Previous Article | Next Article 
Journal of Virology, September 1999, p. 7533-7542, Vol. 73, No. 9
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Thymocyte-Thymic Epithelial Cell Interaction Leads to High-Level
Replication of Human Immunodeficiency Virus Exclusively in Mature
CD4+ CD8
CD3+ Thymocytes: a
Critical Role for Tumor Necrosis Factor and Interleukin-7
L.
Chêne,1
M.-T.
Nugeyre,1
E.
Guillemard,1
N.
Moulian,2
F.
Barré-Sinoussi,1 and
N.
Israël1,*
Unité de Biologie des Rétrovirus,
Institut Pasteur, 75724 Paris Cedex 15,1 and
Laboratoire de Physiologie Thymique, Hôpital
Marie-Lannelongue, CNRS ESA-8078, 92350 Le
Plessis-Robinson,2 France
Received 8 March 1999/Accepted 1 June 1999
 |
ABSTRACT |
This work aims at identifying the thymocyte subpopulation able to
support human immunodeficiency virus (HIV) replication under the
biological stimuli of the thymic microenvironment. In this report we
demonstrate that interaction with thymic epithelial cells (TEC) induces
a high-level replication of the T-tropic primary isolate
HIV-1B-LAIp exclusively in the mature CD4+
CD8
CD3+ thymocytes. Tumor necrosis factor
(TNF) and interleukin-7 (IL-7), secreted during this interaction, are
critical cytokines for HIV long terminal repeat transactivation through
NF-
B-dependent activation. TNF is the major inducer of NF-
B and
particularly of the p50-p65 complex, whereas IL-7 acts as a cofactor by
sustaining the expression of the p75 TNF receptor. The requirement for
TNF is further confirmed by the observation that the inability of the
intermediate CD4+ CD8
CD3
thymocytes to replicate the virus is associated with a defect in TNF
production during their interaction with TEC and correlates with the
absence of nuclear NF-
B activity in these freshly isolated thymocytes. Addition of exogenous TNF to the intermediate thymocyte cultures induces NF-
B activity and is sufficient to promote HIV replication in the cocultures with TEC. The other major subpopulation expressing the CD4 receptor, namely, the double-positive (DP) CD4+ CD8+ CD3± thymocytes, despite
the entry of the virus, do not produce a significant level of virus,
presumably because they are unresponsive to TNF and IL-7. Together,
these data suggest that in vivo, despite an efficient entry of the
virus in all the CD4+ subpopulations, a high viral load may
be generated exclusively within the mature CD4+
CD8
CD3+ subset of thymocytes. However, under
conditions of inflammatory response after infection, TNF might also be
present in the intermediate thymocyte compartment, leading to efficient
HIV replication in these cells.
 |
INTRODUCTION |
The progression of human
immunodeficiency virus (HIV) infection is clearly associated with an
increase in the viral load in plasma and a progressive depletion of
CD4+ T cells. One explanation for this depletion is the
exhaustion of T-cell turnover, which must occur at a very high rate to
replace the CD4+ lymphocytes permanently destroyed during
HIV infection (15, 23, 59).
More recent studies on the kinetics of the increase in the number of
CD4+ T cells after triple-combination therapies
demonstrated that the mechanisms of T-cell depletion during HIV
infection are more complex (36, 40). The depletion observed
in the blood compartment may result from a combination of the trapping
of these cells in lymph nodes and inflamed tissues (3, 40)
and a failure of T-cell regeneration in primary lymphoid organs and
particularly in the thymus (17, 36, 61). Although T-cell
development can occur via extrathymic pathways, generation of the
complete T-cell repertoire, required for immune system function, is
dependent upon the thymus. This organ was shown to be still functional
in adults, albeit less actively (17). HIV infection is
accompanied by a decrease in thymic function (17), and
antiviral therapies contribute to immune system reconstitution by a
recovery of naive T cells, probably through expansion of preexisting
cells and thymic production of new cells (3, 37, 61, 65).
However, this renewal occurs slowly (40), suggesting, in
some cases, a severe impairment of T-cell progenitors, probably
depending on the stage of the disease and the age of the patient.
Indeed, observations of thymuses from HIV-infected pediatric patients,
who underwent a rapid progression to AIDS, led to the conclusion that
insult to this organ induces a severe thymocyte depletion associated with a profound disorganization of the epithelial network (27, 41,
44). Modification of the structure of the thymus and loss of
thymocytes were also found in thymic tissues from infected macaques
(39) and from SCID-hu mice (2, 48). This profound deterioration was also confirmed by the inability to completely restore
thymopoiesis in infected thymuses from SCID-hu mice treated with highly
active antiretroviral therapy (61).
For a better understanding of the immunopathogenesis associated with
HIV infection of the thymus, we previously examined the factors and
mechanisms controlling HIV replication in this organ (14,
45). The goal of the present work was the identification of
thymocyte subpopulations that allow efficient HIV replication in the
thymic environment. This relates to the general question of the control
of spreading of the virus in this organ and its consequences for the
peripheral viral load and thymopoiesis.
Using an autologous mixed culture with thymic epithelial cells (TEC)
and the total population of thymocytes, we previously demonstrated that
interaction of infected thymocytes with TEC is a prerequisite for
high-level HIV replication (45). Cytokines secreted during
this TEC-thymocyte interaction were first identified as tumor necrosis
factor (TNF), interleukin-1 (IL-1), IL-6, and granulocyte-macrophage
colony-stimulating factor (GM-CSF), and a role for IL-7 was
demonstrated later (14). Furthermore, we provided evidence
that NF-
B activation is required for a high-level replication of HIV
in thymocytes (14) by demonstrating that HIV provirus with
its two
B sites deleted fails to replicate in thymocytes cocultured
with TEC. NF-
B is composed of homo- and heterodimers of members of
the Rel/NF-
B family (p65, c-Rel, Rel B, p50 and its precursor p105,
and p52 and its precursor p100) (5, 35). These dimers are
sequestered in the cytosol of unstimulated cells via interactions with
a family of inhibitory proteins called I
Bs (I
B
, I
B
, and
I
B
) (60). Following activation by various immune and
inflammatory stimuli, I
B molecules are degraded through the
ubiquitin-proteasome pathway, allowing nuclear translocation of NF-
B
and activation of its target genes (32, 35). We previously demonstrated, using the total population of thymocytes, that TNF in
association with IL-7 induced the p50-p65 activity observed in the
nuclear extracts of these cells.
The data obtained in our coculture system with TEC and the total
population of thymocytes did not indicate, however, whether all the
subpopulations expressing the CD4 receptor were able to produce virus
at a high level in this partially reconstituted thymic environment.
This is an important question in view of the conflicting data found in
the literature. A number of in vitro studies have shown that all the
human CD4+ thymocytes are susceptible to infection
(16, 20, 52, 55, 56). Controversial in vivo studies report a
specific infection of mature (41) or immature
(44) thymocytes within the thymuses from infected infants.
In thymuses from macaques infected with simian immunodeficiency virus,
particles were detected either in the cortical area (7) or
mainly in the medullary area (63). In the SCID-hu mouse
model, viral DNA sequences were detected by PCR analysis in all the
thymocytes expressing the CD4 receptor (30, 49). However,
the kinetics of replication in the different subpopulations was shown
to vary according to the viral isolates (10, 49), and this
is very probably related to the distribution of the chemokine receptors
on the human thymocyte subsets and to their usage by the viral isolates
(9, 31, 42, 64). However, an efficient entry of the virus
does not necessarily lead to a productive infection. We used the
T-tropic primary isolate HIV-1B-LAIp, which is able to
enter all the CD4+ subpopulations of thymocytes (since this
isolate preferentially uses the CXCR4 coreceptor), to test its capacity
to replicate in these distinct subpopulations.
We showed that the mature CD4+ CD8
CD3+ subpopulation is the only one able to sustain a high
level of HIV replication when cocultured with TEC. TNF and IL-7 were
confirmed to be the major coinducers of replication in these cells
through induction of the p50-p65 complex of NF-
B. We also provide
evidence that IL-7 mediates TNF-induced NF-
B activation by
sustaining the expression of the p75 TNF receptor.
The other CD4+ subpopulations do not produce significant
amounts of the virus during their coculture with TEC either because of
their unresponsiveness to the cytokines (double positive) or because of
the defect of TNF production (intermediate [33])
during their interaction with TEC. GM-CSF, mainly secreted by TEC,
strongly amplifies HIV replication in the intermediate subset but has
no effect on the mature subset.
 |
MATERIALS AND METHODS |
Reagents. (i) Antibodies used for selection.
To enrich the
different thymic subpopulations by negative selection, the following
monoclonal antibodies were used: CD3 (X35), CD8 (B9.11), CD83 (HB15A),
CD10 (ALB 1), and CD34 (QBEND 10) (Immunotech, Marseille, France);
OKT4A (Ortho Diagnostic Systems Inc., Raritan, N.J.); and CD14 (M
P9)
(Becton Dickinson & Co., San Jose, Calif.). CD4-PE (13B8.2) and
CD8-FITC (B9.11) were used for positive selection of the DP thymocytes.
(ii) Antibodies used for immunostaining.
To characterize
thymic subpopulations and TEC, monoclonal antibodies conjugated with
the fluorescent dyes CD3-ECD (Coulter Corp., Hialeah, Fla.) or
CD3-fluorescein isothiocyanate (FITC), CD4-phycoerythrin 7 (PE)
(13B8.2), CD8-FITC (B9.11), CD83-PE (HB15a) (Immunotech), and CD14-FITC
(RMO52) (Becton Dickinson) were used, and for indirect staining, CD7
(8H8.1), CD10 (ALB 1), CD34 (QBEND 10), Cytokeratin (KL1) (Immunotech),
and Vimentin (vim3B4) (Boehringer Mannheim, Meylan, France) were
revealed with goat anti-mouse immunoglobulin G (IgG) (H+L)
F(ab')2-FITC (Immunotech). Expression of the two TNF
receptors, p55 and p75, were determined on CD4+ mature and
intermediate thymocytes by using TNF-receptor I (RI)-FITC (p55)
(16803.1) and TNF-RII-FITC (p75) (22235.3) antibodies (R&D Systems).
Negative controls for these immunostaining reactions were performed
with mouse IgG1 (MARK1) and IgG2a (U7.27) antibodies. Conjugated mouse
IgG1-PE (679.1Mc7), IgG1-FITC (679.1Mc7), goat anti-rabbit-FITC, and
goat anti-mouse-FITC antibodies were purchased from Immunotech, and
IgG1-ECD was from Coulter Corp. Direct and indirect immunostaining was
analyzed by cytofluorometry with an EPICS Profile II fluorometer
(Coulter Corp.).
(iii) Cytokines.
Human recombinant cytokines GM-CSF,
IL-1
, and TNF were purchased from Genzyme Corp. (Cambridge, Mass.);
IL-6 and IL-7 were purchased from R&D Systems (Minneapolis, Minn.).
Cytokines were used at the following concentrations: IL-6, 10 ng/ml;
TNF-
, 10 ng/ml; IL-1
, 10 ng/ml; IL-7, 0.5 ng/ml; and GM-CSF, 20 ng/ml.
Cell culture conditions. (i) Preparation of TEC.
Thymic
fragments were obtained from HIV-1-seronegative children (aged 6 days
to 2 years) undergoing elective cardiac surgery. TEC were obtained by
the procedure of Rothe et al. (45). The dispersed TEC were
seeded in a selective medium: McCoy's 5A (GIBCO) containing 10% fetal
calf serum (FCS), 1 mM L-glutamine, 50 µg of
penicillin-streptomycin per ml, 100 µg of neomycin per ml, 5 × 10
5 M
-mercaptoethanol, 20 ng of epidermal growth
factor (Sigma) per ml, 500 ng of hydrocortisone (Sigma) per ml, and
5 × 10
9 M cholera toxin (Interchim,
Montluçon, France) (11). Prior to the coculture, TEC
were maintained in the selective medium described above. An antikeratin
antibody stained more than 95% of cells in the TEC-enriched
population, confirming their epithelial characteristics
(45).
(ii) Preparation of thymocyte subpopulations.
Preparation of
the total population of thymocytes has already been described
(45). Except for the DP, most of the CD4-expressing subpopulations were obtained by negative selection. Mature
CD4+ CD8
CD3+ thymocytes were
obtained after three depletion cycles with anti-CD8, anti-CD10, and
anti-CD34 antibodies and anti-mouse IgG-coated magnetic beads
(Immunotech). Immature CD4± CD8
CD3
thymocytes were obtained after three depletion cycles
with anti-CD3 and anti-CD8, anti-CD14, and anti-CD83 antibodies
followed by anti-mouse IgG-coated magnetic beads. Anti-CD83 was used to
remove dendritic cells. DP thymocytes were enriched by
fluorescence-activated cell sorting with CD4 and CD8 antibodies in an
Elite (Coulter) cell sorter. The antibodies that we used in this
positive selection did not induce activation, since no replication
after cell activation was detectable in these cells. In addition, each
subpopulation obtained by negative selection was further purified by
depleting monocyte/macrophage and dendritic cells with CD14 and CD83
antibodies and anti-mouse IgG-coated magnetic beads (Immunotech).
(iii) Mixed-culture procedure.
Autologous coculture between
TEC and infected thymocytes, either the total population or each of the
enriched CD4+ subpopulations, was performed 3 days after
thymus excision. A ratio of 4 × 106 thymocytes/5 × 104 TEC in 1 ml/well (24 wells/plate) was used in all
the experiments.
The coculture medium was McCoy's 5A (GIBCO) containing 10% fetal calf
serum (FCS), 1 mM L-glutamine, 50 µg of
penicillin-streptomycin per ml, and 100 µg of neomycin per ml. In
some experiments, cytokines were added at the start of the coculture.
Infection of thymocytes with HIV-1B-LAIp.
All
infections were performed with the primary isolate
HIV-1B-LAIp (p is for primary isolate) (6). A
total of 4 × 106 (for most experiments) or 2 × 106 (for the experiment in Fig. 4) thymocytes were infected
at a multiplicity of infection of about 0.001 for 1 h at 37°C.
The thymocytes were then washed three times with RPMI 1640 containing 10 mM HEPES, resuspended in culture medium, and cultured alone or with
TEC in the presence or absence of cytokines. HIV-1
p24gag antigen concentration was determined in
culture supernatants by using a p24gag antigen
detection kit (Coulter HIV-1 p24 antigen assay) as specified by the manufacturer.
Electrophoretic mobility shift assay.
Total-cell extracts
were obtained as previously described (24). Briefly, 5 × 106 thymocytes under different culture conditions were
harvested and washed in phosphate-buffered saline, lysed with 30 µl
of lysis buffer for 15 min, and then centrifuged at 13,000 × g for 10 min. The protein concentration in the cell lysate was
determined by using the Bradford reagent (Bio-Rad Laboratories, Ivry
sur Seine, France).
For the band shift assay, the binding-reaction mixture was prepared by
adding, in the following order, the binding buffer (20 mM HEPES, 2 mM
dithiothreitol, 60 mM KCl, 0.01% Nonidet P-40, 0.1 mg of bovine serum
albumin, 4% Ficoll), 0.4 µg of sonicated salmon sperm, 10 µg of
protein extract, and 30,000 cpm of 32P-labelled DNA probe
(corresponding to 0.25 ng of probe). The sequence of the
oligonucleotides used was
5' GACAGAGGGGGACTTTCCGAGAGG GTCTCCCCTGAAAGGCTCTCCCT 5'
where the NF-

