Previous Article | Next Article ![]()
Journal of Virology, September 1999, p. 7287-7296, Vol. 73, No. 9
Department of Cell Biology and Anatomy,
Cornell University Medical College, New York, New York
10021,1 and Department of Microbiology
and Molecular Genetics, Medical College of Wisconsin, Milwaukee,
Wisconsin 532262
Received 8 April 1999/Accepted 17 May 1999
Vaccinia virus encodes two protein kinases (B1 and F10) and a
dual-specificity phosphatase (VH1), suggesting that phosphorylation and
dephosphorylation of substrates on serine/threonine and tyrosine residues are important in regulating diverse aspects of the viral life
cycle. Using a recombinant in which expression of the H1 phosphatase
can be regulated experimentally (vindH1), we have previously demonstrated that repression of H1 leads to the maturation of noninfectious virions that contain several hyperphosphorylated substrates (K. Liu et al., J. Virol. 69:7823-7834). In this
report, we demonstrate that among these is a 25-kDa protein that is
phosphorylated on tyrosine residues in H1-deficient virions and can be
dephosphorylated by recombinant H1. We demonstrate that the 25-kDa
phosphoprotein represents the product of the A17 gene and that A17 is
phosphorylated on serine, threonine, and tyrosine residues during
infection. Detection of phosphotyrosine within A17 is abrogated when
Tyr203 (but not Tyr3, Tyr6, or
Tyr7) is mutated to phenylalanine, suggesting strongly that
this amino acid is the site of tyrosine phosphorylation.
Phosphorylation of A17 fails to occur during nonpermissive infections
performed with temperature-sensitive mutants defective in the F10
kinase. Our data suggest that this enzyme, which was initially
characterized as a serine/threonine kinase, might in fact have dual
specificity. This hypothesis is strengthened by the observation that
Escherichia coli induced to express F10 contain multiple
proteins which are recognized by antiphosphotyrosine antiserum. This
study presents the first evidence for phosphotyrosine signaling during
vaccinia virus infection and implicates the F10 kinase and the H1
phosphatase as the dual-specificity enzymes that direct this cycle of
reversible phosphorylation.
Protein phosphorylation has emerged
as a major regulator of numerous intracellular processes. Networks of
kinases and phosphatases that add and remove phosphate to Ser, Thr, and
Tyr residues regulate the orderly transition of eukaryotic cells
through the cell cycle and activate checkpoints that halt this
transition in response to intra- and extracellular stresses. Similarly,
when extracellular signals contact membrane-bound receptors, the signal
is often transduced to the nucleus by means of a cascade of
phosphorylation events which converge on the mitogen-activated protein
kinases. These reversible phosphorylation events can modulate such
properties as protein stability, translocation to intracellular
compartments, catalytic activity, and the ability to interact with
other proteins, membranes, or nucleic acids. The number of kinases and
phosphatases within mammalian cells is daunting, with estimates for
each exceeding 1,000. Simpler eukaryotes such as fission and budding
yeasts, which encode fewer kinases and phosphatases and are
exceptionally amenable to genetic analysis, have proven somewhat
simpler to decipher.
In recent years, it has become clear that bacteria and viruses also
utilize reversible protein phosphorylation as a means of biological
regulation. Our laboratory has been involved in an analysis of the two
protein kinases (B1 and F10) and one protein phosphatase encoded by
vaccinia virus. The B1 kinase (1, 15, 36) is expressed at
early times after infection and appears to be essential for viral DNA
replication (23, 24). B1 is known to phosphorylate several
ribosomal proteins (2) and may also play a role in
regulating subsequent phases of protein synthesis (12a). The
F10 kinase, which is expressed at late times of infection and is the
major kinase encapsidated within virions (14), is essential
for the initiation of virion morphogenesis (37, 39). When
infections with temperature-sensitive (ts) mutants
containing lesions in the F10 gene are maintained at high temperature,
no visible signs of virion morphogenesis are seen despite the
unperturbed synthesis of late viral proteins.
The H1 phosphatase, which is also expressed at late times and
encapsidated (9, 17), was the first phosphatase shown to be
able to dephosphorylate Ser, Thr, and Tyr residues. A significant number of dual-specificity phosphatases have now been discovered, and
they have been grouped into four classes (18). The H1 enzyme encoded by vaccinia virus is the prototype of class I, which contains enzymes encoded by poxviruses, baculoviruses, yeast, and human cells.
