Previous Article | Next Article 
Journal of Virology, September 1999, p. 7627-7632, Vol. 73, No. 9
0022-538X/99/$04.00+0
Epstein-Barr Virus BARF1 Protein Is Dispensable for
B-Cell Transformation and Inhibits Alpha Interferon Secretion from
Mononuclear Cells
Jeffrey I.
Cohen* and
Kristen
Lekstrom
Medical Virology Section, Laboratory of
Clinical Investigation, National Institute of Allergy and
Infectious Diseases, Bethesda, Maryland 20892
Received 24 March 1999/Accepted 14 June 1999
 |
ABSTRACT |
The Epstein-Barr virus (EBV) BARF1 gene encodes a soluble
colony-stimulating factor 1 (CSF-1) receptor that neutralizes the effects of CSF-1 in vitro. To study the effect of BARF1 on EBV-induced transformation, we added recombinant BARF1 to B cells in the presence of EBV. BARF1 did not enhance transformation of B cells by EBV in
vitro. To study the role of BARF1 in the context of EBV infection, we
constructed a recombinant EBV mutant with a large deletion followed by
stop codons in the BARF1 gene as well as a recombinant virus with a
wild-type BARF1 gene. While BARF1 has previously been shown to act as
an oncogene in several cell lines, the EBV BARF1 deletion mutant
transformed B cells and initiated latent infection, and the B cells
transformed with the BARF1 mutant virus induced tumors in SCID mice
with an efficiency similar to that of the wild-type recombinant virus.
Since human CSF-1 stimulates secretion of alpha interferon from
mononuclear cells and BARF1 encodes a soluble CSF-1 receptor, we
examined whether recombinant BARF1 or BARF1 derived from EBV-infected B
cells could inhibit alpha interferon secretion. Recombinant BARF1
inhibited alpha interferon secretion by mononuclear cells in a
dose-dependent fashion. The B cells transformed with mutant BARF1 EBV
showed reduced inhibition of alpha interferon secretion by human
mononuclear cells when compared with the B cells transformed with
wild-type recombinant virus. These experiments indicate that BARF1
expressed from the EBV genome directly inhibits alpha interferon
secretion, which may modulate the innate host response to the virus.
| |
INTRODUCTION |
Herpesviruses encode several
proteins that modulate the immune system. Herpes simplex virus,
varicella-zoster virus, and cytomegalovirus downregulate surface
expression of class I major histocompatibility complex (MHC) antigens
(1, 9, 18). The cytomegalovirus pp65 protein inhibits
presentation of the immediate-early protein to cytotoxic T cells
(16), and the UL18 protein is an MHC class I homolog that
inhibits natural killer (NK) cell killing of virus-infected cells
(27). The Epstein-Barr virus (EBV) EBNA-1 protein has glycine-alanine repeats that interfere with proteolysis of the protein
by proteosomes (21).
Herpesviruses also encode homologs of cytokines, chemokines, and their
receptors. Kaposi's sarcoma-associated herpesvirus (KSHV) encodes a
homolog of interleukin-6 (IL-6) (25), EBV encodes an IL-10
homolog (19), and herpesvirus saimiri encodes an IL-17 homolog (44). KSHV encodes three chemokines, two homologous to the macrophage inflammatory protein 1-
and one in the CC
chemokine family (30). Human cytomegalovirus, KSHV, and
herpesvirus saimiri encode chemokine receptors (2, 3, 14).
While EBV appears to encode fewer cellular homologs than other gamma
herpesviruses, EBV induces expression of IL-6 (36) and a
chemokine receptor (5).
Recently, we have shown that the EBV BARF1 protein functions as a
soluble receptor for human colony-stimulating factor 1 (CSF-1) (32). Recombinant BARF1 inhibits the ability of CSF-1 to
induce proliferation of bone marrow macrophage progenitor cells. CSF-1 is known to have a number of other activities, including induction of
mononuclear cells to release cytokines, such as alpha interferon, tumor
necrosis factor alpha, granulocyte colony-stimulating factor, and IL-1
(29). Thus, the ability of EBV BARF1 to block CSF-1 activity
might impair cytokine release from mononuclear cells and thereby reduce
the cellular immune response to EBV.
Prior studies showed that BARF1 acts as an oncogene when stably
expressed in mouse fibroblasts, monkey kidney cells, or B-lymphoma cells (41-43). BARF1 induces expression of the
c-myc proto-oncogene and B-cell activation antigens CD21 and
CD23 (41). While BARF1 is classified as an early gene
(45) that is not expressed during latent virus infection
(37), it might have a role in initiating EBV transformation
of B cells.
To better determine the role of BARF1 in EBV infection, we constructed
a mutant virus with a deletion in the BARF1 gene and compared its
activities with those of a recombinant virus with a wild-type BARF1
sequence. The BARF1 mutant virus had a similar activity in initiating
latent infection, transforming B cells, and inducing tumors in SCID
mice as the recombinant virus with wild-type BARF1. However, when
compared with the wild-type virus, the BARF1 mutant virus was impaired
in its ability to inhibit alpha interferon production by mononuclear
cells. Thus, BARF1 may be important for modulation of the innate immune
response to EBV.
| |
MATERIALS AND METHODS |
Cell lines, virus, and cosmid DNA.