B consensus binding sequence is indicated in
bold
type.
Specific binding was controlled by competition with a 40-fold excess
(10 ng) of the same nonlabeled oligonucleotide added
to the protein
extract before starting the binding reaction. To
identify the subunits
constituting NF-

B complexes, specific antibodies
against p50, p65,
and RelB were used. p50 and p65 antibodies were
a kind gift from A. Israël (Pasteur Institute, Paris, France),
and RelB antibody was
provided by Santa Cruz Biotechnology (Santa
Cruz, Calif.). Antibodies
were added to the protein extract, and
the mixture was incubated for 15 min at 4°C before further incubation
with the radiolabeled
probe.
Statistical analysis.
The relative role of each cytokine in
HIV replication within a given thymocyte subpopulation was
statistically analyzed by the nonparametric test of Mann-Whitney. The
level of significance was set at P = 0.05.
 |
RESULTS |
Enrichment of CD4+ thymocyte subpopulations.
To
study whether the high-level replication observed in total thymocytes
in coculture with TEC is a feature only of a specific thymocyte subset
defined by the maturation state, we enriched the distinct thymocyte
subpopulations expressing CD4 in the absence of cell activation (see
Materials and Methods). Figure 1
represents the characterization by flow cytometry analysis of these
enriched subpopulations according to their surface expression of CD4,
CD8, and CD3.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 1.
Characterization of the CD4+ thymic
subpopulations according to their expression of CD4, CD8, and CD3.
Freshly isolated total thymocytes (A) as well as immature (TN
[CD4 CD8 CD3 ] and
intermediate [CD4+ CD8 CD3 ])
(B), double-positive CD4+ CD8+
CD3± (C), and mature CD4+ CD8
CD3+ (D) thymocytes were characterized to demonstrate
purity. These various populations were immunophenotyped for CD4 (PE)
and CD8 (FITC) and subsequently analyzed by flow cytometry. The
quadrant lines were set by the background signals obtained with
isotype-matched negative controls. Percentages of cells found in each
quadrant are indicated. The histograms (bottom) show CD3 (EDC) surface
staining of each thymocyte population and the percentage of
CD3+ cells. This experiment is representative of three
experiments performed on three different thymuses.
|
|
Immature CD4
+ thymocytes were enriched by negative
selection of total thymocytes with antibodies against CD8 and CD3, to
discard
the mature CD4
+ CD8

CD3
+
and the DP CD4
+ CD8
+ CD3
±
thymocytes. As shown in Fig.
1B, this immature population was
composed
of two main subsets previously described in the human
thymus
(
33): the immature triple-negative (TN) subset
(CD4

