Previous Article | Next Article ![]()
Journal of Virology, September 1999, p. 7328-7333, Vol. 73, No. 9
Laboratory of Virology, Istituto Superiore di
Sanità, Rome, Italy,1 and
Laboratoire de Virologie et Immunologie Expérimentales,
Unitée Associée à l'INRA, Faculté de
Pharmacie, Châtenay-Malabry, France2
Received 22 February 1999/Accepted 1 June 1999
We investigated the role of the constitutive nitric oxide (NO) in
the expression of interferon (IFN) genes in mouse peritoneal macrophages (PM). The treatment of PM with
L-arginine-NG-amine (AA), a potent
inhibitor of NO-producing enzymes, resulted in a marked accumulation of
IFN- Nitric oxide (NO), a free-radical
gas, acts as an intra- and extracellular messenger in most mammalian
organs (28). Many cell types are capable of producing NO
through the enzymatic conversion of L-arginine to
L-citrulline by NO synthase (NOS). Three isoforms of NOS
have been isolated. NOS 2 was primarily cloned in macrophages, and NOSs
1 and 3 were cloned in brain neuron and endothelial cells, respectively. NOS 1 and 3 activities are dependent on elevated Ca2+ and are generally considered as constitutive. NOS 2 is
inducible by a variety of cytokines and bacterial products and does not depend on elevated Ca2+ (8, 28). NO is an
important regulator and mediator of a wide range of physiological
processes, including blood vessel relaxation, neurotransmission,
inflammation, apoptosis, and macrophage-mediated cytotoxicity for
microbes and tumor cells (28, 48). Over the past few years,
several reports have also demonstrated that NO plays an important role
in host defense against virus infections (38, 48). In spite
of its beneficial effect in maintaining the immunological homeostasis,
NO has also been implicated in disease pathogenesis in a variety of
inflammatory syndromes, as well as in viral infections (1,
48). In fact, high levels of NO or NOS 2 expression have been
found in inflammatory tissues at or around lesion sites in several
systems (10, 13, 38). Moreover, direct evidence of a role
for NO in virus-associated pathology has also been provided (1,
22).
Macrophages are generally considered to be important elements in
natural resistance against infection (33). These cells are
intimately related to the interferon (IFN) system, and the existence of
a so-called "IFN-macrophage alliance" has been postulated (33). During viral infection, macrophages are among the
first cells in any organ to be exposed to the intruders and are
generally considered to be the major producers of alpha/beta IFN
(IFN- Mice.
Specific-pathogen-free 3-week-old Swiss female mice
(weight, 20 to 22 g) were purchased from Charles River, Italia,
S.P.A. (Milan, Italy) and used within 5 days. Mice were housed in cages at 20°C and had access to food and water ad libitum.
Reagents.
RPMI 1640 medium (M. A. Bioproducts,
Walkersville, Md.) was supplemented with penicillin (100 U/ml),
streptomycin (100 µg/ml), L-glutamine (2 mM), and 10%
heat-inactivated fetal calf serum (FCS) and used as the cell culture
medium. All tissue culture reagents were purchased as endotoxin-free
lots, as assessed by the Limulus amebocyte assay.
L-Arginine-NG-amine (AA) and
NG-mono-methyl-L-arginine (NMMA)
were provided by Sigma (Milan, Italy).
Carboxyphenyl-tetramethylimidazoline-oxyl-oxide (carboxy-PTIO) was
obtained from Calbiochem-Inalco S.P.A. (Milan, Italy). Oxyhemoglobin was kindly provided by B. Bohn (Hôpital Bicêtre, Paris, France).
PM cultures.
PM were harvested by washing the peritoneal
cavity with RPMI 1640 containing 10% FCS and then were seeded in
plastic dishes. After 2 h, nonadherent cells were removed by two
washes with medium. PM were then maintained in culture for 24 h in
RPMI 1640 containing 10% FCS. Experiments were undertaken when the
cells were firmly adherent to the culture wells after a vigorous
washing. More than 95% of the cells stained for nonspecific esterase
and were positive in immunofluorescence studies with a rat monoclonal
antibody (F4/80) that was specific for mouse macrophages, as previously
described (5).
Semiquantitative RNA-PCR.