The P3HR-1 cell line is
derived from a Burkitt's lymphoma cell line that lacks the EBNA-2
gene. EBV cosmids EcoRI-A and SnaBI-B contain large portions of the
B95-8 genome cloned into cosmid pDVcosA2 (38). The BARF1
gene contains EBV nucleotides 165504 to 166166 (4). To
produce a cosmid with a deletion and stop codons in BARF1, cosmid
EcoRI-Dhet (13) was cut with PmeI and NsiI at EBV nucleotides 165650 and 165953. The large
fragment was blunted with T4 DNA polymerase and an oligonucleotide,
CTAGTTAATTAACTAG, containing stop codons in all three open
reading frames, and a PacI site was inserted (Fig.
1). Since BARF1 is predicted to have a
signal sequence that is cleaved after amino acid 20, the resulting cosmid EcoRI-Dhet-BARF1D is predicted to have stop codons inserted after the first 29 amino acids of the mature protein. The deletion of
the last 172 amino acids of the protein includes the region which is
conserved with the human CSF-1 receptor (32). Plasmid SVNaeIBamZ (10) contains the EBV BZLF1 gene inserted into
expression plasmid pSG5 (Stratagene, La Jolla, Calif.).
View larger version (18K):
[in this window]
[in a new window]
|
FIG. 1.
Construction of EBV with stop codons in BARF1. The EBV
genome consists of 172,282 bp of circular DNA, a portion of which is
shown (line 1). Cosmids SnaBI-B, EcoRI-A, and EcoRI-Dhet were used to
transfect P3HR-1 cells to produce EBV with a wild-type BARF1 gene. The
EcoRI-Dhet cosmid was cut with PmeI and NsiI, and
an oligonucleotide was inserted to construct cosmid EcoRI-Dhet-BARF1D.
The BARF1 gene in this cosmid has a deletion of amino acids (aa) 50 to
150 followed by stop codons.
|
|
Transfections and infections.
To produce recombinant EBV,
P3HR-1 cells were transfected by electroporation (10). A
total of 10 µg of cosmid EcoRI-A, 20 µg of cosmid SnaBI-B, 20 µg
of cosmid EcoRI-Dhet or EcoRI-Dhet-BARF1D, and 30 µg of plasmid
SVNaeIBamZ were used to transfect P3HR-1 cells. Three days after
transfection, virus was harvested and primary human B lymphocytes were
infected as described previously (10). Passage of EBV from
virus-transformed lymphoblastoid cell lines to B cells was performed as
described previously (35). Briefly, cells were treated with
phorbol myristate acetate (PMA) to induce EBV replication, lethally
irradiated with 90 Gy, and incubated with B cells in 96-well plates;
the number of wells containing transformed cells was counted.
Transformation assays with BARF1.
BARF1.Fc is a fusion
protein containing the BARF1 gene fused to the Fc portion of human
immunoglobulin G1 (32). To assay for enhancement of
EBV-induced B-cell transformation by BARF1, serial dilutions of the EBV
Akata strain were added to BARF1.Fc, control Fc protein (vaccinia virus
p7.5.Fc), or media, and 2 × 106 human peripheral
blood mononuclear cells (PBMC) were added and plated into eight wells
of a microtiter plate. The medium was changed weekly, and the number of
wells containing transformants was counted at 6 weeks.
PCR and reverse transcriptase PCR.
PCR was performed with
total cellular DNA obtained from lymphoblastoid cells. Oligonucleotides
CACCGCTTTCTTGGGTGAGC and CCCTCGGGCATGAGCCACTG, corresponding to EBV nucleotides 165566 to 165585 and 165991 to 165972, respectively, were used in the PCR.
For reverse transcriptase PCR, RNA was isolated from lymphoblastoid
cells and treated with RNase-free DNase I, and cDNA was
produced by
using oligo-dT and Moloney murine leukemia virus reverse
transcriptase
and was amplified by PCR as described
above.
SCID mice assays.
SCID mice (CB17/IcrHsd-scid)
were screened to identify those that do not produce murine
immunoglobulin and therefore have no residual B-cell function. Mice
were injected intraperitoneally with 4 × 106
EBV-transformed cells containing wild-type or mutant BARF1 genomes. Animals were monitored for the development of tumors and sacrificed when moribund or at 105 days. Histopathologic analysis of liver, spleen, and tumor tissues was performed. The distributions of the
animals surviving were compared by the Wilcoxon 2 sample test. Also,
Kaplan-Meier survival curves were compared by the log-rank test.
P values were adjusted for multiple comparisons by the
Bonferroni method.
Alpha interferon assays.
Adherent human mononuclear cells
were obtained by incubating 2.5 × 106 PBMC into each
well of a 24-well plate for 2 h and removing the nonadherent cells
by washing them twice with serum-free media. Recombinant human CSF-1
(10 ng/ml; R & D Systems, Minneapolis, Minn.) and BARF1.Fc (0.01 to 5 µg/ml), vaccinia virus p7.5.Fc (0.01 to 5 µg/ml), or medium was
added. After 3 days, the medium was removed, the cells were washed with
phosphate-buffered saline, and poly(I · C) (Sigma, Chicago,
Ill.) was added to 50 µg/ml, and 2 days later the supernatant was
assayed for alpha interferon by enzyme-linked immunosorbent assay
(ELISA) (Biosource International, Camarillo, Calif.).
To assay the effect of BARF1 secreted from EBV-infected B cells on
alpha interferon production, lymphoblastoid cells containing
wild-type
or mutant BARF1 EBV genomes were treated with 20 ng
of PMA per ml to
induce EBV replication. Three days later, the
cells were irradiated
with 90 Gy and washed twice in medium, and
4 × 10
4
cells were added to adherent human PBMC in 1 ml of a 24-well
plate with
human CSF-1 (10 ng/ml). Three days later, the cells
were washed and
poly(I · C) was added, and after 2 days, the supernatants
were
assayed for alpha interferon as described
above.
| |
RESULTS |
Recombinant BARF1.Fc does not enhance EBV transformation of human B
cells in vitro.