CD8

CD3

) and the
intermediate subset (CD4
+ CD8

CD3

), which in this experiment made up 51% (mean, 38% ± 10.6% for
13 thymuses) and 48% (mean, 57.3 ± 10.8% for 13 thymuses) of the
thymocytes, respectively. Enrichment for DP thymocytes
was performed
by fluorescence-activated cell sorting with CD4 and CD8
antibodies.
As shown in Fig.
1C, an enrichment of 94% was obtained.
CD3 expression
was observed in 55% of cells at an intermediate level
and in 15%
at a high level. However, this high level does not reach
the maximum
level observed in the mature
population.
We developed a new technique for enrichment of the mature
CD4
+ CD8

CD3
+ thymocytes. We
performed a negative selection with CD8, CD34,
and CD10 antibodies.
CD34 is expressed on very immature thymocytes
(
18), and CD10
is expressed early during thymocyte development
but decreases with the
increase of CD3 expression at the DP stage
(
54). The
CD4
+ mature population in the experiment in Fig.
1D was
more than
94% (mean, 90.8 ± 2.9% for eight thymuses)
CD3
high and more than 90% CD69
high (data not
shown). Only 6.6% (mean, 9.7 ± 4.8 for eight thymuses)
of these
cells had an undetectable level of CD4, as shown in Fig.
1D. The mature
CD4 unstained thymocytes, could be depleted by
using an antibody
against CD4, suggesting that they also express
CD4 but at a low
level.
Interaction with TEC favors HIV replication exclusively in the
mature CD4+ CD8
CD3+
thymocytes.
We first tested whether the individually enriched
CD4+ subpopulations of thymocytes were capable of producing
HIV at a high level when cocultured with TEC. Total thymocytes as well
as subpopulations containing predominantly DP CD4+
CD8+ CD3±, immature CD4±
CD8
CD3
, and mature CD4+
CD8
CD3+ cells were infected with the primary
HIV-1B-LAIp isolate and cultured alone or cocultured with
autologous TEC. HIV-1 replication was evaluated by measuring the
p24gag antigen concentration in the culture
supernatants at various times postinfection. No HIV replication was
detected when total thymocytes or any of the CD4+
subpopulations were cultured in the absence of TEC (data not shown). In
contrast, an efficient HIV replication was observed in coculture of
autologous TEC with total thymocytes and exclusively with the subset of
mature CD4+ CD8
CD3+ thymocytes,
as shown in Fig. 2. Under our coculture
conditions, the observed replication level for mature thymocytes
obtained from nine thymuses corresponded to 1.5 to 33 ng of
p24gag per ml. In each thymus, the level of
replication observed in this specific subset was about 5- to 20-fold
higher than that observed in total thymocytes. However, it is worth
pointing out that virus entry was not impaired within the DP and
immature thymocytes, as demonstrated by PCR analysis (data not shown).

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 2.
Interaction with TEC favors high-level HIV replication
exclusively in mature CD4+ CD8
CD3+ thymocytes. Freshly isolated total, immature
CD4± CD8 CD3 , double-positive
CD4+ CD8+ CD3±, or mature
CD4+ CD8 CD3+ thymocytes were
infected by HIV-1B-LAIp at a multiplicity of infection of
0.001 as described in Materials and Methods. Each subpopulation was
cocultured with autologous TEC, and HIV replication was determined by
measuring the p24gag concentration in the
coculture supernatants on days 3, 6, 10, 13, and 17 postinfection. This
experiment is representative of four experiments performed on four
thymuses. Ag, antigen.
|
|
CD4+ CD8
CD3+ as well as
intermediate CD4+ CD8
CD3
thymocytes sustain a high-level HIV replication in response to specific
cytokines required for HIV replication.
The cytokines mainly
involved in HIV replication in total thymocytes during their
interaction with TEC were previously determined as TNF, IL-1, IL-6,
GM-CSF (45), and IL-7 (14). We first determined whether addition of these cytokines was sufficient to promote HIV
replication in the mature CD4+ CD8
CD3+ subset. In parallel, we studied whether the absence of
HIV replication in the DP and the immature subsets during their
interaction with TEC was related to a possible unresponsiveness to
these cytokines.
Therefore, total thymocytes, mature CD4
+ CD8

CD3
+, DP CD4
+ CD8
+
CD3
±, and immature CD4
± CD8

CD3

thymocytes were infected with HIV-1
B-LAIp
and were cultured in
absence of TEC but treated with a mixture of TNF,
IL-1, IL-6,
IL-7, and GM-CSF. As shown in Fig.
3A, the role of these cytokines
in
inducing HIV replication in total thymocytes was confirmed.
As
expected, a 5- to 20-fold-increased replication (between 5
and 130 ng
for eight thymuses) was observed in the mature CD4
+
CD8

CD3
+ subset under these conditions (Fig.
3A). In the experiment represented
in Fig.
3A, despite an especially
high-level replication in total
and mature thymocytes, no detectable
replication was observed
in the DP subset. In contrast, the immature
pool of thymocytes,
although unable to produce the virus in the
presence of TEC, was
able to do so when stimulated with these
cytokines. Because the
immature population consists of two different
thymocyte subsets
(as mentioned above), we determined whether this
high-level replication
took place either in the TN CD4

CD8

CD3

or in the intermediate
CD4
+ CD8

CD3

subset or in both.
We considered the TN subset because the permissivity
of these cells was
previously reported in relation to low CD4
expression under conditions
of stimulation by mitogen (
57).
The TN subset was isolated
by depleting the immature subset from
CD4
+ cells by
negative selection with CD4 antibodies. As shown in
Fig.
3B, the
high-level HIV replication observed in the immature
subset when they
were treated with cytokines was not observed
in the TN subset and
therefore must have been restricted to the
intermediate
CD4
+ CD8

CD3

subset (Fig.
3B).

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 3.
The mature CD4+ CD8
CD3+ but also the intermediate CD4+
CD8 CD3 thymocytes sustain high-level HIV
replication under stimulation with the mixture of cytokines (IL-1,
IL-6, IL-7, GM-CSF, and TNF). (A) Freshly isolated total, immature
CD4± CD8 CD3 , double-positive
CD4+ CD8+ CD3±, and mature
CD4+ CD8 CD3+ thymocytes were
infected by the HIV-1B-LAIp isolate at a multiplicity of
infection of 0.001. They were cultured with stimulation by a mixture of
IL-1, IL-6, IL-7, GM-CSF, and TNF. HIV replication was determined by
measuring the p24gag concentration in the
coculture supernatants on days 3, 7, 10, and 14 postinfection. (B)
Immature CD4± CD8 CD3
thymocytes (including intermediate CD4+ CD8
CD3 and TN CD4 CD8
CD3 ) or immature thymocytes depleted from
CD4+ cells resulting in the TN CD4
CD8 CD3 subset were infected by
HIV-1B-LAIp at a multiplicity of infection of 0.001 and
cultured with stimulation by a mixture of cytokines (IL-1, IL-6, IL-7,
GM-CSF, and TNF). HIV replication was determined by measuring the
p24gag concentration in the coculture
supernatants on days 3, 6, 10, and 14 postinfection. This pattern of
response of the different subpopulations to the cytokines is
representative of three experiments performed on three different
thymuses.
|
|
We then evaluated the relative importance of each of these cytokines in
promoting HIV replication in total thymocytes and
in the two responsive
subsets, namely, the mature CD4
+ CD8

CD3
+ and the intermediate CD4
+
CD8

CD3

.
Due to the need for a large number of cells, each population used in
this experiment was obtained from a different thymus.
The total
population, the mature subset, and the immature CD4
±
CD8