Total cellular RNA, prepared by
the method of Chirgwin et al. (6), was reverse transcribed
and amplified as previously described (36), except that the
oligonucleotide sense primer was labeled with
[
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Inhibitory Activity of Constitutive Nitric Oxide on
the Expression of Alpha/Beta Interferon Genes in Murine
Peritoneal Macrophages
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
4 mRNA and, to a minor extent, of IFN-
mRNA. In contrast, the
expression of IFN-
mRNA, as well as tumor necrosis factor alpha and
interleukin-6 mRNA, was not affected. Furthermore, a remarkable
increase in the expression of the IFN regulating factor 1 (IRF-1), but
not of IRF-2, mRNA was detected in AA-treated PM. To investigate
whether the AA-induced activation of the IFN system correlates with the
production and antiviral activity of IFN, the extent of
encephalomyocarditis virus (EMCV) replication was monitored in
AA-treated PM with respect to control cultures. AA treatment strongly
inhibited, in a dose-dependent manner, EMCV yields in PM. Likewise,
similar results were obtained by the addition of the NO-scavenger
carboxyphenyl-tetramethylimidazoline-oxyl-oxide. In addition,
inhibition of NO synthesis by
NG-mono-methyl-L-arginine in PM
strongly decreased virus replication in coculture of PM and
EMCV-infected L929 cells, whereas no antiviral effect was observed in
L929 cells alone. Moreover, the AA-mediated antiviral activity was
abrogated in the presence of antibody to IFN-
/
, whereas antibody
to IFN-
was completely ineffective. Taken together, these results
indicate that low levels of NO, constitutively released by resting PM,
negatively regulate the expression and activity of IFN-
/
in PM.
We suggest that NO acts as a homeostatic agent in the regulation of IFN
pathway expression in macrophages.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
/
) soon after infection (33). In addition,
several studies performed by our group over the years have revealed
that low levels of IFN-
are spontaneously expressed in resting mouse
peritoneal macrophages (PM) and are responsible for the natural
antiviral state of these cells (5, 35). The IFN-
-mediated
antiviral state of freshly harvested PM is progressively lost when
these cells are maintained in vitro for a few days (11). In
the present study, we provide evidence that endogenous NO,
constitutively expressed in PM, acts as a negative regulator of IFN
system expression. In fact, neutralization of endogenous NO by using
specific NOS inhibitors, results in an increased expression of IFN-
4
and IFN-
mRNA. Moreover, the expression of an IFN-inducible gene,
such as IFN regulatory factor 1 (IRF-1), is positively regulated upon
NO inhibition. The activation of IFN system induced by NO inhibition
correlates with an increased resistance of PM to encephalomyocarditis
virus (EMCV) infection. This resistance is abrogated in the presence of
antibody to IFN-
/
. Taken together, these results indicate that
low levels of NO, constitutively released by resting PM, negatively
regulate the expression and activity of IFN-
/
in PM. We suggest
that NO acts as a homeostatic agent in the regulation of IFN pathway
expression in macrophages.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-32P]ATP and Taq polymerase was
neutralized by a TaqStart antibody (Clontech) before use in order to
enhance the specificity and sensitivity of the PCR amplification. For
IRF-mRNA analysis, cold primers were used.
, tumor necrosis
factor alpha [TNF-
], interleukin-6 [IL-6], IRF-1, and IRF-2) to
35 (for IFN-
4 and IFN-
) repeated cycles of denaturation for
40 s at 90°C, primer annealing for 40 s at 62°C, and
extension for 60 s at 72°C. A negative control lacking template
RNA or reverse transcriptase was included in each experiment. The PCR
products were run together with a
[
-32P]ATP-labelled-DNA molecular-weight marker (Marker
VI; Boehringer Manheim) on a 5% acrylamide-polyacrylamide (proportion,
29/1) gel. After being dried at 80°C in a dryer, the gel was analyzed with an electronic autoradiography system. Instant Imager (Packard), that allows quantification of labeled PCR products in counts per minute. For RNA quantification, the amount of mRNA corresponding to
IFN-
and IFN-
4 present in each sample was normalized to the constitutive stable expression of GAPDH-mRNA. Values are given as the
IFN/GAPDH ratio. Gels were then exposed on a photographic plate. For
IRF, PCR products were run on agarose gel containing ethidium bromide
together with a DNA molecular-weight marker (
X174; Finnzymes).
4 sense primer
CTCAAAGCCTGTGTGATGC and antisense primer
AAGACAGGGCTCTCCAGAC, IFN-
sense primer
CCATCCAAGAGATGCTCCAG and antisense primer
GTGGAGAGCAGTTGAGGACA, IFN-
sense primer
AACGCTACACACTGCATCTTGG and antisense primer GACTTCAAAGAGTCTGAGG, IRF-1 sense primer
CAGAGGAAAGAGAGAAAGTCC and antisense primer
CACACGGTGACAGTGCTGG, IRF-2 sense primer
CAGTTGAGCATCTTTGGGGC and antisense primer
TGGTCATCACTCTCAGTGG, TNF-
sense primer
GATCTCAAAGACAACCAACTAGTG and antisense primer
CTCCAGCTGGAAGACTCCTCCCAG, and IL-6 sense primer
ATGATGGATGCTAACAAACTGG and antisense primer GATGGATTGGATGGTCTTGG.
Primer sense labeling.
