nature 383:720-722[Medline].
17. Hasler, F., H. G. Bluestein, N. J. Zvaifler, and L. B. Epstein. 1983. Analysis of the defects responsible for the impaired regulation of Epstein-Barr virus-induced B cell proliferation by rheumatoid arthritis lymphocytes. I. Diminished gamma interferon production in response to autologous stimulation. J. Exp. Med. 157:173-188[Abstract/Free Full Text].
18. Hill, A., P. Jugovic, I. York, G. Russ, J. Bennink, J. Yewdell, H. Ploegh, and D. Johnson. 1995. Herpes simplex virus protein turns off the TAP to evade host immunity. Nature 375:411-415[Medline].
19. Hsu, D.-H., R. deWaal Malefyt, D. F. Fiorentino, M.-N. Dang, P. Vieira, J. deVries, H. Spits, T. R. Mosmann, and K. W. Moore. 1990. Expression of interleukin-10 activity by Epstein-Barr virus protein BCRF1. Science 250:830-832[Abstract/Free Full Text].
20. Joncas, J., Y. Monczak, F. Gibu, C. Alfieri, A. Bonin, G. Ahronheim, and G. Rivard. 1989. Brief report: killer cell defect and persistent immunological abnormalities in two patients with chronic active Epstein-Barr virus infection. J. Med. Virol. 28:110-117[Medline].
21. Levitskaya, J., A. Shapiro, A. Leonchiks, A. Ciechanover, and M. G. Massucci. 1997. Inhibition of ubiquitin/proteosome-dependent protein degradation by the Gly-Ala repeat domain of the Epstein-Barr virus nuclear antigen 1. Proc. Natl. Acad. Sci. USA 94:12616-12621[Abstract/Free Full Text].
22. Lin, J.-C., Z.-X. Zhang, T.-C. Chou, I. Sim, and J. S. Pagano. 1989. Synergistic inhibition of Epstein-Barr virus: transformation of B lymphocytes by alpha and gamma interferon and by 3'-azido-3'-deoxythymidine. J. Infect. Dis. 159:248-254[Medline].
23. Lindahl, P., I. Gresser, P. Leary, and M. Tovey. 1976. Interferon treatment of mice: enhanced expression of histocompatibility antigens on lymphoid cells. Proc. Natl. Acad. Sci. USA 73:1284-1287[Abstract/Free Full Text].
24. Masucci, M. G., M. T. Bejarno, G. Masucci, and E. Klein. 1983. Large granular lymphocytes inhibit the in vitro growth of autologous Epstein-Barr virus-infected cells. Cell. Immunol. 76:311-321[Medline].
25. Moore, P. S., C. Bashoff, R. A. Weiss, and Y. Chang. 1996. Molecular mimicry of human cytokine and cytokine response pathway genes by KSHV. Science 274:1739-1744[Abstract/Free Full Text].
26. Prabhu, A., M. Warwick, and A. Mathur. 1996. Decreased levels of circulating interferon-alpha and increased sCD23 in patients with acute infectious mononucleosis. Viral Immunol. 9:45-50[Medline].
27. Reyburn, H. T., O. Mandelboim, M. Vales-Gomez, D. M. Davis, L. Pazmany, and J. L. Strominger. 1997. The class I MHC homologue of human cytomegalovirus inhibits attack by natural killer cells. Nature 386:514-517[Medline].
28. Rogge, L., L. Barberis-Maino, M. Biffi, N. Passini, D. H. Presky, U. Gubler, and F. Sinigaglia. 1997. Selective expression of an interleukin-12 receptor component by human T helper 1 cells. J. Exp. Med. 185:825-831[Abstract/Free Full Text].
29. Roth, P., and E. R. Stanley. 1992. The biology of CSF-1 and its receptor. Curr. Top. Microbiol. Immunol. 181:141-167[Medline].
30. Russo, J. J., R. A. Bohenzky, M.-C. Chien, J. Chen, M. Yan, D. Maddalena, J. P. Parry, D. Peruzzi, I. S. Edelman, Y. Chang, and P. S. Moore. 1996. Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus. Proc. Natl. Acad. Sci. USA 93:14862-14867[Abstract/Free Full Text].