CD3

pool (in which only the
intermediate thymocytes replicate the
virus) were infected by
HIV-1
B-LAIp and cultured at 2 × 10
6/well
with either the mixture of all cytokines (TNF, IL-1, IL-6,
IL-7, and
GM-CSF) or with mixtures which each lacked one specific
cytokine. As
shown in Fig.
4A, we confirmed a crucial
role of
TNF and IL-7 in sustaining HIV replication in total thymocytes,
since no detectable replication was observed in the absence of
either
one. The absence of GM-CSF resulted in a significant reduction
of HIV
replication. Comparison of Fig.
4B and C shows that TNF
and IL-7 appear
to play the same crucial role in mature and immature
thymocytes whereas
GM-CSF is an additional major factor only in
immature thymocytes. The
absence of IL-1 did not significantly
affect HIV replication in either
subpopulation, whereas the absence
of IL-6 impaired the replication in
the mature thymocytes exclusively.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 4.
TNF and IL-7 play a crucial role in mature
CD4+ CD8 CD3+ and in immature
CD4+ CD8 CD3 thymocytes,
whereas GM-CSF is a major factor only in immature thymocytes. Each
population used in this experiment, i.e., total (A), mature
CD4+ CD8 CD3+ (B), and immature
CD4± CD8 CD3 (C) was obtained
from a different thymus. Thymocytes of each population were infected by
HIV-1B-LAIp at a multiplicity of infection of 0.001, were
seeded at 2 × 106 cells/ml, and cultured with the
mixture of cytokines (IL-1, IL-6, IL-7, GM-CSF, and TNF) or with this
mixture including all but one of these cytokines. HIV replication was
determined by measuring the p24gag concentration
in the culture supernatants on various days postinfection. For each
subpopulation, this experiment is representative of three experiments
performed with three different thymuses. Statistical analysis by the
nonparametric test of Mann-Whitney gave the following significant
differences between the different cytokine mixtures: for total
thymocytes with all cytokines versus total thymocytes minus IL-7,
P < 0.006; for all cytokines versus minus GM-CSF,
P < 0.006; and for all cytokines versus minus TNF,
P < 0.006; for mature thymocytes with all cytokines
versus minus IL-7, P < 0.02; for all cytokines versus
minus IL-6, P < 0.02; and for all cytokines versus
minus TNF, P < 0.02; for the immature thymocytes with
all cytokines versus minus IL-7, P < 0.006; for all
cytokines versus minus GM-CSF, P < 0.006; and for all
cytokines versus minus TNF, P < 0.01.
|
|
TNF secreted during interaction of thymocytes with TEC is crucial
in inducing NF-
B-dependent replication since its absence during the
specific interaction between intermediate thymocytes and TEC is
responsible for an impaired replication.
Since the lack of a
high-level HIV replication within the intermediate subset was not due
to their unresponsiveness to the specific cytokines required for
replication, we examined an alternative hypothesis, i.e., that of a
defect in the secretion of one or more of these cytokines during
intermediate thymocyte-TEC interaction. To test this hypothesis, we
first performed experiments in which the cytokines exhibiting a crucial
role in the immature subset (TNF, IL-7, and GM-CSF) for HIV replication
were added, individually to cocultures of infected intermediate
thymocytes with TEC. As shown in Fig. 5,
of the three factors tested, only TNF was able to promote a detectable
HIV replication in the coculture. These data suggest that TNF is not
secreted or is secreted in insufficient amounts during immature
thymocyte-TEC interaction.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 5.
Defect in activation of TNF secretion during the
TEC-immature-thymocyte interaction correlates with an impairment of
HIV replication in the immature CD4+ CD8
CD3 thymocytes. Freshly isolated immature
CD4± CD8 CD3 thymocytes were
infected by the HIV-1B-LAIp isolate at a multiplicity of
infection of 0.001. They were cocultured with autologous TEC with no
additional stimulation (Control) or with TNF, IL-7, or GM-CSF. HIV
replication was determined by measuring the
p24gag concentration in the culture supernatants
on various days postinfection. This experiment is representative of
three experiments performed on three different thymuses.
|
|
In our previous report (
14), we provided evidence that the
activation of transcription factors of the Rel/NF-

B family is
a
requirement to promote efficient HIV replication in thymocytes.
The
prevalent NF-

B complex present in total freshly isolated
thymocytes
was shown to be the p50-p65 complex, whereas p50-p50
and p50-RelB
complexes, although present, were less strongly represented.
We also
demonstrated that TNF, secreted during the coculture,
is the cytokine
mainly involved in the maintenance of NF-

B activity
and that TNF
signaling requires coactivation by IL-7. Here we
first verified that
the active p50-p65 complex actually resides
in mature but not in
immature thymocytes. NF-

B complexes were
characterized, in mature
CD4
+ CD8

CD3
+ and immature
CD4
± CD8

CD3

thymocytes
freshly isolated from the same thymus, by electrophoretic
mobility
shift assay with antibodies specific for the different
members of this
family. As shown in Fig.
6A, in the
freshly isolated
CD4
+ CD8

CD3
+
thymocytes, antibodies against p50 abolished the binding of most
complexes, antibodies against p65 abolished the binding of the
upper
complex, and antibodies against RelB did not modify the
binding of any
complex. This suggests that the p50-p50 and the
p50-p65 complexes are
the main representatives in this subset.
In contrast, as shown in Fig.
6B, in freshly isolated immature
thymocytes, the major complex was the
transcriptionally inactive
p50-p50, while the p50-p65 complex was
hardly visible (antibody
upshifting confirmed this interpretation
[data not shown]). We
also confirmed that TNF maintained p50-p65
activity in the mature
CD4
+ CD8

CD3
+ thymocytes (Fig.
6A). As shown in Fig.
6B, this
cytokine can
induce p50-p65 activity also in the immature thymocytes
cultured
for 45 h, demonstrating again that the absence of p50-p65
complex
in freshly isolated cells was not associated with a defect in
responsiveness to this cytokine. In the two populations (mature
and
immature), IL-7 by itself does not induce p50-p65 but, rather,
is a
cofactor with TNF in the induction of p50-p65, as shown in
Fig.
6.
Therefore, convergent lines of evidence indicate that
HIV replication
cannot take place in intermediate thymocytes because
of the absence of
p50-p65 complex, essentially due to the impairment
of TNF production
during the interaction with TEC. In contrast,
mature thymocytes fulfill
the requirement for TNF secretion during
coculture with TEC associated
with an IL-7 secretion for an efficient
NF-

B-dependent transcription
of the viral genome.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 6.
Electrophoretic mobility shift assays. The p50-p65
complex is present in the freshly isolated mature CD4+
CD8 CD3+ thymocytes (A) but not in the
immature CD4± CD8 CD3 ones
(B). TNF and IL-7 coinduce this activity in both subsets. (A)
Whole-cell extracts from freshly isolated mature CD4+
CD8 CD3+ thymocytes were preincubated either
with a preimmune serum (control) or with antibodies against RelB, p65,
or p50 before incubation with a 32P-labeled oligonucleotide
representing the HIV long terminal repeat-derived B motif. The
positions of the two specific bands, p50-p65 and p50-p50, are
indicated. Mature CD4+ CD8 CD3+
thymocytes were also cultured for 45 h either unstimulated
(control) or stimulated with TNF, IL-7, or TNF plus IL-7, or cocultured
with TEC as indicated. Whole-cell extracts from these various samples
were incubated with a 32P-labeled oligonucleotide
representing the HIV long terminal repeat-derived B motif. (B)
Immature CD4± CD8 CD3
thymocytes were freshly isolated or cultured for 45 h either
unstimulated (control) or stimulated with TNF or with IL-7 or with TNF
plus IL-7. Whole-cell extracts from these various samples were
incubated with a 32P-labeled oligonucleotide representing
the HIV long terminal repeat-derived B motif. This experiment is
representative of five experiments performed on five different
thymuses.
|
|
IL-7 sustains expression of the p75 TNF receptor.
The role of
IL-7 as a cofactor of TNF in NF-
B activation was further
investigated in the mature CD4+ CD8
CD3+ thymocytes. We determined the level of expression of
the two TNF receptors, p55 and p75 (12), by immunostaining
and flow cytometry in mature thymocytes either freshly isolated or
maintained in culture for 4 days in the presence or absence of IL-7. As
shown in Fig. 7A, p75 was detected in the
mature thymocytes just after their isolation. However, p75 expression
was not maintained in culture and was no longer detectable at 4 days
unless IL-7 was added to the culture.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 7.
IL-7 maintains p75 TNF receptor expression on the mature
CD4+ CD8 CD3+ thymocytes. The
presence of two TNF receptors, p75 (A) and p55 (B), was determined by
flow cytometry on the mature CD4+ CD8
CD3+ thymocytes, either freshly isolated or cultured for 4 days without IL-7 or with IL-7 as indicated. Thymocytes were stained
with FITC anti-p75, FITC anti-p55, or FITC anti-IgG control. p75 and
p55 fluorescence histograms are shown (solid line) in comparison with
those obtained with the isotype-matched controls (broken line). This
experiment is representative of three experiments performed on three
different thymuses.
|
|
As shown in Fig.
7B, p55 expression, conversely to p75, persists in
culture and IL-7 has no noticeable
effect.
 |
DISCUSSION |
For a better evaluation of the consequences of HIV infection of
the thymus, we investigated whether HIV replication was favored in
thymocytes at certain stages of their differentiation. Our previous in
vitro studies demonstrated the crucial role of interaction of
thymocytes with TEC to produce a high-level virus replication. We
pointed out the role of this interaction in creating a favorable cytokine microenvironment that was able to activate virus replication mainly through TNF, IL-1, IL-6 (45), and IL-7
(14), as well as in protecting thymocytes against apoptosis
through GM-CSF (4, 25) and IL-7 (1, 22). These
previous data have been obtained by infecting the total population of
thymocytes with various primary isolates or laboratory strains
(14, 45). In this study, we identified, within this total
population, the subpopulations of thymocytes in which this high-level
replication readily occurs with the HIV-1B-LAIp primary
isolate. We obtained the same results with the molecular clone NL-4-3
(data not shown). In addition, we specified the characteristics of
these cells which permit such a virus production. The first step of
this work consisted of enriching the CD4+ subpopulations
susceptible to HIV infection. Therefore, the various CD4+
populations were isolated on the basis of their level of expression of
CD4 but also of CD3, a criterion of cell maturity. We developed methods
to enrich these different subpopulations, avoiding nonspecific activation. In most cases, except for the DP thymocytes, negative selection was used. However, no activation subsequent to CD4 and CD8
cell sorting of these cells was observed since no virus replication was
detectable. Figure 1 indicates the rate of enrichment of these subpopulations and the level of expression of the different markers within each subset. In particular, mature CD4+
CD8
CD3+ cells obtained by negative selection
with CD8, CD10 and CD34 antibodies led to a subset of CD8
thymocytes that have undergone positive selection, as also indicated by
the expression of CD69 (data not shown), associated with a strong
expression of CD3 (28, 54). A small part of this population was determined to express CD4 at a low level. These cells probably represent a mature population that has undergone positive selection and
downregulated both CD4 and CD8 before differentiation to
single-positive CD4+ or CD8+ cells (13,
58), or they might also represent thymocytes expressing the