Labeling of oligonucleotides sense
primers consisted of 45 min of incubation at 37°C of the following
mixture prepared for 10 samples: 110 ng of primer sense, 10 U of T4
polynucleotide kinase (New England Biolabs), 25 µCi of
[
-32P]ATP (Amersham), 70 mM Tris-HCl (pH 7.6), 10 mM
MgCl2, and 5 mM dithiothreitol, for a final volume of 100 µl. Oligonucleotide was then precipitated by adding 10 µl of 3 M
sodium acetate (pH 5.2) and 300 µl of absolute ethanol. After
centrifugation at 14,000 rpm for 15 min at 4°C, the supernatant was
removed, and 500 µl of 70% ethanol was added. After a further
centrifugation in the same conditions, the supernatant was carefully
discarded. The oligonucleotide pellet was air dried at room temperature
for 10 min, resuspended in water, and dissolved at 37°C for 15 min.
At this point the oligonucleotide was ready for use for PCR.
Infection of PM with EMCV and titration of virus yields.
After a 24-h culture, PM were infected with EMCV in RPMI 1640 supplemented with 2% inactivated FCS at a multiplicity of infection (MOI) of 1. After 1 h of adsorption the cells were washed twice with medium and then incubated in RPMI 1640 containing 2% FCS. Cell
supernatants were harvested 48 h later, clarified by
centrifugation, and stored at
80°C. The titers of virus yields were
determined as previously described (5).
Coculture of EMCV-infected L929 cells and PM.
Confluent L929
cells were infected by EMCV (MOI = 10
5) in RPMI with
2% FCS. After 1 h of adsorption, the cells were washed with Hanks
balanced salt solution, trypsinized and resuspended in RPMI with 2%
FCS. Infected L929 cells (L-EMCV) (3 × 105 cells/ml)
were added to 24-h cultures of PM. After 24 h of incubation, duplicate samples of L-EMCV or L-EMCV plus PM were scraped off with a
rubber policeman, harvested with culture fluids, pooled, and stored at
80°C. The samples were frozen and thawed once, sonicated for 2 min
at 47 kHz in an ultrasonic cleaner (Bransonic B-1200 E1), clarified by
centrifugation (1,250 × g, 10 min), and titrated for
intra- and extracellular EMCV yields as described above. In parallel,
cocultures of L929 cells and PM were performed as a control for
cytotoxic activity of PM against uninfected cells and evaluated by a
photometric method (16).
IFN assay.
The biological IFN assay was based on the
protection of L929 cells against the cytopathic effect of vesicular
stomatitis virus (VSV). Serial twofold dilutions of the supernatants
were transferred to 24-h semiconfluent monolayers of L929 cells in a
96-well plate. Supernatants were removed 24 h later, and VSV was
added to each well (80 infectious particles/well). After 48 h the
cytopathic effect was evaluated by a photometric method
(16). IFN titers were adjusted to a laboratory standard IFN
preparation that was calibrated against an international standard for
IFN-
.
Antibodies to mouse IFNs.
Antiserum to mouse IFN-
was
provided by HyCult Biotechnology (Uden, The Netherlands). The origin of
the partially purified sheep immunoglobulin to mouse IFN-
/
(neutralizing titer of 6.4 × 106 against 4 U of mouse
IFN-
/
) has been described in detail elsewhere (5).
Titration of NO.
NO release was assayed by nitrites
(NO2
) titration: 100-µl samples in
duplicate in a 96-well microtiter plate (Falcon) were reacted with 200 µl of the Griess reagent prepared by mixing equal volumes of
sulfanilamide (1% in 1.2 N HCl) and
N-(1-naphtyl)ethylenediamine (0.3% in H2O)
(Sigma). After 30 min of shaking in the dark, the absorbance at 550 nm
was measured, and the nitrite concentration was determined by using a
curve calibrated with NaNO2 standards.
Statistical analysis. Statistical analysis of data was performed by using the Kruskall-Wallis test.
| |
RESULTS |
|---|
|
|
|---|
Effect of NO synthesis inhibition on the expression of IFN and
IFN-inducible genes.
In preliminary experiments, we measured the
level of NO in PM cultures. As detected by nitrite titration, a low
level of NO (i.e., 0.8 ± 0.1 µM) was found in the cell
supernatants after 24 h of culture. To investigate whether this
low secretion of NO could have some role in the regulation of IFN gene
expression, the steady-state levels of IFN transcripts were analyzed by
RNA-PCR in cultures treated with a specific NO inhibitor (i.e., AA). As shown in Fig. 1A, control PM did not
express detectable levels of IFN-
4 mRNA, but this transcript
markedly accumulated after AA treatment. In contrast, the same
treatment resulted in only a modest increase in IFN-
mRNA expression
that was constitutively expressed in control PM. Quantification of the
PCR products shown in Fig. 1A revealed that the steady-state levels of
IFN-
mRNA was slightly increased (fold increase, 2.2) after AA
treatment (IFN-
/GAPDH control PM, 2.6; AA-treated PM, 5.2), whereas
a marked induction (fold increase, 42) of IFN-
4 was observed under
the same experimental conditions (IFN-
4/GAPDH control PM, 0.031; AA-treated PM, 1.3). To investigate whether the effect of AA was specific for IFN-
/
, we also analyzed the expression of IFN-
, TNF-
, and IL-6 mRNA in AA-treated cultures. No IFN-
mRNA was detected with or without AA treatment (data not shown). In addition, as
shown in Fig. 1A, no changes in the expression of TNF-
and IL-6
mRNAs were detected in the presence of AA. Experiments were then
performed to establish whether other factors involved in the regulation
of IFN gene expression were also modulated by the inhibition of NO
synthesis. We thus analyzed the expression of IRF-1 and -2 that act as
activator and repressor, respectively, of the transcription of target
genes involved in the biological response to IFN (34). As
shown in Fig. 1B, a strong accumulation of IRF-1 mRNA was observed in
PM cultured in the presence of AA, whereas the expression of IRF-2 mRNA
was not affected.
|
Effect of NO inhibitors on the replication of EMCV in PM.