To determine whether BARF1 could enhance
transformation of B cells by EBV, serial dilutions of virus were
incubated with BARF1.Fc (1.5 µg/ml), control Fc protein, or medium.
PBMC were then added, and wells containing transformants were counted.
BARF1.Fc did not enhance transformation (Table
1). To further confirm that BARF1 does
not enhance transformation, the amount of EBV was kept constant,
different dilutions of BARF1.Fc (4 to 50 µg/ml), control Fc protein,
or medium were added to PBMC, and the number of wells containing
transformants was assayed. BARF1.Fc and the control Fc protein had no
effect on EBV transformation (12).
Construction of recombinant EBV that is unable to express
BARF1.
P3HR-1 cells contain an EBV genome with a deletion in the
EBNA-2 gene that can replicate viral DNA but cannot transform B cells.
Transfection of P3HR-1 cells with DNA containing the EBNA-2 gene
results in production of transformation-competent recombinant EBV in
which the EBNA-2 gene has been restored by homologous recombination (10). If P3HR-1 cells are transfected with the EBNA-2 gene
and a second DNA containing a mutated EBV gene, homologous
recombination can occur, resulting in an EBV genome with a full-length
EBNA-2 gene and a mutation at the second site (35).
To produce recombinant EBV that is unable to express BARF1, cosmid
EcoRI-Dhet-BARF1D was constructed that contains the EBV
BARF1 gene with
a large deletion followed by stop codons. P3HR-1
cells were transfected
with EBV cosmids EcoRI-Dhet-BARF1D, EcoRI-A
(which contains EBNA-2),
and SnaBI-B (Fig.
1). Cosmid SnaBI-B
spans the gap between EBNA-2 and
the BARF1 mutation, thereby increasing
the likelihood that recombinants
will have both a restored EBNA-2
gene and a mutation in BARF1. Primary
B cells were infected with
virus obtained from the transfected cells,
and transformants were
screened by PCR for the BARF1 deletion. All
transformants contained
either the wild-type BARF1 gene or both the
wild-type and mutant
BARF1 genes. These cell lines were probably due to
coinfection
with P3HR-1 virus, which contains wild-type BARF1, and
recombinant
P3HR-1 with mutant
BARF1.
To isolate cell lines with only EBV genomes from which BARF1 was
deleted, cells coinfected with wild-type BARF1 EBV and mutant
BARF1 EBV
were induced to undergo lytic replication, and the resultant
virus was
used to transform primary B cells. Analysis of the mutants
by PCR
showed that a number of the cell lines contained EBV genomes
with only
mutant BARF1. Cells containing only wild-type BARF1
were also induced
in parallel to obtain cell lines from the same
donors that contain only
wild-type BARF1. Southern blotting of
DNA with a
SmaI
fragment containing the BARF1 gene confirmed that
several cell lines
contained EBV genomes with only mutant BARF1
(Fig.
2).
View larger version (44K):
[in this window]
[in a new window]
|
FIG. 2.
Southern blot of recombinant EBV with deletion in BARF1.
Lymphoblastoid cell lines containing EBV with only the mutant BARF1
gene (lanes 1 to 6 and 8) or wild-type BARF1 gene (lane 7) and P3HR-1
cells that contain wild-type BARF1 (lane 9) are shown. The deletion in
the BARF1 gene removes 0.3 kb of DNA. Markers indicate DNA sizes in
kilobases.
|
|
Expression of BARF1 RNA in cells infected with recombinant EBV
containing wild-type or mutant BARF1.
While BARF1 has been
detected in cell lines that are highly permissive for viral replication
(32, 37), the protein has not been detected in
lymphoblastoid cell lines after induction of lytic replication
(12, 37). To verify that BARF1 RNA is expressed in
lymphoblastoid cells infected with recombinant EBV, viral replication
was induced in cells containing wild-type or mutant BARF1, total RNA
was isolated, cDNA was made, and a portion of the BARF1 gene was
amplified by PCR. Cells containing wild-type BARF1 had a 426-bp band,
while cells with mutant BARF1 had a 107-bp band, due to the deletion in
BARF1 (Fig. 3A). No PCR product was detected in the absence of reverse transcriptase, indicating that the
PCR product was from cDNA and not viral DNA contaminating the RNA (Fig.
3B).
View larger version (41K):
[in this window]
[in a new window]
|
FIG. 3.
PCR amplification of cDNA obtained from BARF1 RNA from
cell lines containing recombinant EBV with wild-type or mutant BARF1
genomes. (A) PCR amplification of cDNA obtained from RNA isolated from
EBV-transformed cells containing wild-type (lanes 1 to 4) or mutant
BARF1 (lanes 5 to 8). Cell lines are designated at the top of each
lane. PCR amplification of DNA from a cosmid containing wild-type BARF1
(lane 9) or the BARF1 deletion mutant (lane 10) serves as a control.
(B) Selected RNAs used in panel A were left untreated ( ) or were
treated (+) with reverse transcriptase (RT) before PCR to verify that
the DNase I digestion was adequate. PCR amplification of DNA from
wild-type or deleted BARF1 genes are shown. Markers indicate DNA sizes
in kilobases.
|
|
EBV that is unable to express BARF1 is not impaired for B-cell
transformation or initiation of lytic infection in vitro.