T-cell receptor described that do not express detectable levels
of CD4 (38).
We first show that the population of mature CD4+
CD8
CD3+ thymocytes is the only one able to
exhibit a high-level virus replication when cocultured with TEC (Fig.
2). HIV replication in the mature subpopulation was about 5- to 20-fold
higher than that observed in total thymocytes, whereas this subset
represents 1/20 of the total thymocytes. Since infection progresses in
an exponential manner, we might have expected a more marked difference.
This result may also suggest that within the total thymocytes, the other subpopulations facilitated HIV replication within the mature subset. No replication was detectable in the other CD4+
thymocytes including the intermediate CD4+
CD8
CD3
and the DP CD4+
CD8+ CD3± subsets cocultured with TEC (Fig.
2). The ability of these cells to be infected was not in doubt, as
demonstrated by us (data not shown) and others (49, 55) by
PCR analysis of the proviral genome or by expression of murine genes
inserted into the nef (30) or vpr
(26) region of HIV-1NL4-3 provirus. Together, these data indicate that some replication might occur in the other subsets but at very low levels, undetectable by
p24gag determination in culture supernatants. In
the TN and DP subsets, this absence of detectable replication is
associated with unresponsiveness to the cytokines required for a
high-level replication (TNF, IL-1, IL-6, IL-7, and GM-CSF) (Fig. 3). In
contrast, the intermediate subset does not exhibit a defect in
responsiveness to one or more of these cytokines, since these cells
support a high level of replication in the presence of these cytokines
(Fig. 3). We demonstrated that IL-7 and TNF are both required to
support HIV replication in both the mature and intermediate subsets
(Fig. 4B and C). In addition to the requirement for TNF and IL-7, a
differential role of GM-CSF was observed. This cytokine was an
additional important factor only in the immature subset (Fig. 4B and
C). Therefore, the effect of GM-CSF observed in the total population of
thymocytes reflects its ability to support viral replication
essentially in the intermediate subpopulation. It is very likely that
in the presence of TNF added to the culture, the synergistic role of IL-1 is hardly visible, since both cytokines act on NF-
B activation and since TNF signaling has the major effect (14). In
contrast, the effect of IL-6 on HIV replication is restricted to the
mature population. This is in agreement with the fact that this
cytokine was shown to specifically induce the proliferation of this
thymocyte subset (50).
The requirement for IL-7 might explain the absence of viral production
in the DP cells, since most of them do not express the IL-7 receptor
(51). However, according to the murine model, a small
fraction of the DP cells (around 5%) which have undergone positive
selection have acquired this receptor. We cannot exclude replication in
this small fraction of DP cells, which might be masked by the high rate
of apoptosis of the remaining 95% of the DP cells which are not
protected by the antiapoptotic effect of IL-7 in culture. Response to
TNF might not also be efficient in this set of DP cells, since TNF
receptors are present on only 3% of the total population of thymocytes
(46).
We previously demonstrated with the total population of thymocytes
(14, 45) that TNF and IL-7 act synergistically to enhance HIV transcription through NF-
B transcription factors, with p50-p65 being the prevalent complex observed. We demonstrate here that the
p50-p65 activity observed in the total population is clearly located in
the freshly isolated mature thymocytes and is maintained either by
coculture with TEC or by the synergistic effect of TNF and IL-7 (Fig.
6A). The major role of TNF in HIV replication in thymocytes was further
confirmed by the fact that the only barrier to virus production in
intermediate thymocytes was a defect in TNF production during their
interaction with TEC. Indeed, addition of exogenous TNF to the
coculture was sufficient to induce replication (Fig. 5). The relevance
of the absence of an efficient stimulation by TNF in the
microenvironment of the intermediate thymocytes was supported in vivo
by the fact that these thymocytes, freshly isolated, are devoid of
nuclear p50-p65 activity. The p50-p50 complex was observed, but this
complex is transcriptionally inactive (19) (Fig. 6B). When
added to the culture medium of these thymocytes, TNF induces the
activation of p50-p65, suggesting again the lack of TNF in the microenvironment.
The role of IL-7 as a cofactor with TNF in the activation of NF-
B
was further investigated in the mature thymocytes. We showed that TNF
receptors p55 and p75 (12) were both expressed when cells
were freshly isolated from their thymic environment. Culture of these
cells led to a decrease of p75 expression, whereas p55 expression was
much more stable. However, IL-7 was able to maintain p75 expression in
culture but has no effect on p55 expression. It is worth noting that
IL-7, known for its antiapoptotic role, favors the expression of the
p75 receptor, which leads exclusively to NF-
B activation, and not
that of the p55 receptor, which also leads to an apoptotic pathway.
This increase in NF-
B, by itself, might serve to protect against
apoptosis induced by TNF signaling through p55 (47). Since
p55 expression is constitutively stable, this receptor might be
sufficient to induce the NF-
B activation necessary for HIV
replication even in absence of IL-7, but the higher rate of cell death
(observed in the culture in absence of IL-7) might impair this process.
This interpretation is supported by the data in the literature showing
that only agonists of the p75 receptor lead to thymocyte activation, as
shown by their proliferation, whereas agonists of p55 receptor mediate
cytotoxicity (53). Since GM-CSF plays an important role in
HIV replication in the immature population, we also tested its effect
on the expression of the two TNF receptors. However, since the
viability of the immature thymocytes is highly dependent on IL-7, we
tested GM-CSF in the presence of IL-7 and found that the levels of the
two TNF receptors were identical to those observed with IL-7 alone.
Taken together, these data led us to establish the following model for
the dynamics of HIV replication in the thymus. Our study argues for a
preferential replication within the mature CD4+
CD8
CD3+ thymocytes as a result of their
interaction with TEC by a process involving TNF and IL-7 secretion. The
presence of a high viral load in this population might be responsible
in vivo for an increase of the peripheral viral load, explaining a
rapid progression toward AIDS. We can also speculate that the
intermediate thymocytes may contribute to viral spreading in the
presence of TNF, secreted in their microenvironment, by inflammatory
cells in response to infection of the mature population. This sequence
of events was actually observed in the thymus of juvenile cats infected
by feline immunodeficiency virus: a high level of virus was observed
within mature thymocytes early postinfection, whereas infection of the immature thymocytes was seen later and was associated with the inflammatory response and cortical atrophy (62).
Furthermore, infection of this immature population is upregulated by
GM-CSF. This cytokine might act by increasing thymocyte viability
(23, 29) or, as suggested previously (21), by