Although the dual-specificity enzymes retain the active-site sequence
motifs and the catalytic mechanism of Tyr-specific phosphatases, they
resemble each other more closely than they do the traditional Tyr-specific phosphatases. We have previously described the
construction of an inducible vaccinia virus recombinant in which
expression of the H1 phosphatase is dependent on the inclusion of
isopropyl- (Much of this work was presented at the American Society of Virology
[19 to 23 July 1997, Bozeman, Mont.] and International Poxvirus [6
to 10 June 1998, St. Thomas, U.S. Virgin Islands] symposia; at the
latter meeting, we learned that the laboratory of Bernard Moss
[National Institutes of Health] has obtained similar results
regarding the phosphorylation of A17 [3].)
Cells and viruses.
BSC40 cells were maintained in Dulbecco
modified Eagle medium (DMEM; GIBCO BRL) containing 5% fetal bovine
serum (GIBCO BRL). wt vaccinia virus (WR strain), vindH1
(17), vindA17 (41) (vA17L Metabolic labeling of proteins. (i) Labeling with
32PPi.
Confluent BSC40 cell monolayers
were rinsed with phosphate-buffered saline and infected with wt,
vindH1, or ts28 (multiplicity of infection
[MOI] of 2). Cells were refed with complete medium after a 30- to
60-min adsorption period. At 3 h postinfection (hpi), cells were
rinsed with phosphate-free DMEM (ICN Biomedicals, Inc., Costa Mesa,
Calif.) and fed with phosphate-free DMEM supplemented with 50 µCi of
32PPi (Dupont NEN, Boston, Mass.) per ml and 5% fetal calf
serum that had been rendered phosphate free by dialysis against
Tris-buffered saline (25 mM Tris-HCl [pH 7.4], 136 mM NaCl, 2.7 mM
KCl). Cells were harvested at 17 hpi.
(ii) Labeling with [35S]methionine.
At 6 h after infection with vindH1, BSC40 cells were rinsed with
methionine-free DMEM (ICN Biomedicals) and incubated for 60 min with
methionine-free DMEM supplemented with 100 µCi of [35S]methionine (Dupont NEN) per ml.
Immunodetection analyses.
Rabbit polyclonal
antiphosphotyrosine (anti-pTyr) serum was obtained from Transduction
Laboratories (Lexington, Ky.); monoclonal anti-pTyr antibody was a
generous gift from N. Tonks (Cold Spring Harbor Laboratories, Cold
Spring Harbor, N.Y.). D. Hruby (Oregon Health Sciences Center,
Corvallis) kindly provided rabbit anti-A17L and anti-L1 antisera.
Rabbit anti-I3, anti-L4, and anti-A14 sera were developed in our
laboratory (17, 25, 38). For immunoblot analysis, cell and
virion extracts were prepared in the presence of 1 mM sodium
orthovanadate (Sigma, St. Louis, Mo.) prior to fractionation by sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and
electrophoretic transfer to nitrocellulose (Schleicher & Schuell,
Keene, N.H.) or Immobilon P (Millipore Corp., Bedford, Mass.)
membranes. Transfer was performed in
3-[(cyclohexylamino)-1-propanesulfonic acid (CAPS) transfer buffer (10 mM CAPS in 10% methanol, pH 11.3). Primary sera are described above.
Secondary antibodies (horseradish peroxidase [HRP]- or alkaline
phosphatase-conjugated goat anti-rabbit or goat anti-mouse) were
obtained from Bio-Rad (Richmond, Calif.) and used according the
manufacturer's instructions. Blots were developed colorimetrically or
by enhanced chemiluminescence (ECL) (DuPont NEN or Pierce, Rockford,
Ill.). For immunoprecipitation analysis, cells were rinsed with
phosphate-buffered saline and lysed in 1× PLB (0.1 M NaPO4
[pH 7.4], 0.1 M NaCl, 1% Triton X-100, 0.1% SDS, 0.5% sodium
deoxycholate) containing 1 mM sodium orthovanadate (1.2 ml per 3 × 106 cells). Clarified lysates were incubated with
primary serum for >4 h and then with protein A-Sepharose (Sigma) for
1.5 h; immunoprecipitates were then retrieved, washed extensively,
and analyzed by SDS-PAGE and autoradiography or fluorography.
Virion fractionation.
wt and H1-deficient virions were
purified from cytoplasmic lysates of infected cells by
ultracentrifugation through 36% sucrose and subsequent banding on 25 to 40% sucrose gradients. Banded virions were concentrated by an
additional ultracentrifugation; 109 particles were
incubated at 37°C for 30 min in a 100-µl reaction mix containing
100 mM dithiothreitol (DTT), 100 mM Tris (pH 8.0), 0.1% Nonidet P-40
(NP-40), and 1 mM sodium orthovanadate. The permeabilized virions were
partitioned into membrane and core fractions by centrifugation
(14,000 × g, 1 h, 4°C).