To
determine whether BARF1 has a role in initiating lytic infection, cell
lines containing only wild-type or mutant BARF1 EBV genomes were
induced to undergo lytic replication, and protein lysates from induced
cells were analyzed on Western blots with human serum that recognizes
EBV lytic genes. While the levels of lytic proteins varied between cell
lines, there was no consistent difference in the level of EBV lytic
proteins in cells containing wild-type and mutant BARF1 EBV genomes
(Fig. 4).
View larger version (46K):
[in this window]
[in a new window]
|
FIG. 4.
Lytic replication by lymphoblastoid cells containing
recombinant EBV with either mutant (A) or wild-type (B) BARF1. Protein
lysates from cells induced to undergo lytic replication were analyzed
by Western blot analysis with human serum that recognizes early
replicative antigens. Markers indicate protein sizes in kilodaltons.
|
|
BARF1 has previously been shown to have oncogenic activity in
B-lymphoma cells (
41). To determine whether BARF1 might have
a direct role in B-cell transformation, cells containing only
mutant or
wild-type BARF1 EBV genomes that expressed comparable
levels of lytic
viral proteins were induced to undergo lytic replication
and were
lethally irradiated, and the resultant viruses were used
to transform
human B cells. Similar numbers of transformants were
obtained from
cells containing either wild-type or mutant BARF1
EBV genomes (Table
2) (Wilcoxon rank sum score,
P = 0.25).
Cells transformed with EBV that are unable to express BARF1 are not
impaired for induction of B-cell tumors in SCID mice.
Inoculation
of SCID mice with EBV-transformed B cells results in EBV-containing
lymphomas, and certain EBV mutants show different transforming
phenotypes in vivo (11). To determine whether BARF1 has a
role in transformation in vivo, SCID mice were inoculated intraperitoneally with EBV-transformed B cells containing either wild-type or mutant BARF1 genes. Four different cell lines containing each virus were used, and at least four mice were inoculated with each
cell line. Animals were sacrificed when moribund or at 105 days. The
experiment was done twice, with similar results, and the data were
pooled (Fig. 5). There was no significant
difference in survival of animals receiving cells containing wild-type
or mutant BARF1 EBV (P > 0.5). The median time to
death in animals receiving wild-type BARF1 recombinant virus (58 days,
confidence interval 53 to 76) was similar to that in animals receiving
BARF1 mutant virus (58 days, confidence interval 54 to 69). High-grade lymphoblastic lymphomas were present in the lymph nodes, liver, spleen,
and abdominal wall, with spread to the skin, pancreas, stomach, and
large and small intestines in animals receiving cells containing either
wild-type or mutant BARF EBV.
View larger version (11K):
[in this window]
[in a new window]
|
FIG. 5.
Kaplan-Meier survival curve for SCID mice receiving
transformed B cells containing wild-type or mutant BARF1. The
experiment was performed twice, and the pooled data are shown.
|
|
Inhibition of alpha interferon secretion from human mononuclear
cells by BARF1.
BARF1 was previously shown to encode a soluble
CSF-1 receptor. Since CSF-1 induces alpha interferon production by
mononuclear cells (40), BARF1 might block the ability of
CSF-1 to induce alpha interferon. Prior experiments by ourselves and
others (12, 40) showed that addition of poly(I · C)
and CSF-1 to monocytes was required for alpha interferon secretion.
Recombinant human CSF-1 and BARF1.Fc or a control Fc protein was added
to human mononuclear cells, followed by poly(I · C), and the
supernatants were assayed for alpha interferon. BARF1.Fc inhibited
alpha interferon secretion by mononuclear cells with a dose-dependent
response, while control Fc protein had little effect on alpha
interferon (Fig. 6A).
View larger version (13K):
[in this window]
[in a new window]
|
FIG. 6.
BARF1 inhibits secretion of alpha interferon. (A)
Secretion of alpha interferon from human mononuclear cells in the
presence of recombinant BARF1.Fc or control Fc fusion protein. (B)
Secretion of alpha interferon from human mononuclear cells in the
presence of BARF1 expressed by EBV-transformed B cells. Lymphoblastoid
cell lines transformed with EBV containing wild-type (BARF1 +) or
mutant (BARF1 ) BARF1 were induced to lytic replication, irradiated,
and incubated with mononuclear cells, and alpha interferon was assayed.
Each point represents a different lymphoblastoid cell line.
|
|
To determine whether EBV-produced BARF1 has an effect similar to that
of BARF1.Fc on the inhibition of alpha interferon production
by
mononuclear cells, cell lines were selected from different
donors that
were transformed with recombinant wild-type or mutant
BARF1 EBV that
showed similar levels of lytic protein expression.
The cells were
induced for lytic replication, irradiated, and
added to mononuclear
cells with CSF-1. Poly(I · C) was added and
alpha
interferon was measured in the supernatants. Cells containing
wild-type
BARF1 EBV genomes inhibited alpha interferon secretion
by mononuclear
cells to a greater extent than cells containing
mutant BARF1 (Fig.
6B),
although there was overlap between the
two groups. When the results of
assays performed in 16 separate
experiments with different donors were
analyzed together, the
median level of alpha interferon produced in
monocytes after exposure
to cells containing wild-type BARF1 EBV
genomes (77 pg/ml) was
about one-half that (166 pg/ml) after exposure
to cells containing
mutant BARF1. The difference in alpha interferon
levels between
the cell groups was highly significant (Wilcoxon 2 sample test,
P = 0.004).
| |
DISCUSSION |
We have shown that both recombinant BARF1 and EBV-produced BARF1
inhibit alpha interferon production by human monocytes. The levels of
alpha interferon secreted from these cells (50 to 100 pg/ml) are
similar to the levels of alpha interferon that have been shown to
inhibit the outgrowth of EBV-transformed B cells (15).