increasing IL-7 receptor expression on the thymocyte surface
(21). We cannot exclude the possibility that GM-CSF with TNF
favors the differentiation of immature CD34+ thymocytes
into dendritic cells (34). Indeed, we observed that addition
of GM-CSF to immature CD4+ CD8
CD3
cells cultured with IL-7 and TNF is associated with
the appearance of cells with dendritic morphology (data not shown).
Dendritic cells were shown to strongly enhance HIV replication in T
cells (43), and thymic dendritic cells were also found to
support HIV replication (8). It is possible that dendritic
differentiation and infection, in the immature compartment, also
contributes to the inflammatory response. Such an inflammatory
response, by favoring virus spreading, might lead to direct destruction
of these cells (49) and disruption of the cortical
microenvironment and may contribute to an irreversible adverse effect
on T-cell regeneration.
 |
ACKNOWLEDGMENTS |
L. Chêne and M.-T. Nugeyre contributed equally to this work.
We are very grateful to Sonia Berrih-Aknin and to Claude Planché
(Hospital Marie-Lannelongue, Le Plessis-Robinson, France) for providing
us with thymuses from infants undergoing cardiac surgery. We also thank
Sonia Berrih-Aknin for helpful discussions. We thank R. H. Bassin
for careful reading of the manuscript.
This work was supported by the Agence Nationale pour la Recherche sur
le SIDA (ANRS). L. Chêne was a fellow of the French Ministry of
Education and Research (MENESR). E. Guillemard was supported by a
SIDACTION fellowship from Fondation pour la Recherche Médicale.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Unité de
Biologie des Rétrovirus, Institut Pasteur, 25 rue du Dr Roux,
75724 Paris Cedex 15, France. Phone: 33 1 45 68 89 44/87 33. Fax: 33 1 45 68 89 57. E-mail: nisrael{at}pasteur.fr.
 |
REFERENCES |
| 1.
|
Akashi, K.,
M. Kondo,
U. von Freeden-Jeffry,
R. Murray, and I. L. Weissman.
1997.
Bcl-2 rescues T lymphopoiesis in interleukin-7 receptor-deficient mice.
Cell
89:1033-1041[Medline].
|
| 2.
|
Aldrovandi, G. M.,
G. Feuer,
L. Gao,
B. Jamieson,
M. Kristeva,
I. S. Y. Chen, and J. A. Zack.
1993.
The SCID-hu mouse as a model for HIV-1 infection.
Nature
363:732-736[Medline].
|
| 3.
|
Autran, B.,
G. Carcelain,
T. S. Li,
C. Blanc,
D. Mathez,
R. Tubiana,
C. Katlama,
P. Debre, and J. Leibowitch.
1997.
Positive effects of combined antiretroviral therapy on CD4+ T cell homeostasis and function in advanced HIV disease.
Science
277:112-116[Abstract/Free Full Text].
|
| 4.
|
Bach, M. K., and J. R. Brashler.
1995.
Evidence that granulocyte/macrophage-colony-stimulating factor and interferon-gamma maintain the viability of human peripheral blood monocytes in part by their suppression of IL-10 production.
Int. Arch. Allergy Immunol.
107:90-92[Medline].
|
| 5.
|
Baldwin, A. S.
1996.
The NF-kappa B and I kappa B proteins: new discoveries and insights.
Annu. Rev. Immunol.
14:649-683[Medline].
|
| 6.
|
Barré-Sinoussi, F.,
J.-C. Chermann,
F. Rey,
M.-T. Nugeyre,
S. Chamaret,
C. Axler-Blin,
F. Vezinet-Brun,
C. Rouzioux,
W. Rozenbaum, and L. Montagnier.
1983.
Isolation of a T lymphotropic retrovirus from a patient at risk for acquired immune deficiency syndrome (AIDS).
Science
220:868-870[Abstract/Free Full Text].
|
| 7.
|
Baskin, G. B.,
M. Murphey-Corb,
L. N. Martin,
B. Davison-Fairburn,
F.-S. Hu, and D. Kuebler.
1991.
Thymus in simian immunodeficiency virus-infected rhesus monkeys.
Lab. Investig.
65:400-407[Medline].
|
| 8.
|
Beaulieu, S.,
A. Kessous,
D. Landry,
S. Montplaisir,
D. Bergeron, and E. A. Cohen.
1996.
In vitro characterization of purified human thymic dendritic cells infected with human immunodeficiency virus type 1.
Virology
222:214-226[Medline].
|
| 9.
|
Berkowitz, R. D.,
K. P. Bekerman,
T. J. Schall, and J. M. McCune.
1998.
CXCR4 and CCR5 expression delineates target for HIV-1 disruption of T cell differentiation.
J. Immunol.
161:3702-3710[Abstract/Free Full Text].
|
| 10.
|
Bonyhadi, M. L.,
L. Rabin,
S. Salimi,
D. A. Brown,
J. Kosek,
J. M. McCune, and H. Kaneshima.
1993.
HIV induces thymus depletion in vivo.
Nature
363:728-732[Medline].
|
| 11.
|
Braun, J.,
H. Valentin,
M. T. Nugeyre,
H. Ohayon,
P. Gounon, and F. Barré-Sinoussi.
1996.
Productive and persistent infection of human thymic epithelial cells in vitro with HIV-1.
Virology
225:413-418[Medline].
|
| 12.
|
Brockhaus, M.,
H. J. Schoenfeld,
E. J. Schlaeger,
W. Hunzicher,
W. Lesslauer, and H. Loetsher.
1990.
Identification of two types of tumor necrosis factor receptors on human cell lines by monoclonal antibodies.
Proc. Natl. Acad. Sci. USA
87:3127-3131[Abstract/Free Full Text].
|
| 13.
|
Budd, R. C., and P. F. Mixter.
1995.
The origin of CD4-CD8-TCR + thymocytes: a model based on T-cell receptor avidity.
Immunol. Today
16:428-431[Medline].
|
| 14.
|
Chêne, L.,
M. T. Nugeyre,
F. Barré-Sinoussi, and N. Israël.
1999.
High-level replication of human immunodeficiency virus in thymocytes requires NF- B activation through interaction with thymic epithelial cells.
J. Virol.
73:2064-2073[Abstract/Free Full Text].
|
| 15.
|
Coffin, J. M.
1995.
HIV population dynamics in vivo: implications for genetic variation, pathogenesis, and therapy.
Science
267:483-489.
|
| 16.
|
De Rossi, A.,
M.-L. Calabro,
M. Panozzo,
D. Bernardi,
B. Caruzo,
G. Tridente, and L. Chieco-Banchi.
1990.
In vitro studies of HIV-1 infection in thymic lymphocytes: a putative role of the thymus in AIDS pathogenesis.
AIDS Res. Hum. Retroviruses
6:287-297[Medline].
|
| 17.
|
Douek, D. C.,
R. D. McFarland,
P. H. Keiser,
E. A. Gage,
J. M. Massey,
B. F. Haynes,
M. A. Polis,
A. T. Haase,
M. B. Feinberg,
J. L. Sullivan,
B. D. Jamieson,
J. A. Zack,
L. J. Picker, and R. A. Koup.
1998.
Changes in thymic function with age and during the treatment of HIV infection.
Nature
396:690-695[Medline].
|
| 18.
|
Galy, A.,
S. Verma,
A. Barcena, and H. Spits.
1993.
Precursors of CD3+CD4+CD8+ cells in the human thymus are defined by expression of CD34. Delineation of early events in human thymic development.
J. Exp. Med.
178:391-401[Abstract/Free Full Text].
|
| 19.
|
Hansen, S. K.,
L. Guerrini, and F. Blasi.
1994.
Differential DNA sequence specificity and regulation of HIV-1 enhancer activity by crel-relA transcription factor.
J. Biol. Chem.
269:22230-22237[Abstract/Free Full Text].
|
| 20.
|
Hays, E. F.,
C. H. Uittenbogaart,
J. C. Brewer,
L. W. Vollger, and J. A. Zack.
1992.
In vitro studies of HIV-1 expression in thymocytes from infants and children.
AIDS
6:265-272[Medline].
|
| 21.
|
Herbelin, A.,
F. Machavoine,
A. Vicari,
E. Schneider,
M. Papiernik,
H. Ziltener,
C. Penit, and M. Dy.
1994.
Endogenous granulocyte-macrophage colony-stimulating factor is involved in IL-1- and IL-7-induced murine thymocyte proliferation.
J. Immunol.
153:1973-1981[Abstract].
|
| 22.
|
Hernandez-Caselles, T.,
M. Martinez-Esparza,
D. Sancho,
G. Rubio, and P. Aparicio.
1995.
Interleukin-7 rescues human activated T lymphocytes from apoptosis induced by glucocorticosteroids and regulates Bcl-2 and CD25 expression.
Hum. Immunol.
43:181-189[Medline].
|
| 23.
|
Ho, D. D.,
A. U. Neumann,
A. S. Perelson,
W. Chen,
J. M. Leonard, and M. Markowitz.
1995.
Rapid turnover of plasma virions and CD4 lymphocytes in HIV-1 infection.
Nature
373:123-126[Medline].
|
| 24.
|
Israel, N.,
U. Hazan,
J. Alcami,
A. Munier,
S. F. Arenzana,
F. Bachelerie,
A. Israel, and J. L. Virelizier.
1989.
Tumor necrosis factor stimulates transcription of HIV-1 in human T lymphocytes, independently and synergistically with mitogens.