Phosphatase treatment of H1-deficient virions.
H1-deficient
virions (9 µg) were incubated with 1.5 µg of recombinant H1
phosphatase or the catalytically inert H1C110S mutant,
which were prepared as previously described (17). Treatment was for 1 h at 37°C in 40 µl of 50 mM Tris (pH 8)-50 mM
DTT-0.05% NP-40.
Construction of A17 alleles containing Tyr Induction and purification of recombinant F10 kinase.
The
F10 ORF was prepared by PCR using the HindIII F fragment
of the vaccinia virus (WR strain) genome as a template and primers 1 (5' CCGGATCCATATGTTAGTTGCCAATGAT 3')
and 2 (5'
TCGGATCCCTATTAGTTTCCGCCATTTAT 3'). The
product generated with these primers contained the full-length F10 open
reading frame, extending from the initiating ATG codon through the TAA
termination codon (underlined). The upstream primer introduced an
NdeI site that overlapped the initiating ATG codon, and the
downstream primer introduced a BamHI site (boldface in each
primer) downstream of the termination codon. The F10 ORF contains an
internal NdeI site. Therefore, the ORF was cloned into
pET16b (35) (Novagen, Madison, Wis.) in two steps: a
C-terminal NdeI/BamHI fragment was cloned first,
and then the N terminus was repaired by insertion of an
NdeI/NdeI fragment in the proper orientation. The
resulting clone encoded an F10 ORF predicted to contain a 27-amino-acid
N-terminal extension that included a decahistidine tag. In this
plasmid, the F10 ORF is under the regulation of the bacteriophage T7
promoter and the lac operator/repressor. pET16b-F10 was
maintained in Escherichia coli BL21(DE3), where F10
expression was induced by the addition of IPTG. Mid-log-phase cultures
were induced by the addition of IPTG (0.2 mM); ethanol (EtOH) was added
(2%) to increase the fraction of F10 that would remain soluble.
Induced cultures were placed on ice for an initial 30 min and then
grown at 18°C with vigorous agitation for 48 h. Cultures were
then harvested, and soluble lysates were prepared and subjected to
batch chromatography on Ni2+-agarose (Qiagen, Valencia,
Calif.). The resin was developed with increasing concentrations of
imidazole; F10 was eluted from the column with 100 mM imidazole. The
eluant was concentrated by sedimentation in a Centricon concentrator
and stored at Kinase assays.
F10 kinase activity was verified by using
myelin basic protein (MBP) as a substrate. Reaction mixes (25 µl)
containing 2.5 µg of MBP, 5 µM [ Preparation of figures.
For Fig. 1 to 4 and 6, scans of
original autoradiographs and immunoblots were obtained with a
Linotype-Hell Saphir Scanner. Images were adjusted to best resemble the
original data with Photoshop 4.0 (Adobe Systems Inc., San Jose, Calif.)
and then labeled by using Canvas 5.0 (Deneba Software, Miami, Fla.).
The enzymatic properties of the vaccinia virus H1 phosphatase were
originally characterized in vitro (9). The ability of the
enzyme to remove the phosphate moiety from phosphoserine (pSer), phosphothreonine (pThr), and pTyr residues led to its classification as
a dual-specificity phosphatase. These studies were complemented by our
in vivo analyses of infections performed in the presence or absence of
H1 expression. In the absence of H1 expression, nascent virions were
greatly diminished in their infectivity and were found to contain at
least three hyperphosphorylated proteins. Eleven- and 16-kDa
proteins representing the products of the F18 and A14 genes (17,
38), respectively, were shown to be hyperphosphorylated on serine
residues when H1 expression was repressed. The dual specificity of H1
in vitro suggested that Tyr phosphorylation might also play a role in
the vaccinia virus life cycle. As a first step toward addressing this
question, we investigated whether any virion proteins were
phosphorylated on Tyr residues and, if so, whether this modification
was regulated by the H1 phosphatase.
H1-deficient virions contain a 25-kDa protein that is
phosphorylated on Tyr residues.
Four different preparations of
purified wt virions and three different preparations of purified
H1-deficient virions (1 to 3 µg of each) were fractionated by
SDS-PAGE and transferred electrophoretically to nitrocellulose. After
incubation with anti-pTyr antibodies, filters were developed with an
HRP-conjugated secondary antibody and ECL. Figure
1A (left) shows that wt virions contained
no proteins with detectable levels of pTyr; in contrast, each
preparation of H1-deficient virions contained a tyr-phosphorylated
protein with an apparent molecular weight (MW) of 25,000. Partitioning of H1-deficient particles into core and membrane fractions revealed that the 25-kDa protein was a component of the virion membrane (Fig.