We
then carried out a series of experiments to determine whether AA
treatment resulted in some secretion of IFN in the culture medium. In
spite of the remarkable effect of AA on the expression of IFN-
4 and
IFN-
mRNA expression, we failed to detect any IFN-
/
secretion
in supernatants of AA-treated PM (data not shown). Since undetectable
levels of IFN-
/
are sufficient to induce an antiviral state in
macrophages (5, 12, 35), we investigated the effect of AA on
the replication of EMCV. As shown in Fig.
2A, AA exerted an antiviral activity in a
dose-dependent manner, with maximal activity at a concentration of
1,000 µM. This AA dose did not result in any toxic effect on cell
viability (data not shown). Similar antiviral activity was obtained in
the presence of a different NO inhibitor, the carboxy-PTIO (Fig. 2B), a
scavenger molecule that oxidizes NO to NO2
in a
stoichiometric manner and completely abolishes its biological activity
(29). We have previously shown that resident PM harvested from different strains of mice are naturally resistant to the infection
by several animal viruses (5). This natural antiviral state
of PM is largely mediated by IFN-
production and is acquired during
mouse development (14). In addition, the resistance of PM to
viral infection is progressively lost during in vitro culture (35). We thus carried out experiments in which PM were
treated with AA and infected with EMCV at different times of in vitro culture. As shown in Fig. 2C, AA exerted a strong antiviral activity on
PM independently of the time of culture. In all experiments, no
variation of the low constitutive production of NO in PM was observed
upon virus infection (data not shown).
|
PM treated with NMMA confer an antiviral state to EMCV when cocultured with L929 cells. As shown in Fig. 3, the treatment with NMMA, a specific inhibitor of NO synthesis, did not result in any inhibition of EMCV replication in L929 mouse cells. Similar results were also obtained by using NG-nitro-L-arginine or the oxyhemoglobin (300 µM), a potent NO scavenger (data not shown), as NOS inhibitors. These results indicated that NOS inhibition did not induce IFN production in any type of cells, suggesting that a specific pattern of regulation may occur in macrophages. The cocultivation of L929 cells with freshly harvested PM resulted in a slight reduction of EMCV yield compared to control cultures. Previous studies had shown that the capability of PM to transfer an antiviral state to L929 cells was due to the production of low level of IFN (35). Interestingly, when the coculture was performed in the presence of NMMA there was a much stronger reduction of EMCV yield.
|
The AA-induced antiviral state of resident PM is abolished by
antibody to IFN-
/
.
In order to establish whether the
antiviral effect exhibited by AA in PM was mediated by IFN, we carried
out experiments in the presence of specific antibodies to IFNs. As
shown in Fig. 4, the addition of antibody
to IFN-
/
completely abolished the AA-induced antiviral effect. In
contrast, antibody to IFN-
was ineffective.
|
| |
DISCUSSION |
|---|
|
|
|---|
It has been extensively described that NO can act as a positive
and/or negative regulator of the cytokine network (30). In
this regard, interactions between the IFN system and NO pathway have
also been clearly established. In particular, several reports demonstrated that the NO pathway can be positively regulated by both
IFN-
/
(39, 46, 47) and
-IFN (41, 47) in
murine macrophages. However, it appears that a pretreatment of cells with IFN-
and/or IFN-
counteracts the induction of NO production in activated macrophages (7, 26). In contrast, only a few reports have described the capacity of NO to regulate IFNs expression. Ito and coworkers (19, 20) described the inhibitory effect of various NO-releasing agents on the NK cell activity of nonadherent human peripheral blood mononuclear cells against cytomegalovirus or
varicella-zoster virus-infected fibroblasts. This inhibitory effect was
related to a reduced production of IFN-
by CD16
HLA-DR+ cells (20). A number of studies also
showed that NO, endogenously produced or exogenously supplied,
inhibited IFN-
production in stimulated splenocytes or T cells
(4, 42). Furthermore, pulmonary leukocytes from
NOS2
/
knockout mice infected with influenza virus have
been shown to produce higher levels of IFN-
than wild-type cells
(22).
In the present study, we provide evidence that low levels of endogenous
NO, constitutively produced by PM, exert a negative control on the
expression of IFN-
and, to a lesser extent, of IFN-
mRNA in PM.