J. Immunol.
143:3956-3960[Abstract].
|
| 25.
|
Iversen, P. O.,
L. B. To, and A. F. Lopez.
1996.
Apoptosis of hemopoietic cells by the human granulocyte-macrophage colony-stimulating factor mutant E21R.
Proc. Natl. Acad. Sci. USA
93:2785-2789[Abstract/Free Full Text].
|
| 26.
|
Jamieson, B. D., and J. A. Zack.
1998.
In vivo pathogenesis of a human immunodeficiency virus type 1 reporter virus.
J. Virol.
72:6520-6526[Abstract/Free Full Text].
|
| 27.
|
Joshi, V. V.,
J. M. Oleske,
S. Saad,
C. Gadol,
E. Connor,
R. Bobila, and A. B. Minnefor.
1986.
Thymus biopsy in children with acquired immunodeficiency syndrome.
Arch. Pathol. Lab. Med.
110:837-842[Medline].
|
| 28.
|
Jung, L. K. L.,
B. F. Haynes,
S. Nakamura,
S. Pahwa, and S. M. Fu.
1990.
Expression of early activation antigen (CD69) during human T cell development.
Clin. Exp. Immunol.
141:466-472.
|
| 29.
|
Kinoshita, T.,
T. Yokoda,
K. Arai, and A. Miyajima.
1995.
Regulation of Bcl-2 expression by oncogenic Ras protein in hematopoietic cells.
Oncogene
10:2207-2212[Medline].
|
| 30.
|
Kitchen, S. G.,
C. H. Uittenbogaart, and J. A. Zack.
1997.
Mechanism of human immunodeficiency virus type 1 localization in CD4-negative thymocytes differentiation from a CD4-positive precursor allows productive infection.
J. Virol.
71:5713-5722[Abstract/Free Full Text].
|
| 31.
|
Kitchen, S. G., and J. A. Zack.
1997.
CXCR4 expression during lymphopoiesis: implications for human immunodeficiency virus type 1 infection of the thymus.
J. Virol.
71:6928-6934[Abstract/Free Full Text].
|
| 32.
|
Kopp, E. B., and S. Ghosh.
1995.
NF-kappa B and rel proteins in innate immunity.
Adv. Immunol.
58:1-27[Medline].
|
| 33.
|
Kraft, D. L.,
I. L. Weissman, and E. K. Waller.
1993.
Differentiation of CD3 4 8 human fetal thymocytes in vivo: characterization of a CD3 4+8 intermediate.
J. Exp. Med.
178:265-277[Abstract/Free Full Text].
|
| 34.
|
Marquez, C.,
C. Trigueros,
E. Fernandez, and M. L. Toribio.
1995.
The development of T and non-T cell lineages from CD34+ human thymic precursors can be traced by the differential expression of CD44.
J. Exp. Med.
181:475-483[Abstract/Free Full Text].
|
| 35.
|
May, M. J., and S. Ghosh.
1997.
Rel/NF-kappa B and I kappa B proteins: an overview.
Semin. Cancer Biol.
8:63-73[Medline].
|
| 36.
|
McCune, J. M.
1997.
Thymic function in HIV-1 disease.
Semin. Immunol.
9:397-404[Medline].
|
| 37.
|
McCune, J. M.,
R. Loftus,
D. K. Schmidt,
P. Carroll,
D. Webster,
Y. L. Swor,
I. R. Francis,
B. H. Gross, and R. M. Grant.
1998.
High prevalence of thymic tissue in adults with human immunodeficiency virus-1 infection.
J. Clin. Investig.
101:2301-2308[Medline].
|
| 38.
|
Moretta, L.,
E. Ciccone,
S. Ferrini,
P. G. Pelicci,
M. C. Mingari,
J. Zeromski,
C. Bottino,
C. Grossi, and A. Moretta.
1991.
Molecular and cellular analysis of human T lymphocytes expressing gamma delta T-cell receptor.
Immunol. Rev.
120:117-125[Medline].
|
| 39.
|
Müller, J. G.,
V. Krenn,
C. Schindler,
S. Czub,
C. Stahl-Hennig,
C. Coulibaly,
G. Hunsmann,
C. Kneitz,
T. Kerbau,
A. Rethwilm,
V. terMeulen, and H. K. Müller-Hermelink.
1993.
Alteration of thymus cortical epithelium and interdigitating dendritic cells but no increase of thymocyte cell death in the early course of simian immunodeficiency virus infection.
Am. J. Pathol.
143:699-713[Abstract].
|
| 40.
|
Pakker, N. G.,
D. W. Notermans,
R. de Boer,
M. T. Roos,
F. de Wolf,
A. Hill,
J. M. Leonard,
S. A. Danner,
F. Miedema, and P. T. Schellekens.
1998.
Biphasic kinetics of peripheral blood T cells after triple combination therapy in HIV-1 infection: a composite of redistribution and proliferation.
Nat. Med.
4:208-214[Medline].
|
| 41.
|
Papiernik, M.,
Y. Brossard,
N. Mulliez,
J. Roume,
C. Brechot,
F. Barin,
A. Goudeau,
J.-F. Bach,
C. Griscelli,
R. Henrion, and R. Vazeux.
1992.
Thymic abnormalities in fetuses aborted from human immunodeficiency virus type 1 seropositive women.
Pediatrics
89:297-301[Abstract/Free Full Text].
|
| 42.
|
Pedroza-Martins, L.,
K. B. Gurney,
B. E. Torbett, and C. Uittenbogaart.
1998.
Differential tropism and replication kinetics of human immunodeficiency virus type 1 isolates in thymocytes: coreceptor expression allows viral entry, but productive infection of distinct subsets is determined at the postentry level.
J. Virol.
72:9441-9452[Abstract/Free Full Text].
|
| 43.
|
Pope, M.,
S. Gezelter,
N. Gallo,
L. Hoffman, and R. M. Steinman.
1995.
Low levels of HIV-1 infection in cutaneous dendritic cells promote extensive viral replication upon binding to memory CD4+ T cells.
J. Exp. Med.
182:2045-2056[Abstract/Free Full Text].
|
| 44.
|
Rosenzweig, M.,
D. P. Clark, and G. N. Gaulton.
1993.
Selective thymocyte depletion in neonatal HIV-1 thymic infection.
AIDS
7:1601-1605[Medline].
|
| 45.
|
Rothe, M.,
L. Chêne,
M. Nugeyre,
F. Barré-Sinoussi, and N. Israël.
1998.
Contact with thymic epithelial cells as a prerequisite for cytokines enhanced HIV-1 replication in thymocytes.
J. Virol.
72:5852-5861[Abstract/Free Full Text].
|
| 46.
|
Ryffel, B.,
M. Brockhaus,
B. Greiner,
M. J. Mihatsh, and F. Gudat.
1991.
Tumour necrosis factor receptor distribution in human lymphoid tissue.
Immunology
74:446-452[Medline].
|
| 47.
|
Sonenshein, G. E.
1997.
Rel/NF-kappa B transcription factors and the control of apoptosis.
Semin. Cancer Biol.
2:113-119.
|
| 48.
|
Stanley, S. K.,
J. M. McCune,
H. Kaneshima,
J. S. Justement,
M. Sullivan,
E. Boone,
M. Baseler,
J. Adelsberger,
M. Bonyhadi,
J. Orenstein,
C. H. Fox, and A. S. Fauci.
1993.
Human immunodeficiency virus infection of the human thymus and disruption of the thymic microenvironment in the SCID-hu mouse.
J. Exp. Med.
178:1151-1163[Abstract/Free Full Text].
|
| 49.
|
Su, L.,
H. Kaneshima,
M. Bonyhadi,
S. Salimi,
D. Kraft,
L. Rabin, and J. M. McCune.
1995.
HIV-1-induced thymocyte depletion is associated with indirect cytopathogenicity and infection of progenitor cells in vivo.
Immunity
2:25-36[Medline].
|
| 50.
|
Suda, T.,
R. Murray,
C. Guidos, and A. Zlotnik.
1990.
Growth-promoting activity of IL-1 alpha, IL-6, and tumor necrosis factor-alpha in combination with IL-2, IL-4, or IL-7 on murine thymocytes. Differential effects on CD4/CD8 subsets and on CD3+/CD3 double-negative thymocytes.
J. Immunol.
144:3039-3045[Abstract].
|
| 51.
|
Sudo, T.,
S. Nishikawa,
N. Ohno,
N. Akiyama,
M. Tamakoshi,
H. Yoshida, and S. Nishikawa.
1993.
Expression and function of the interleukin 7 receptor in murine lymphocytes.
Proc. Natl. Acad. Sci. USA
90:9125-9129[Abstract/Free Full Text].
|
| 52.
|
Tanaka, K. E.,
W. C. Hatch,
Y. Kress,
R. Soeiro,
T. Calvelli,
W. K. Rashbaum,
A. Rubinstein, and W. D. Lyman.
1992.
HIV-1 infection of human fetal thymocytes.
J. Acquired Immune Defic. Syndr.
5:94-101.
|
| 53.
|
Tartaglia, L. A.,
D. V. Goeddel,
C. Reynolds,
I. S. Figari,
R. F. Weber, and M. A. Palladino.
1993.
Stimulation of human T-cell proliferation by specific activation of the 75-kDa tumor necrosis factor receptor.
J. Immunol.
151:4637-4641[Abstract].
|
| 54.
|
Terstappen, L.,
S. Huang, and L. Picker.
1992.
Flow cytometry assessment of human T-cell differentiation in thymus and bone marrow.
Blood
79:666-677[Abstract/Free Full Text].
|
| 55.
|
Uittenbogaart, C. H.,
D. J. Anisman,
B. D. Jamieson,
S. Kitchen,
I. Schmid,
J. A. Zack, and E. F. Hays.
1996.
Differential tropism of HIV-1 isolates for distinct thymocyte subsets in vitro.
AIDS
10:9-16[Medline].
|
| 56.
|
Uittenbogaart, C. H.,
D. J. Anisman,
J. A. Zack,