1A, right). These data demonstrate a genetic relationship between
repression of the H1 phosphatase and hyperphosphorylation of the 25-kDa
protein on Tyr residues. To demonstrate a direct enzyme-substrate
relationship, the ability of the residual encapsidated phosphatase
and/or exogenously supplied H1 to dephosphorylate the 25-kDa protein
was investigated. These data are presented in Fig. 1B. Lanes 1 and 2 demonstrate again the specific detection of a pTyr containing 25-kDa
protein within H1-deficient virions. These virions contain
approximately 2.4% of the levels of H1 protein found within wt
particles (17). When these virions were incubated in the
presence of NP-40 plus DTT, the level of pTyr within the 25-kDa protein
decreased, presumably due to the activation of the residual
phosphatase. Consistent with this interpretation, no diminution in the
pTyr signal was observed (lane 6) when the incubation with NP-40 plus
DTT was conducted in the presence of sodium orthovanadate, an inhibitor
of the phosphatase (9). When treatment with NP-40 plus DTT
was accompanied by the inclusion of recombinant H1 protein, the pTyr
signal was lost completely (lane 4). This loss of phosphorylation was
not seen when a catalytically inert form of the H1 protein (9,
17) was used instead (lane 5). (Appropriate controls confirmed
that these treatments affected only the phosphorylation state of the
virion proteins and not their integrity [not shown].) These data
demonstrate that the 25-kDa protein can be dephosphorylated directly by
the H1 phosphatase and is therefore a bona fide substrate. In concert
with our previous analyses of H1's role in regulating Ser
phosphorylation of the F18 and A14 proteins, the data shown in Fig. 1
provide strong evidence that H1 is a dual-specificity enzyme in vivo
and in vitro.
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Tyrosine Phosphorylation of A17 during Vaccinia Virus Infection:
Involvement of the H1 Phosphatase and the F10 Kinase

![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-D-thiogalactopyranoside (IPTG) in the culture
medium (17). Using this recombinant, we have shown that H1
is essential for ensuring the infectivity and transcriptional
competence of nascent virions. As one approach to clarifying the role
of H1 in ensuring virion infectivity, we have attempted to identify
viral phosphoproteins that are H1 substrates. As we have previously
reported, the preparation of 32P-labeled wild-type (wt) and
H1-deficient virions facilitated the identification of 25-, 16-, and
11-kDa proteins that were hyperphosphorylated in H1-deficient virions.
The 11-kDa species represents the DNA-binding protein encoded by the
F18 gene (17) (designated F17 in the Copenhagen strain
[11]); we have recently determined that the 16-kDa
species represents the membrane protein encoded by the A14 gene
(38). By demonstrating that recombinant H1 could reverse the
hyperphosphorylation of these two proteins in vitro, we confirmed the
enzyme-substrate relationship that was suggested by our genetic data.
Both F18 and A14 are hyperphosphorylated on Ser residues in the absence
of H1 expression. Because H1 has been shown to have dual specificity in
vitro (9), and because Tyr phosphorylation is such an
important feature of diverse regulatory networks, we were interested in
determining whether any viral proteins would exhibit
hyperphosphorylation on Tyr residues under conditions of H1 repression.
In this report, we describe the identification and characterization of
a virion component that is indeed phosphorylated on Tyr residues as
well as on serine/threonine residues. Moreover, we provide evidence
that the reversible phosphorylation of this protein, which is the
product of the A17 gene, is regulated by the F10 kinase as well as the
H1 phosphatase.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
5; kindly
provided by B. Moss), and ts15 and ts28 (gift
from R. Condit) (5, 37) were amplified in monolayer cultures
of BSC40 cells or suspension cultures of L cells. Viral stocks were
prepared from cytoplasmic lysates of infected cells by
ultracentrifugation through 36% sucrose; titrations were performed on
BSC40 cells. In some cases, virions were further purified by banding on
25 to 40% sucrose gradients (17). For ts
mutants, 31.5 and 39.5°C were used as the permissive and
nonpermissive temperatures, respectively. For vindA17,
permissive infections were performed in the presence of IPTG (5 µM).
Where indicated, rifampin was added to a final concentration of 100 µg/ml.
Phe mutations:
identification of Tyr-phosphorylated residue(s).
The wt A17 open
reading frame (ORF) and five mutant alleles that would direct Tyr
Phe
substitutions at codons 3, 6, 7, 3+6+7, or 203 were amplified by PCR.