Therefore, BARF1 may play an important role in modulating the innate
host response to promote survival of virus-infected cells in vivo.
BARF1 could protect virus-infected cells by inhibiting innate host
responses when it is expressed in the lytic cycle during acute EBV
infection of epithelial cells or during virus reactivation in B cells.
Alpha interferon is one of the first cytokines produced in response to
virus infection. Alpha interferon activates NK cell cytotoxicity and
lysis of virus-infected cells and is necessary for both NK cell
blastogenesis and cytotoxicity during murine cytomegalovirus infection
(6). While cytotoxic T cells are critical for controlling
persistent EBV infection, NK cells are important during the initial
stages of EBV infection. Increased numbers of NK cells are present
within weeks after primary infection with EBV (24). Impaired
NK cell cytotoxic activity has been associated with severe human
herpesvirus infections (7), including EBV infections
(20, 34).
Alpha interferon has been shown to have a role during EBV infection in
vivo. Alpha interferon decreases EBV shedding in immunosuppressed patients (8), and the cytokine has been used successfully to treat some cases of EBV-associated lymphoproliferative disease (31). Circulating alpha interferon levels are decreased
during acute infectious mononucleosis (26) at a time of
active EBV replication when BARF1 should be expressed. Alpha interferon
has a number of other activities that can enhance the cellular arm of
the immune system, including upregulation of the expression of the
IL-12 receptor to induce TH1 development (28), induction of
the expression of MHC class I molecules (23), and
enhancement in the generation and maintenance of memory T cells
(39). Thus, inhibition of alpha interferon production by EBV
may allow virus-infected cells to avoid destruction by the immune system.
While BARF1 has been shown to act as an oncogene in stably transfected
B-lymphoma cells (41), EBV that is unable to express BARF1
was not impaired for B-cell transformation. In addition, we did not
detect a difference in induction of B-cell tumors in mice with
wild-type BARF1 and mutant BARF1 recombinant EBV. In stably transfected
B-lymphoma cells, BARF1 protein could be detected directly by
immunofluorescence and BARF1 RNA could be detected by Northern blot
analysis (41); however, in EBV-transformed B cells, BARF1
RNA was detected only by reverse transcriptase PCR after induction of
lytic replication of the cells and the gene was not expressed during
latent infection. Thus, BARF1 apparently does not have a role in B-cell
transformation when expressed at the levels obtained during EBV
infection of primary B cells. While recombinant BARF1 did not stimulate
virus-induced B-cell transformation, EBV contains another gene, viral
IL-10, which has been shown to enhance EBV transformation of B cells
directly (33).
In addition to capturing a CSF-1 receptor that inhibits the release of
alpha interferon, EBV has also captured IL-10, which inhibits the
release of gamma interferon from PBMC (19, 35). Like alpha
interferon, gamma interferon has also been shown to inhibit the
outgrowth of EBV-transformed B cells (17). Interestingly, alpha interferon and gamma interferon can inhibit EBV-induced B-cell
transformation in a synergistic fashion (22). The somewhat modest inhibition of alpha interferon production by cells containing wild-type versus mutant BARF1 EBV may be amplified by the synergistic action of viral IL-10 in inhibiting gamma interferon. Thus, EBV has
pirated two genes from the cellular genome to modulate interferon production during virus infection.
| |
ACKNOWLEDGMENTS |
We thank B. Tomkinson and E. Kieff for EBV cosmids and plasmids,
L. Pesnicak for assistance with animal experiments, L. Olsen for help
with analysis of tumor tissue, C. Hallahan for assistance with
statistics, M. Spriggs for Fc fusion proteins and helpful discussions,
and S. Straus for reviewing the manuscript.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratory of
Clinical Investigation, Bldg. 10, Rm. 11N214, National Institutes of Health, Bethesda, MD 20892. Phone: (301) 496-5221. Fax: (301) 496-7383. E-mail: jcohen{at}niaid.nih.gov.
| |
REFERENCES |
| 1.
|
Ahn, K.,
A. Gruhler,
B. Galochia,
T. R. Jones,
E. J. H. J. Wiertz,
H. L. Ploegh,
P. A. Peterson,
Y. Yang, and K. Fruh.
1997.
The ER-luminal domain of the HCMV glycoprotein US6 inhibits peptide translocation by TAP.
Immunity
6:613-621[Medline].
|
| 2.
|
Ahuja, S. K., and P. M. Murphy.
1993.
Molecular piracy of mammalian interleukin-8 receptor type B by herpesvirus saimiri.
J. Biol. Chem.
268:20691-20694[Abstract/Free Full Text].
|
| 3.
|
Arvanitakis, L.,
E. Geras-Raaka,
A. Varma,
M. C. Gershengorn, and E. Cesarman.
1997.
Human herpesvirus KSHV encodes a constitutively active G-protein-coupled receptor linked to cell proliferation.
Nature
385:347-350[Medline].
|
| 4.
|
Baer, R.,
A. T. Bankier,
M. D. Biggin,
P. L. Deininger,
P. J. Farrell,
T. J. Gibson,
G. Hatfull,
G. S. Hudson,
S. C. Satchwell,
C. Seguin,
P. S. Tuffnell, and B. G. Barrell.
1984.
DNA sequence and expression of the B95-8 Epstein-Barr virus genome.
Nature
310:207-211[Medline].
|
| 5.
|
Birkenbach, M.,
K. Josefsen,
R. Yalamanchili,
G. Lenoir, and E. Kieff.
1993.
Epstein-Barr virus-induced genes: first lymphocyte-specific G protein-coupled peptide receptors.