A. Economides,
I. Schmid, and E. F. Hays.
1995.
Effects of cytokines on HIV-1 production by thymocytes.
Thymus
23:155-175.
|
| 57.
|
Valentin, H.,
M. T. Nugeyre,
F. Vuillier,
L. Boumsell,
M. Schmid,
F. Barré-Sinoussi, and R. A. Pereira.
1994.
Two subpopulations of human triple-negative thymic cells are susceptible to infection by human immunodeficiency virus type 1 in vitro.
J. Virol.
68:3041-3050[Abstract/Free Full Text].
|
| 58.
|
Vanhecke, D.,
G. Leclercq,
J. Plum, and B. Vandekerckhove.
1995.
Characterization of distinct stages during the differentiation of human CD69+CD3+ thymocytes and identification of thymic emigrants.
J. Immunol.
155:1862-1872[Abstract].
|
| 59.
|
Wei, X.,
S. K. Ghosh,
M. E. Taylor,
V. A. Johnson,
E. A. Emini,
P. Deutsch,
J. D. Lifson,
S. Bonhoefer,
M. A. Nowak,
B. H. Hahn,
M. S. Saag, and G. M. Shaw.
1995.
Viral dynamics in human immunodeficiency virus type 1 infection.
Nature
373:117-122[Medline].
|
| 60.
|
Whiteside, S. T., and A. Israel.
1997.
I kappa B proteins: structure, function and regulation.
Semin. Cancer Biol.
8:75-82[Medline].
|
| 61.
|
Withers-Ward, E. S.,
R. G. Amado,
P. S. Koka,
B. D. Jamieson,
A. H. Kaplan,
I. S. Y. Chen, and J. A. Zack.
1997.
Transient renewal of thymopoiesis in HIV-infected human thymic implants following antiviral therapy.
Nat. Med.
3:1102-1109[Medline].
|
| 62.
|
Woo, J. C.,
G. A. Dean,
N. C. Pedersen, and P. F. Moore.
1997.
Immunopathologic changes in the thymus during the acute stage of experimentally induced immunodeficiency virus infection in juvenile cats.
J. Virol.
71:8632-8641[Abstract/Free Full Text].
|
| 63.
|
Wykrzykowska, J. J.,
M. Rosenzweig,
R. S. Veazey,
M. A. Simon,
K. Halvorsen,
R. C. Desrosier,
R. P. Johnson, and A. Lackner.
1998.
Early regeneration of thymic progenitors in rhesus macaques infected with simian immunodeficiency virus.
J. Exp. Med.
187:1767-1778[Abstract/Free Full Text].
|
| 64.
|
Zaitseva, M. B.,
S. Lee,
R. L. Rabin,
H. L. Tiffany,
J. M. Farber,
K. W. C. Peden,
P. M. Murphy, and H. Golding.
1998.
CXCR4 and CCR5 on human thymocytes: biological function and role in HIV-1 infection.
J. Immunol.
161:3103-3113[Abstract/Free Full Text].
|
| 65.
|
Zhang, Z. Q.,
D. W. Notermans,
G. Sedgewick,
W. Cavert,
S. Wietgrefe,
M. Zupancic,
K. Gebhard,
K. Henry,
L. Boies,
Z. Chen,
M. Jenkins,
R. Mills,
H. McDade,
C. Goodwin,
C. M. Schuwirth,
S. A. Danner, and A. T. Haase.
1998.
Kinetics of CD4+ T cell repopulation of lymphoid tissues after treatment of HIV infection.
Proc. Natl. Acad. Sci. USA
95:1154-1159[Abstract/Free Full Text].
|
Journal of Virology, September 1999, p. 7533-7542, Vol. 73, No. 9
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Zaunders, J. J., Ip, S., Munier, M. L., Kaufmann, D. E., Suzuki, K., Brereton, C., Sasson, S. C., Seddiki, N., Koelsch, K., Landay, A., Grey, P., Finlayson, R., Kaldor, J., Rosenberg, E. S., Walker, B. D., Fazekas de St. Groth, B., Cooper, D. A., Kelleher, A. D., on Behalf of the PHAEDRA Study Team,
(2006). Infection of CD127+ (Interleukin-7 Receptor+) CD4+ Cells and Overexpression of CTLA-4 Are Linked to Loss of Antigen-Specific CD4 T Cells during Primary Human Immunodeficiency Virus Type 1 Infection. J. Virol.
80: 10162-10172
[Abstract]
[Full Text]
-
Zhang, M., Drenkow, J., Lankford, C. S. R., Frucht, D. M., Rabin, R. L., Gingeras, T. R., Venkateshan, C., Schwartzkopff, F., Clouse, K. A., Dayton, A. I.
(2006). HIV regulation of the IL-7R: a viral mechanism for enhancing HIV-1 replication in human macrophages in vitro. J. Leukoc. Biol.
79: 1328-1338
[Abstract]
[Full Text]
-
Audige, A., Schlaepfer, E., Joller, H., Speck, R. F.
(2005). Uncoupled Anti-HIV and Immune-Enhancing Effects when Combining IFN-{alpha} and IL-7. J. Immunol.
175: 3724-3736
[Abstract]
[Full Text]
-
Thiebot, H., Vaslin, B., Derdouch, S., Bertho, J.-M., Mouthon, F., Prost, S., Gras, G., Ducouret, P., Dormont, D., Le Grand, R.
(2005). Impact of bone marrow hematopoiesis failure on T-cell generation during pathogenic simian immunodeficiency virus infection in macaques. Blood
105: 2403-2409
[Abstract]
[Full Text]
-
Stebbing, J., Gazzard, B., Douek, D. C.
(2004). Where Does HIV Live?. NEJM
350: 1872-1880
[Full Text]
-
Brooks, D. G., Arlen, P. A., Gao, L., Kitchen, C. M. R., Zack, J. A.
(2003). Identification of T cell-signaling pathways that stimulate latent HIV in primary cells. Proc. Natl. Acad. Sci. USA
100: 12955-12960
[Abstract]
[Full Text]
-
Nugeyre, M.-T., Monceaux, V., Beq, S., Cumont, M.-C., Fang, R. H. T., Chene, L., Morre, M., Barre-Sinoussi, F., Hurtrel, B., Israel, N.
(2003). IL-7 Stimulates T Cell Renewal Without Increasing Viral Replication in Simian Immunodeficiency Virus-Infected Macaques. J. Immunol.
171: 4447-4453
[Abstract]
[Full Text]
-
Napolitano, L. A., Stoddart, C. A., Hanley, M. B., Wieder, E., McCune, J. M.
(2003). Effects of IL-7 on Early Human Thymocyte Progenitor Cells In Vitro and in SCID-hu Thy/Liv Mice. J. Immunol.
171: 645-654
[Abstract]
[Full Text]
-
Schmitt, N., Chene, L., Boutolleau, D., Nugeyre, M.-T., Guillemard, E., Versmisse, P., Jacquemot, C., Barre-Sinoussi, F., Israel, N.
(2003). Positive Regulation of CXCR4 Expression and Signaling by Interleukin-7 in CD4+ Mature Thymocytes Correlates with Their Capacity To Favor Human Immunodeficiency X4 Virus Replication. J. Virol.
77: 5784-5793
[Abstract]
[Full Text]
-
Ducrey-Rundquist, O., Guyader, M., Trono, D.
(2002). Modalities of Interleukin-7-Induced Human Immunodeficiency Virus Permissiveness in Quiescent T Lymphocytes. J. Virol.
76: 9103-9111
[Abstract]
[Full Text]
-
Pedroza-Martins, L., Boscardin, W. J., Anisman-Posner, D. J., Schols, D., Bryson, Y. J., Uittenbogaart, C. H.
(2002). Impact of Cytokines on Replication in the Thymus of Primary Human Immunodeficiency Virus Type 1 Isolates from Infants. J. Virol.
76: 6929-6943
[Abstract]
[Full Text]
-
Wuchter, C., Ruppert, V., Schrappe, M., Dorken, B., Ludwig, W.-D., Karawajew, L.
(2002). In vitro susceptibility to dexamethasone- and doxorubicin-induced apoptotic cell death in context of maturation stage, responsiveness to interleukin 7, and early cytoreduction in vivo in childhood T-cell acute lymphoblastic leukemia. Blood
99: 4109-4115
[Abstract]
[Full Text]
-
Steffens, C. M., Managlia, E. Z., Landay, A., Al-Harthi, L.
(2002). Interleukin-7-treated naive T cells can be productively infected by T-cell-adapted and primary isolates of human immunodeficiency virus 1. Blood
99: 3310-3318
[Abstract]
[Full Text]
-
Igarashi, T., Brown, C. R., Byrum, R. A., Nishimura, Y., Endo, Y., Plishka, R. J., Buckler, C., Buckler-White, A., Miller, G., Hirsch, V. M., Martin, M. A.
(2002). Rapid and Irreversible CD4+ T-Cell Depletion Induced by the Highly Pathogenic Simian/Human Immunodeficiency Virus SHIVDH12R Is Systemic and Synchronous. J. Virol.
76: 379-391
[Abstract]
[Full Text]
-
Llano, A., Barretina, J., Gutierrez, A., Blanco, J., Cabrera, C., Clotet, B., Este, J. A.
(2001). Interleukin-7 in Plasma Correlates with CD4 T-Cell Depletion and May Be Associated with Emergence of Syncytium-Inducing Variants in Human Immunodeficiency Virus Type 1-Positive Individuals. J. Virol.
75: 10319-10325
[Abstract]
[Full Text]
-
Guillemard, E., Nugeyre, M.-T., Chene, L., Schmitt, N., Jacquemot, C., Barre-Sinoussi, F., Israel, N.
(2001). Interleukin-7 and infection itself by human immunodeficiency virus 1 favor virus persistence in mature CD4+CD8{-}CD3+ thymocytes through sustained induction of Bcl-2. Blood
98: 2166-2174
[Abstract]
[Full Text]