This correlates with a downregulation of IFN-
/
production and
activity as shown by the antiviral effect of NOS inhibitors on PM and
its inhibition by an anti-IFN-
/
serum. Our results suggest that
the inhibitory effect of NO was specific for IFN-
/
. In fact, NO
inhibition did not induce any upregulation of IFN-
mRNA expression
(data not shown). Similarly, the antiviral activity induced upon NOS
inhibition was not related to IFN-
production since antibody to
IFN-
did not affect this activity. Furthermore, we failed to detect
any modification of the steady-state levels of some proinflammatory
cytokine mRNA, such as TNF-
and IL-6. Our results also indicate that
IFN-
and IFN-
4 mRNA expression is affected differently by NO. In
this regard, it is of interest to mention that although IFN-
and
IFN-
4 promoters show striking sequence similarities, they also
exhibit differences in their transcriptional regulation. In fact, it
has been reported that different pathways mediate virus inducibility of
the human IFN-
1 and IFN-
genes (27). Moreover, it has
been shown that the transcription factor NF-
B is involved in the
transcriptional regulation of IFN-
but not of IFN-
genes
(25, 43). On the other hand, the IFN-
1 promoter contains
at least one novel virus-responsive element, the "TG sequence,"
that differs from PRDI and NF-
B binding sequences responsible for
IFN-
promoter induction (27).
IRF-1 is a transcriptional factor implicated in the positive regulation
of both IFN-
(3, 9, 32) and IFN-
(9, 18,
32) gene expression. IRF-2 was identified as a suppressor of the
activity of IRF-1 on IFN-
promoter (18). On the other hand, IRF-1 is involved in the positive control of the promoter expression of iNOS (NOS 2), the inducible form of NOS (31). Interestingly, macrophages from mice with a targeted disruption of
IRF-1 produce little or no NO and synthesize barely detectable levels
of iNOS mRNA in response to stimulation (21). In the present
study, we show that the inhibition of constitutive NO synthesis results
in the specific upmodulation of mRNA for IRF-1 but not for IRF-2 in PM.
In light of these results, we suggest that the IFN mRNA accumulation
observed upon NOS inhibition could be due, at least in part, to the
transcriptional activity of IRF-1. Further studies are needed to define
the role of this transcription factor in the NO-mediated regulation of
IFN upregulation, as well as the involvement of additional factors.
In recent years, the importance of NO in the host antiviral defense, as
well as in the pathogenesis of various viral diseases has been
increasingly recognized (1, 48). Our study here represents
the first example of a negative regulation of IFN-
/
by endogenous
NO in macrophages. A physiologic role for such a pathway could be to
limit not only the basal level of IFN synthesis but also the induced
high level of IFN production during the response to pathogens. This
regulatory loop could be beneficial in preventing toxic effects due to
an excess of IFN. In this regard, trehalose dimycolate (TDM), a
glycolipid from Mycobacterium tuberculosis, injected in mice
induces a high level of IFN in PM (15, 16), and this
production was shown to be also enhanced upon in vitro treatment with
inhibitors of NO (data not shown). Of particular interest is the fact
that TDM-treated PM are also stimulated to produce substantial level of
NO (17), which raises the possibility that NO-mediated
negative regulation of IFN pathway occurs even during an inducible high
output of NO. In this regard, inhibitors of NOSs have been used
extensively to limit the damages provoked by a high production of NO in
virus-infected animals (1, 2, 22-24, 40, 44). Therefore, a
side effect of these treatments could be the activation of the IFN
response. This could result in the decrease of virus spread but also in
some deleterious toxicity of the overproduced IFN and thus suggests
that the use of NO inhibitors as therapeutic agents should be
contemplated cautiously.
In conclusion, in the light of our data, we can envisage the following
pathway. (i) In physiological conditions, the constitutive NO released
by resting macrophages maintains at a low level the expression of
IFN-
/
genes. (ii) During the response to pathogens and
inflammatory process leading to high production of NO, the same
regulation pathway takes place to control the overproduction of IFN,
thus avoiding its detrimental effects. Therefore, NO appears as a
homeostatic agent for the regulation of IFN-mediated immune responses.
The discovery of this regulatory loop between IFN and NO in macrophages
adds novel insights to our understanding of the regulation of
macrophage functions in the immune response to environmental stimuli. A
perspective of particular interest will be to investigate the relevance
of this pathway in human monocytes, which have been shown to express
both the inducible and constitutive isoforms of NOS (37,
45).
| |
ACKNOWLEDGMENTS |
|---|
We thank Sabrina Tocchio, Istituto Superiore di Sanità, Rome, Italy, for excellent editorial assistance. We are indebted to Stefano Belli for help with the statistical analysis. We also thank Stefania Mochi, Laboratory of Virology, Istituto Superiore di Sanità, for oligonucleotide synthesis.