J. Virol.
67:2209-2220[Abstract/Free Full Text].
|
| 6.
|
Biron, C. A.
1997.
Activation and function of natural killer cell responses during viral infections.
Curr. Opin. Immunol.
9:24-34[Medline].
|
| 7.
|
Biron, C. A.,
K. S. Byron, and J. L. Sullivan.
1989.
Severe herpesvirus infections in an adolescent without natural killer cells.
N. Engl. J. Med.
320:1731-1735[Medline].
|
| 8.
|
Cheeseman, S. H.,
W. Henle,
R. H. Rubin,
N. E. Tolkoff-Rubin,
B. Cosimi,
K. Cantell,
S. Winkle,
J. T. Herrin,
P. H. Black,
P. S. Russell, and M. S. Hirsch.
1980.
Epstein-Barr virus infection in renal transplant recipients: effects of antithymocyte globulin and interferon.
Ann. Intern. Med.
93:39-42.
|
| 9.
|
Cohen, J. I.
1998.
Infection of cells with varicella-zoster virus down-regulates surface expression of class I major histocompatibility complex antigens.
J. Infect. Dis.
177:1390-1393[Medline].
|
| 10.
|
Cohen, J. I.,
F. Wang, and E. Kieff.
1991.
Epstein-Barr virus nuclear protein 2 mutations define essential domains for transformation and transactivation.
J. Virol.
65:2545-2554[Abstract/Free Full Text].
|
| 11.
|
Cohen, J. I.,
G. R. Picchio, and D. E. Mosier.
1992.
Epstein-Barr virus nuclear protein 2 is a critical determinant for tumor growth in SCID mice and for transformation in vitro.
J. Virol.
66:7555-7559[Abstract/Free Full Text].
|
| 12.
| Cohen, J. I., and K. Lekstrom. Unpublished
data.
|
| 13.
|
Dambaugh, T.,
C. Beisel,
M. Hummel,
W. King,
S. Fennewald,
A. Cheung,
M. Heller,
N. Raab-Traub, and E. Kieff.
1980.
Epstein-Barr virus (B95-8) DNA VII: molecular cloning and detailed mapping.
Proc. Natl. Acad. Sci. USA
77:2999-3003[Abstract/Free Full Text].
|
| 14.
|
Gao, J.-L., and P. M. Murphy.
1994.
Human cytomegalovirus open reading frame US28 encodes a functional beta chemokine receptor.
J. Biol. Chem.
269:28539-28542[Abstract/Free Full Text].
|
| 15.
|
Garner, J. G.,
M. S. Hirsch, and R. T. Schooley.
1984.
Prevention of Epstein-Barr virus-induced B-cell outgrowth by interferon alpha.
Infect. Immun.
43:920-924[Abstract/Free Full Text].
|
| 16.
|
Gilbert, M. J.,
S. R. Riddell,
B. Plachter, and P. D. Greenberg.
1996.
Cytomegalovirus selectively blocks antigen processing and presentation of its immediate-early gene product.
Nature
383:720-722[Medline].
|
| 17.
|
Hasler, F.,
H. G. Bluestein,
N. J. Zvaifler, and L. B. Epstein.
1983.
Analysis of the defects responsible for the impaired regulation of Epstein-Barr virus-induced B cell proliferation by rheumatoid arthritis lymphocytes. I. Diminished gamma interferon production in response to autologous stimulation.
J. Exp. Med.
157:173-188[Abstract/Free Full Text].
|
| 18.
|
Hill, A.,
P. Jugovic,
I. York,
G. Russ,
J. Bennink,
J. Yewdell,
H. Ploegh, and D. Johnson.
1995.
Herpes simplex virus protein turns off the TAP to evade host immunity.
Nature
375:411-415[Medline].
|
| 19.
|
Hsu, D.-H.,
R. deWaal Malefyt,
D. F. Fiorentino,
M.-N. Dang,
P. Vieira,
J. deVries,
H. Spits,
T. R. Mosmann, and K. W. Moore.
1990.
Expression of interleukin-10 activity by Epstein-Barr virus protein BCRF1.
Science
250:830-832[Abstract/Free Full Text].
|
| 20.
|
Joncas, J.,
Y. Monczak,
F. Gibu,
C. Alfieri,
A. Bonin,
G. Ahronheim, and G. Rivard.
1989.
Brief report: killer cell defect and persistent immunological abnormalities in two patients with chronic active Epstein-Barr virus infection.
J. Med. Virol.
28:110-117[Medline].
|
| 21.
|
Levitskaya, J.,
A. Shapiro,
A. Leonchiks,
A. Ciechanover, and M. G. Massucci.
1997.
Inhibition of ubiquitin/proteosome-dependent protein degradation by the Gly-Ala repeat domain of the Epstein-Barr virus nuclear antigen 1.
Proc. Natl. Acad. Sci. USA
94:12616-12621[Abstract/Free Full Text].
|
| 22.
|
Lin, J.-C.,
Z.-X. Zhang,
T.-C. Chou,
I. Sim, and J. S. Pagano.
1989.
Synergistic inhibition of Epstein-Barr virus: transformation of B lymphocytes by alpha and gamma interferon and by 3'-azido-3'-deoxythymidine.
J. Infect. Dis.
159:248-254[Medline].
|
| 23.
|
Lindahl, P.,
I. Gresser,
P. Leary, and M. Tovey.
1976.
Interferon treatment of mice: enhanced expression of histocompatibility antigens on lymphoid cells.
Proc. Natl. Acad. Sci. USA
73:1284-1287[Abstract/Free Full Text].
|
| 24.
|
Masucci, M. G.,
M. T. Bejarno,
G. Masucci, and E. Klein.
1983.