31. Shapiro, R. S., K. McClain, G. Frizzera, K. J. Gajl-Peczalska, J. H. Kersey, B. R. Blazar, D. C. Arthur, D. F. Patton, J. S. Greenberg, B. Burke, N. K. C. Ramsay, P. McGlavew, and A. H. Filipovich. 1988. Epstein-Barr virus associated B cell lymphoproliferative disorders following bone marrow transplantation. Blood 71:1234-1243[Abstract/Free Full Text].
32. Strockbine, L. D., J. I. Cohen, T. Farrah, S. D. Lyman, F. Wagener, R. F. DuBose, R. I. Armitage, and M. K. Spriggs. 1998. The Epstein-Barr virus BARF1 gene encodes a novel, soluble colony-stimulating factor-1 receptor. J. Virol. 72:4015-4021[Abstract/Free Full Text].
33. Stuart, A. D., J. P. Stewart, J. R. Arrand, and M. Mackett. 1995. The Epstein-Barr virus encoded cytokine viral interleukin-10 enhances transformation of human B lymphocytes. Oncogene 11:1711-1719[Medline].
34. Sullivan, J. L., K. S. Byron, F. E. Brewster, and D. T. Purtillo. 1980. Deficient natural killer cell activity in the X-linked lymphoproliferative syndrome. Science 210:543-544[Abstract/Free Full Text].
35. Swaminathan, S., R. Hesselton, J. Sullivan, and E. Kieff. 1993. Epstein-Barr virus recombinants with specifically mutated BCRF1 genes. J Virol. 67:7406-7413[Abstract/Free Full Text].
36. Tanner, J. E., C. Alfieri, T. A. Chatila, and F. Diaz-Mitoma. 1996. Induction of interleukin-6 after stimulation of human B-cell CD21 by Epstein-Barr virus glycoproteins gp350 and gp220. J. Virol. 70:570-575[Abstract].
37. Tanner, J. E., M. X. Wei, C. Alfieri, A. Ahmad, P. Taylor, T. Ooka, and J. Menezes. 1997. Antibody and antibody-dependent cellular cytotoxicity responses against the BamHI A rightward open-reading frame-1 protein of Epstein-Barr virus (EBV) in EBV-associated disorders. J. Infect. Dis. 175:38-46[Medline].
38. Tomkinson, B., E. Robertson, R. Yalamanchili, R. Longnecker, and E. Kieff. 1993. Epstein-Barr virus recombinants from overlapping cosmid fragments. J. Virol. 67:7298-7306[Abstract/Free Full Text].
39. Tough, D. F., P. Boroow, and J. Sprent. 1996. Induction of bystander T cell proliferation by viruses and type I interferon in vivo. Science 272:1947-1950[Abstract].
40. Warren, M. K., and P. Ralph. 1986. Macrophage growth factor CSF-1 stimulates human monocyte production of interferon, tumor necrosis factor, and colony stimulating activity. J. Immunol. 137:2281-2285[Abstract].
41. Wei, M. X., J.-C. Moulin, G. Decaussin, F. Berger, and T. Ooka. 1994. Expression and tumorigenicity of the Epstein-Barr virus BARF1 gene in human Louckes B-lymphocyte cell line. Cancer Res. 54:1843-1848[Abstract/Free Full Text].
42. Wei, M. X., M. de Turenne-Tessier, G. Decaussin, G. Benet, and T. Ooka. 1997. Establishment of a monkey kidney epithelial cell line with the BARF1 open reading frame from Epstein-Barr virus. Oncogene 14:3073-3081[Medline].
43. Wei, M. X., and T. Ooka. 1989. A transforming function of the BARF1 gene encoded by Epstein-Barr virus. EMBO J. 8:2897-2903[Medline].
44. Yao, Z., W. C. Fanslow, M. F. Seldin, A.-M. Rousseau, S. L. Painter, M. R. Comeau, J. I. Cohen, and M. K. Spriggs. 1995. Herpesvirus saimiri encodes a new cytokine, IL-17, which binds to a novel cytokine receptor. Immunity 3:811-821[Medline].
45. Zhang, C. X., G. Decaussin, J. Daillie, and T. Ooka. 1988. Altered expression of two Epstein-Barr virus early genes localized in BamHI-A in nonproducer Raji cells. J. Virol. 62:1862-1869[Abstract/Free Full Text].