E.G. was the recipient of a fellowship from the Istituto Superiore di Sanità.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Laboratory of Virology, Istituto Superiore di Sanità, Viale Regina Elena 299, 00161 Rome, Italy. Phone: (3906) 49903169. Fax: (3906) 49387184. E-mail: gessani{at}virus1.net.iss.it.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Akaike, T., M. Suga, and H. Maeda. 1998. Free radicals in viral pathogenesis: molecular mechanisms involving superoxide and NO. PSEBM (Proc. Soc. Exp. Biol. Med.) 217:64-73[Medline]. |
| 2. |
Akaike, T.,
Y. Noguchi,
S. Ijiri,
K. Setoguchi,
M. Suga,
Y. M. Zheng,
B. Dietzschold, and H. Maeda.
1996.
Pathogenesis of influenza virus-induced pneumonia: involvement of both nitric oxide and oxygen radicals.
Proc. Natl. Acad. Sci. USA
93:2448-2453 |
| 3. |
Au, W.-C.,
Y. Su,
N. B. Raj, and P. M. Pitha.
1993.
Virus-mediated induction of interferon A gene requires cooperation between multiple binding factors in the interferon- promoter region.
J. Biol. Chem.
268:24032-24040 |
| 4. | Bauer, H., T. Jung, D. Tsikas, D. O. Stichtenoth, J. C. Frölich, and C. Neumann. 1997. Nitric oxide inhibits the secretion of T-helper 1- and T-helper 2-associated cytokines in activated human T cells. Immunology 90:205-211[Medline]. |
| 5. |
Belardelli, F.,
F. Vignaux,
E. Proietti, and I. Gresser.
1984.
Injection of mice with antibody to interferon renders peritoneal macrophages permissive for vesicular stomatitis virus and encephalomyocarditis virus.
Proc. Natl. Acad. Sci. USA
81:602-606 |
| 6. | Chirgwin, J. M., A. E. Przybyla, R. J. MacDonald, and W. J. Rytter. 1979. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18:5294-5299[Medline]. |
| 7. | Deguchi, M., K. Inaba, and S. Muramatsu. 1995. Counteracting effect of interferon-gamma-induced production of nitric oxide which is suppressive for antibody response. Immunol. Lett. 45:157-162[Medline]. |
| 8. |
Forstermann, U.,
J. P. Boissel, and H. Kleinert.
1998.
Expressional control of the "constitutive" isoforms of nitric oxide synthase (NOS I and NOS III).
FASEB J.
12:773-790 |
| 9. |
Fujita, T.,
Y. Kimura,
M. Miyamoto,
E. L. Barsoumian, and T. Taniguchi.
1989.
Induction of endogenous IFN- and IFN- genes by a regulatory transcription factor, IRF-1.
Nature
337:270-272[Medline].
|
| 10. | Gendelman, H. E., J. Zheng, C. L. Coulter, A. Ghorpade, M. Che, M. Thylin, R. Rubocki, Y. Persidsky, F. Hahn, J. Reinhard, Jr., and S. Swindells. 1998. Suppression of inflammatory neurotoxins by highly active antiretroviral therapy in human immunodeficiency virus-associated dementia. J. Infect. Dis. 178:1000-1007[Medline]. |
| 11. |
Gessani, S.,
C. W. Dieffenbach,
L. Conti,
P. Di Marzio,
K. L. Wilson, and F. Belardelli.
1993.
Selective alteration of the turnover of interferon mRNA in peritoneal macrophages from LPS-hyporesponsive mice and its role in the defective expression of spontaneous interferon.
Virology
193:507-509[Medline].
|
| 12. |
Gessani, S.,
P. Puddu,
B. Varano,
P. Borghi,
L. Conti,
L. Fantuzzi, and F. Belardelli.
1994.
Induction of beta interferon by human immunodeficiency virus type 1 and its gp120 protein in human monocytes-macrophages: role of beta interferon in restriction of virus replication.
J. Virol.
68:1983-1986 |
| 13. | Giovannoni, G., R. F. Miller, S. J. Heales, J. M. Land, M. J. Harrison, and E. J. Thompson. 1998. Elevated cerebrospinal fluid and serum nitrate and nitrite levels in patients with central nervous system complications of HIV-1 infection: a correlation with blood-brain-barrier dysfunction. J. Neurol. Sci. 156:53-58[Medline]. |
| 14. | Gresser, I., C. Maury, T. Kaido, M. T. Bandu, M. G. Tovey, M. T. Maunoury, L. Fantuzzi, S. Gessani, G. Greco, and F. Belardelli. 1995. The essential role of endogenous IFN alpha/beta in the anti-metastatic action of sensitized T lymphocytes in mice injected with Friend erythroleukemia cells. Int. J. Cancer 63:726-731[Medline]. |
| 15. |
Guillemard, E.,
M. Geniteau-Legendre,
B. Mabboux,
I. Poilane,
R. Kergot,
G. Lemaire,
J. F. Petit,
C. Labarre, and A. M. Quero.
1993.
Antiviral action of trehalose dimycolate against EMC virus: role of macrophages and interferon / .
Antiviral Res.