Large granular lymphocytes inhibit the in vitro growth of autologous Epstein-Barr virus-infected cells.
Cell. Immunol.
76:311-321[Medline].
|
| 25.
|
Moore, P. S.,
C. Bashoff,
R. A. Weiss, and Y. Chang.
1996.
Molecular mimicry of human cytokine and cytokine response pathway genes by KSHV.
Science
274:1739-1744[Abstract/Free Full Text].
|
| 26.
|
Prabhu, A.,
M. Warwick, and A. Mathur.
1996.
Decreased levels of circulating interferon-alpha and increased sCD23 in patients with acute infectious mononucleosis.
Viral Immunol.
9:45-50[Medline].
|
| 27.
|
Reyburn, H. T.,
O. Mandelboim,
M. Vales-Gomez,
D. M. Davis,
L. Pazmany, and J. L. Strominger.
1997.
The class I MHC homologue of human cytomegalovirus inhibits attack by natural killer cells.
Nature
386:514-517[Medline].
|
| 28.
|
Rogge, L.,
L. Barberis-Maino,
M. Biffi,
N. Passini,
D. H. Presky,
U. Gubler, and F. Sinigaglia.
1997.
Selective expression of an interleukin-12 receptor component by human T helper 1 cells.
J. Exp. Med.
185:825-831[Abstract/Free Full Text].
|
| 29.
|
Roth, P., and E. R. Stanley.
1992.
The biology of CSF-1 and its receptor.
Curr. Top. Microbiol. Immunol.
181:141-167[Medline].
|
| 30.
|
Russo, J. J.,
R. A. Bohenzky,
M.-C. Chien,
J. Chen,
M. Yan,
D. Maddalena,
J. P. Parry,
D. Peruzzi,
I. S. Edelman,
Y. Chang, and P. S. Moore.
1996.
Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus.
Proc. Natl. Acad. Sci. USA
93:14862-14867[Abstract/Free Full Text].
|
| 31.
|
Shapiro, R. S.,
K. McClain,
G. Frizzera,
K. J. Gajl-Peczalska,
J. H. Kersey,
B. R. Blazar,
D. C. Arthur,
D. F. Patton,
J. S. Greenberg,
B. Burke,
N. K. C. Ramsay,
P. McGlavew, and A. H. Filipovich.
1988.
Epstein-Barr virus associated B cell lymphoproliferative disorders following bone marrow transplantation.
Blood
71:1234-1243[Abstract/Free Full Text].
|
| 32.
|
Strockbine, L. D.,
J. I. Cohen,
T. Farrah,
S. D. Lyman,
F. Wagener,
R. F. DuBose,
R. I. Armitage, and M. K. Spriggs.
1998.
The Epstein-Barr virus BARF1 gene encodes a novel, soluble colony-stimulating factor-1 receptor.
J. Virol.
72:4015-4021[Abstract/Free Full Text].
|
| 33.
|
Stuart, A. D.,
J. P. Stewart,
J. R. Arrand, and M. Mackett.
1995.
The Epstein-Barr virus encoded cytokine viral interleukin-10 enhances transformation of human B lymphocytes.
Oncogene
11:1711-1719[Medline].
|
| 34.
|
Sullivan, J. L.,
K. S. Byron,
F. E. Brewster, and D. T. Purtillo.
1980.
Deficient natural killer cell activity in the X-linked lymphoproliferative syndrome.
Science
210:543-544[Abstract/Free Full Text].
|
| 35.
|
Swaminathan, S.,
R. Hesselton,
J. Sullivan, and E. Kieff.
1993.
Epstein-Barr virus recombinants with specifically mutated BCRF1 genes.
J Virol.
67:7406-7413[Abstract/Free Full Text].
|
| 36.
|
Tanner, J. E.,
C. Alfieri,
T. A. Chatila, and F. Diaz-Mitoma.
1996.
Induction of interleukin-6 after stimulation of human B-cell CD21 by Epstein-Barr virus glycoproteins gp350 and gp220.
J. Virol.
70:570-575[Abstract].
|
| 37.
|
Tanner, J. E.,
M. X. Wei,
C. Alfieri,
A. Ahmad,
P. Taylor,
T. Ooka, and J. Menezes.
1997.
Antibody and antibody-dependent cellular cytotoxicity responses against the BamHI A rightward open-reading frame-1 protein of Epstein-Barr virus (EBV) in EBV-associated disorders.
J. Infect. Dis.
175:38-46[Medline].
|
| 38.
|
Tomkinson, B.,
E. Robertson,
R. Yalamanchili,
R. Longnecker, and E. Kieff.
1993.
Epstein-Barr virus recombinants from overlapping cosmid fragments.
J. Virol.
67:7298-7306[Abstract/Free Full Text].
|
| 39.
|
Tough, D. F.,
P. Boroow, and J. Sprent.
1996.
Induction of bystander T cell proliferation by viruses and type I interferon in vivo.
Science
272:1947-1950[Abstract].
|
| 40.
|
Warren, M. K., and P. Ralph.
1986.
Macrophage growth factor CSF-1 stimulates human monocyte production of interferon, tumor necrosis factor, and colony stimulating activity.
J. Immunol.
137:2281-2285[Abstract].
|
| 41.
|
Wei, M. X.,
J.-C. Moulin,
G. Decaussin,
F. Berger, and T. Ooka.
1994.
Expression and tumorigenicity of the Epstein-Barr virus BARF1 gene in human Louckes B-lymphocyte cell line.
Cancer Res.