Journal of Virology, September 1999, p. 7627-7632, Vol. 73, No. 9
0022-538X/99/$04.00+0



This article has been cited by other articles:

  • de Turenne-Tessier, M., Ooka, T. (2007). Post-translational modifications of Epstein Barr virus BARF1 oncogene-encoded polypeptide. J. Gen. Virol. 88: 2656-2661 [Abstract] [Full Text]  
  • Houali, K., Wang, X., Shimizu, Y., Djennaoui, D., Nicholls, J., Fiorini, S., Bouguermouh, A., Ooka, T. (2007). A New Diagnostic Marker for Secreted Epstein-Barr Virus Encoded LMP1 and BARF1 Oncoproteins in the Serum and Saliva of Patients with Nasopharyngeal Carcinoma. Clin. Cancer Res. 13: 4993-5000 [Abstract] [Full Text]  
  • Sheng, W., Decaussin, G., Ligout, A., Takada, K., Ooka, T. (2003). Malignant Transformation of Epstein-Barr Virus-Negative Akata Cells by Introduction of the BARF1 Gene Carried by Epstein-Barr Virus. J. Virol. 77: 3859-3865 [Abstract] [Full Text]  
  • Rivailler, P., Cho, Y.-g., Wang, F. (2002). Complete Genomic Sequence of an Epstein-Barr Virus-Related Herpesvirus Naturally Infecting a New World Primate: a Defining Point in the Evolution of Oncogenic Lymphocryptoviruses. J. Virol. 76: 12055-12068 [Abstract] [Full Text]  
  • Jabs, W. J., Wagner, H. J., Maurmann, S., Hennig, H., Kreft, B. (2002). Inhibition of macrophage inflammatory protein-1alpha production by Epstein-Barr virus. Blood 99: 1512-1516 [Abstract] [Full Text]  
  • Tune, C. E., Pilon, M., Saiki, Y., Dosch, H.-M. (2002). Sustained Expression of the Novel EBV-Induced Zinc Finger Gene, ZNFEB, Is Critical for the Transition of B Lymphocyte Activation to Oncogenic Growth Transformation. J. Immunol. 168: 680-688 [Abstract] [Full Text]  
  • Rivailler, P., Jiang, H., Cho, Y.-g., Quink, C., Wang, F. (2002). Complete Nucleotide Sequence of the Rhesus Lymphocryptovirus: Genetic Validation for an Epstein-Barr Virus Animal Model. J. Virol. 76: 421-426 [Abstract] [Full Text]  
  • Cho, Y.-G., Ramer, J., Rivailler, P., Quink, C., Garber, R. L., Beier, D. R., Wang, F. (2001). An Epstein-Barr-related herpesvirus from marmoset lymphomas. Proc. Natl. Acad. Sci. USA 98: 1224-1229 [Abstract] [Full Text]  
  • Decaussin, G., Sbih-Lammali, F., Mireille de Turenne-Tessier, , Bouguermouh, A., Ooka, T. (2000). Expression of BARF1 Gene Encoded by Epstein-Barr Virus in Nasopharyngeal Carcinoma Biopsies. Cancer Res. 60: 5584-5588 [Abstract] [Full Text]  
  • Cohen, J. I. (2000). Epstein-Barr Virus Infection. NEJM 343: 481-492 [Full Text]  
  • Chung, K. M., Lee, J., Kim, J.-E., Song, O.-K., Cho, S., Lim, J., Seedorf, M., Hahm, B., Jang, S. K. (2000). Nonstructural Protein 5A of Hepatitis C Virus Inhibits the Function of Karyopherin beta 3. J. Virol. 74: 5233-5241 [Abstract] [Full Text]  
  • Hausen, A. z., Brink, A. A. T. P., Craanen, M. E., Middeldorp, J. M., Meijer, C. J. L. M., van den Brule, A. J. C. (2000). Unique Transcription Pattern of Epstein-Barr Virus (EBV) in EBV-carrying Gastric Adenocarcinomas: Expression of the Transforming BARF1 Gene. Cancer Res. 60: 2745-2748 [Abstract] [Full Text]  
  • Savard, M., Bélanger, C., Tardif, M., Gourde, P., Flamand, L., Gosselin, J. (2000). Infection of Primary Human Monocytes by Epstein-Barr Virus. J. Virol. 74: 2612-2619 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cohen, J. I.
Right arrow Articles by Lekstrom, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cohen, J. I.
Right arrow Articles by Lekstrom, K.