22:201-213[Medline].
|
| 16. |
Guillemard, E.,
M. Geniteau-Legendre,
R. Kergot,
G. Lemaire,
J. F. Petit,
C. Labarre, and A. M. Quero.
1995.
Role of TDM-induced interferon / in the restriction of EMC virus growth in vivo and in peritoneal macrophage cultures.
Antiviral Res.
28:175-189[Medline].
|
| 17. |
Guillemard, E.,
M. Geniteau-Legendre,
R. Kergot,
G. Lemaire,
S. Gessani,
C. Labarre, and A.-M. Quero.
1998.
Simultaneous Production of IFN- , IFN- / and Nitric Oxide in Peritoneal Macrophages from TDM-Treated Mice.
J. Biol. Regul. Homeostatic Agents
12:67-75.
|
| 18. | Harada, H., T. Fujita, M. Miyamoto, Y. Kimura, M. Maruyama, A. Furia, T. Miyata, and T. Taniguchi. 1989. Structurally similar but functionally distinct factors, IRF-1 and IRF-2, bind to the same regulatory elements of IFN and IFN-inducible genes. Cell 58:729-739[Medline]. |
| 19. | Ito, M., M. Watanabe, H. Kamiya, and M. Sakurai. 1996. Inhibition of natural killer (NK) cell activity against varicella-zoster virus (VZV)-infected fibroblasts and lymphocyte activation in response to VZV antigen by nitric oxide-releasing agents. Clin. Exp. Immunol. 106:40-44[Medline]. |
| 20. | Ito, M., M. Watanabe, H. Kamiya, and M. Sakurai. 1996. Inhibition of natural killer cell activity against cytomegalovirus-infected fibroblasts by nitric oxide-releasing agents. Cell. Immunol. 174:13-18[Medline]. |
| 21. |
Kamijo, R.,
H. Harada,
T. Matsuyama,
M. Bosland,
J. Gerecitanoshapiro,
J. Le,
S. I. Koh,
T. Kimura,
S. J. Green,
T. W. Mak,
T. Taniguchi, and J. Vilcek.
1994.
Requirement for transcription factor IRF-1 in NO synthase induction in macrophages.
Science
263:1612-1615 |
| 22. |
Karupiah, G.,
J. H. Chen,
S. Mahalingam,
C. F. Nathan, and J. D. MacMicking.
1998.
Rapid interferon gamma-dependent clearance of influenza A virus and protection from consolidating pneumonitis in nitric oxide synthase 2-deficient mice.
J. Exp. Med.
188:1541-1546 |
| 23. | Kreil, T. R., and M. M. Eibl. 1996. Nitric oxide and viral infection: no antiviral activity against a flavivirus in vitro, and evidence for contribution to pathogenesis in experimental infection in vivo. Virology 219:304-306[Medline]. |
| 24. | Lane, T. E., A. D. Paoletti, D. Paoletti, and M. J. Buchmeier. 1997. Disassociation between the in vitro and in vivo effects of nitric oxide on a neurotropic murine coronavirus. J. Virol. 71:2202-2210[Abstract]. |
| 25. |
Lenardo, M. J.,
C.-M. Fang,
T. Maniatis, and D. Baltimore.
1989.
The involvement of NF- B in -interferon gene regulation reveals its role as widely inducible mediator of signal transduction.
Cell
57:287-294[Medline].
|
| 26. |
Lòpez-Collazo, E.,
S. Hortelano,
A. Rojas, and L. Bosca.
1998.
Triggering of peritoneal macrophages with IFN- / attenuates the expression of inducible nitric oxide synthase through a decrease in NF- B activation.
J. Immunol.
160:2889-2895 |
| 27. |
MacDonald, N. J.,
D. Kuhl,
D. Maguire,
D. Naf,
P. Gallant,
A. Goswammy,
H. Hug,
H. Büeler,
M. Chaturvedi,
J. de la Fuente, and C. Weissman.
1990.
Different pathways mediate virus inducibility of the human IFN- 1 and IFN- genes.
Cell
60:767-779[Medline].
|
| 28. | MacMicking, J., Q. W. Xie, and C. Nathan. 1997. Nitric oxide and macrophage function. Annu. Rev. Immunol. 15:323-350[Medline]. |
| 29. | Maeda, H., T. Akaike, M. Yoshida, and M. Suga. 1994. Multiple function of nitric oxide in pathophysiology and microbiology: analysis by a new nitric oxide scavenger. J. Leukoc. Biol. 56:588-592[Abstract]. |
| 30. | Marcinkiewicz, J. 1997. Regulation of cytokine production by eicosanoids and nitric oxide. Arch. Immunol. Ther. Exp. 45:163-167. |
| 31. |
Martin, E.,
C. Nathan, and Q.-W. Xie.
1994.
Role of interferon regulatory factor 1 in induction of nitric oxide synthase.
J. Exp. Med.
180:977-984 |
| 32. |
Miyamoto, M.,
T. Fujita,
Y. Kimura,
M. Maruyama,
H. Harada,
Y. Sudo,
T. Miyata, and T. Taniguchi.
1988.