54:1843-1848[Abstract/Free Full Text].
|
| 42.
|
Wei, M. X.,
M. de Turenne-Tessier,
G. Decaussin,
G. Benet, and T. Ooka.
1997.
Establishment of a monkey kidney epithelial cell line with the BARF1 open reading frame from Epstein-Barr virus.
Oncogene
14:3073-3081[Medline].
|
| 43.
|
Wei, M. X., and T. Ooka.
1989.
A transforming function of the BARF1 gene encoded by Epstein-Barr virus.
EMBO J.
8:2897-2903[Medline].
|
| 44.
|
Yao, Z.,
W. C. Fanslow,
M. F. Seldin,
A.-M. Rousseau,
S. L. Painter,
M. R. Comeau,
J. I. Cohen, and M. K. Spriggs.
1995.
Herpesvirus saimiri encodes a new cytokine, IL-17, which binds to a novel cytokine receptor.
Immunity
3:811-821[Medline].
|
| 45.
|
Zhang, C. X.,
G. Decaussin,
J. Daillie, and T. Ooka.
1988.
Altered expression of two Epstein-Barr virus early genes localized in BamHI-A in nonproducer Raji cells.
J. Virol.
62:1862-1869[Abstract/Free Full Text].
|
Journal of Virology, September 1999, p. 7627-7632, Vol. 73, No. 9
0022-538X/99/$04.00+0
This article has been cited by other articles:
-
de Turenne-Tessier, M., Ooka, T.
(2007). Post-translational modifications of Epstein Barr virus BARF1 oncogene-encoded polypeptide. J. Gen. Virol.
88: 2656-2661
[Abstract]
[Full Text]
-
Houali, K., Wang, X., Shimizu, Y., Djennaoui, D., Nicholls, J., Fiorini, S., Bouguermouh, A., Ooka, T.
(2007). A New Diagnostic Marker for Secreted Epstein-Barr Virus Encoded LMP1 and BARF1 Oncoproteins in the Serum and Saliva of Patients with Nasopharyngeal Carcinoma. Clin. Cancer Res.
13: 4993-5000
[Abstract]
[Full Text]
-
Sheng, W., Decaussin, G., Ligout, A., Takada, K., Ooka, T.
(2003). Malignant Transformation of Epstein-Barr Virus-Negative Akata Cells by Introduction of the BARF1 Gene Carried by Epstein-Barr Virus. J. Virol.
77: 3859-3865
[Abstract]
[Full Text]
-
Rivailler, P., Cho, Y.-g., Wang, F.
(2002). Complete Genomic Sequence of an Epstein-Barr Virus-Related Herpesvirus Naturally Infecting a New World Primate: a Defining Point in the Evolution of Oncogenic Lymphocryptoviruses. J. Virol.
76: 12055-12068
[Abstract]
[Full Text]
-
Jabs, W. J., Wagner, H. J., Maurmann, S., Hennig, H., Kreft, B.
(2002). Inhibition of macrophage inflammatory protein-1alpha production by Epstein-Barr virus. Blood
99: 1512-1516
[Abstract]
[Full Text]
-
Tune, C. E., Pilon, M., Saiki, Y., Dosch, H.-M.
(2002). Sustained Expression of the Novel EBV-Induced Zinc Finger Gene, ZNFEB, Is Critical for the Transition of B Lymphocyte Activation to Oncogenic Growth Transformation. J. Immunol.
168: 680-688
[Abstract]
[Full Text]
-
Rivailler, P., Jiang, H., Cho, Y.-g., Quink, C., Wang, F.
(2002). Complete Nucleotide Sequence of the Rhesus Lymphocryptovirus: Genetic Validation for an Epstein-Barr Virus Animal Model. J. Virol.
76: 421-426
[Abstract]
[Full Text]
-
Cho, Y.-G., Ramer, J., Rivailler, P., Quink, C., Garber, R. L., Beier, D. R., Wang, F.
(2001). An Epstein-Barr-related herpesvirus from marmoset lymphomas. Proc. Natl. Acad. Sci. USA
98: 1224-1229
[Abstract]
[Full Text]
-
Decaussin, G., Sbih-Lammali, F., Mireille de Turenne-Tessier, , Bouguermouh, A., Ooka, T.
(2000). Expression of BARF1 Gene Encoded by Epstein-Barr Virus in Nasopharyngeal Carcinoma Biopsies. Cancer Res.
60: 5584-5588
[Abstract]
[Full Text]
-
Cohen, J. I.
(2000). Epstein-Barr Virus Infection. NEJM
343: 481-492
[Full Text]
-
Chung, K. M., Lee, J., Kim, J.-E., Song, O.-K., Cho, S., Lim, J., Seedorf, M., Hahm, B., Jang, S. K.
(2000). Nonstructural Protein 5A of Hepatitis C Virus Inhibits the Function of Karyopherin beta 3. J. Virol.
74: 5233-5241
[Abstract]
[Full Text]
-
Hausen, A. z., Brink, A. A. T. P., Craanen, M. E., Middeldorp, J. M., Meijer, C. J. L. M., van den Brule, A. J. C.
(2000). Unique Transcription Pattern of Epstein-Barr Virus (EBV) in EBV-carrying Gastric Adenocarcinomas: Expression of the Transforming BARF1 Gene. Cancer Res.
60: 2745-2748
[Abstract]
[Full Text]
-
Savard, M., Bélanger, C., Tardif, M., Gourde, P., Flamand, L., Gosselin, J.
(2000). Infection of Primary Human Monocytes by Epstein-Barr Virus. J. Virol.
74: 2612-2619
[Abstract]
[Full Text]
Top
Abstract
Introduction