Regulated expression of a gene encoding a nuclear factor, IRF-1 that specifically binds to IFN- gene regulatory elements.
Cell
54:903-913[Medline].
|
| 33. | Mogensen, S. C., and J. L. Virelizier. 1987. The interferon-macrophage alliance. Interferon 8:55-84[Medline]. |
| 34. | Nguyen, H., J. Hiscott, and P. M. Pitha. 1997. The growing family of interferon regulatory factors. Cytokine Growth Factor Rev. 8:293-312[Medline]. |
| 35. |
Proietti, E.,
S. Gessani,
F. Belardelli, and I. Gresser.
1986.
Mouse peritoneal cells confer an antiviral state on mouse cell monolayers: role of interferon.
J. Virol.
57:456-463 |
| 36. |
Puddu, P.,
L. Fantuzzi,
P. Borghi,
B. Varano,
G. Rainaldi,
E. Guillemard,
W. Malorni,
P. Nicaise,
S. F. Wolf,
F. Belardelli, and S. Gessani.
1997.
IL-12 induces IFN- expression and secretion in mouse peritoneal macrophages.
J. Immunol.
159:3490-3497[Abstract].
|
| 37. | Reiling, N., A. J. Ulmer, M. Duchrow, M. Ernst, H.-D. Flad, and S. Hauschildt. 1994. Nitric oxide synthase: mRNA expression of different isoforms in human monocytes/macrophages. Eur. J. Immunol. 24:1941-1944[Medline]. |
| 38. |
Reiss, C. S., and T. Komatsu.
1998.
Does nitric oxide play a critical role in viral infections?
J. Virol.
72:4547-4551 |
| 39. |
Riches, D. W. H.
1991.
Expression of interferon- during the triggering phase of macrophage cytocidal activation.
J. Biol. Chem.
266:24785-24792 |
| 40. | Rose, J. W., K. E. Hill, Y. Wada, C. I. B. Kurtz, I. Tsunoda, R. S. Fujinami, and A. H. Cross. 1998. Nitric oxide synthase inhibitor, aminoguanidine, reduces inflammation and demyelination produced by Theiler's virus infection. J. Neuroimmunol. 81:82-89[Medline]. |
| 41. | Stuehr, D. J., and M. A. Marletta. 1987. Induction of nitrite/nitrate synthesis in murine macrophages by BCG infection, lymphokines, or interferon-gamma. J. Immunol. 139:518-525[Abstract]. |
| 42. | Taylor-Robinson, A., F. Y. Liew, A. Severn, D. Xu, S. J. McSorley, P. Garside, J. Padron, and R. S. Phillips. 1994. Regulation of the immune response by nitric oxide differentially produced by T helper type 1 and T helper type 2 cells. Eur. J. Immunol. 24:980-984[Medline]. |
| 43. |
Visvanathan, K. V., and S. Goodbourn.
1989.
Double-stranded RNA activates binding of NF-![]() to an inducible element in the human -interferon promoter.
EMBO J.
8:1129-1138[Medline].
|
| 44. |
Wang, W. Z.,
A. Matsumori,
T. Yamada,
T. Shioi,
I. Okada,
S. Matsui,
Y. Sato,
H. Suzuki,
K. Shiota, and S. Sasayama.
1997.
Beneficial effect of amlodipine in a murine model of congestive heart failure induced by viral myocarditis. A possible mechanism through inhibition of nitric oxide production.
Circulation
95:245-251 |
| 45. |
Weinberg, J. B.,
M. A. Misukonis,
P. J. Shami,
S. N. Mason,
D. L. Sauls,
W. A. Dittman,
E. R. Wood,
G. K. Smith,
B. McDonald,
K. E. Bachus,
A. F. Haney, and D. L. Granger.
1995.
Human mononuclear phagocyte inducible nitric oxide synthase (iNOS): analysis of iNOS mRNA, iNOS protein, biopterin, and nitric oxide production by blood monocytes and peritoneal macrophages.
Blood
86:1184-1195 |
| 46. |
Zhang, X.,
E. W. Alley,
S. W. Russel, and D. C. Morrison.
1994.
Necessity and sufficiency of beta interferon for nitric oxide production in mouse peritoneal macrophages.
Infect. Immun.
62:33-40 |
| 47. |
Zhou, A.,
Z. Chen,
J. A. Rummage,
H. Jiang,
M. Kolosov,
I. Kolosova,
C. H. Stewart, and R. W. Leu.
1995.
Exogenous interferon- induces endogenous synthesis of interferon- and - by murine macrophages for induction of nitric oxide synthase.
J. Interferon Cytokine Res.
15:897-904[Medline].
|
| 48. | Zidek, Z., and K. Masek. 1998. Erratic behavior of nitric oxide within the immune system: illustrative review of conflicting data and their immunopharmacological aspects. Int. J. Immunopharmacol. 20:319-343[Medline]. |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»