The 5' primer introduced a ClaI site upstream of the ORF,
and the 3' primer introduced a BamHI site downstream of the
ORF. These sites were used to insert the A17 sequences into a modified
pUC under the transcriptional regulation of a strong, late poxvirus
promoter, the cowpox ATI promoter (20, 38). The primers used
for wt A17 were U (5' CCATCG ATG AGT TAT TTA AGA 3') and D (5' GCGGATCC
TTA ATA ATC GTC AGT ATT 3'). The primers used for Y3F A17 were 3 (5'
CCATCG ATG AGT TTC TTA AGA TAT TAC) and D. The primers used for Y6F A17
were 6 (5' CCATCG ATG AGT TAT TTA AGA TTC TAC AAT 3') and D. The
primers used for Y7F A17 were 7 (5' CCATCG ATG AGT TAT TTA AGA TAT TTC
AAT ATG 3') and D. The primers used for Y3,6,7F A17 were 367 (5' CCATCG ATG AGT TTC TTA AGA TTC TTC AAT ATG CTT 3') and D. The primers used for
Y203F A17 were U and 203 (5' GCGGATCC TTA AAA ATC GTC AGT ATT TAA AC
5'). The sequences of all of the constructs were determined and shown
to be accurate, and the constructs were then used in transient
transfection assays. By using Lipofectamine Plus (GIBCO BRL), 5 µg of
each construct was applied to parallel cultures of BSC40 cells
(1.2 × 106 cells) at 3 h after infection with
vindA17 (MOI of 10) in the absence of IPTG. Cells were
harvested at 30 hpi. As controls, cells were transfected with empty
vector or left untransfected (with and without IPTG). Expression of the
wt and mutant alleles of A17 within transfected cells was evaluated by
immunoblot analysis using anti-A17 antiserum; the levels of tyrosine
phosphorylation of the A17 proteins was assessed by immunoblot analysis
using anti-pTyr antiserum.
80°C in 25% glycerol.
-32P]ATP (2.5 µCi/125 pmol), 50 mM Tris (pH 7.4), 10 mM MgCl2, 1 mM
DTT, and 75 to 400 ng of pure F10 were incubated for 30 min at room
temperature. Phosphorylated MBP was visualized by SDS-PAGE and
autoradiography. To test whether F10 could phosphorylate sequences corresponding to the extreme C terminus of the A17 protein, the peptide
N' RRRTFNSLNTDDY C' was synthesized (Protein Nucleic Acid Shared
Facility, Medical College of Wisconsin). The purity and accuracy of the
peptide were verified by high-pressure liquid chromatography and amino
acid analysis. Kinase reaction mixes (25 µl) contained 75 ng of F10
kinase, peptide (5 to 500 µM), 5 µM [
-32P]ATP (2.5 to 10 µCi/125 pmol), 50 mM Tris (pH 7.4), 10 mM MgCl2, and 1 mM DTT. Control reactions lacked the F10 kinase or the peptide substrate. After reactions were performed for the time indicated (10 or
30 min), they were spotted onto P81 phosphocellulose paper (Whatman,
Ltd.) and washed in 75 mM orthophosphoric acid for 5 min with agitation
(4, 21). Filters were then rinsed in acetone and left to air
dry; the levels of radiolabeled peptide bound to the filter were
quantitated by Cerenkov counting in a Beckman scintillation counter.
The values obtained for control reactions lacking kinase or substrate
were averaged and subtracted from the remaining experimental values.
The data were plotted by using Sigma Plot 4.0 (SPSS Inc., Chicago,
Ill.). Filters were also exposed overnight to Kodak MR film for
autoradiographic visualization.
![]()
RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

View larger version (16K):
[in a new window]
FIG. 1.
Identification of an encapsidated H1 substrate that is
phosphorylated on Tyr residues. (A) A 25-kDa pTyrosine-containing
protein is found within the membranes of H1-deficient virions. (Left)
Seven independently prepared stocks of wt virions (lanes 1 to 4) and
H1-deficient virions (lanes 5 to 7) (approximately 3 µg of each) were
subjected to SDS-PAGE and immunoblot analysis. After incubation of the
nitrocellulose filters with a polyclonal anti-pTyr serum and an
HRP-conjugated secondary antiserum, ECL development allowed the
immunoreactive proteins to be visualized on Kodak MR film. (Right)
H1-deficient virions (4 µg) were partitioned into membrane and core
fractions as described in Materials and Methods. pTyr-containing
proteins were detected by immunoblot analysis as described above; only
the relevant portion of the filter is shown. (B) The H1 phosphatase can
dephosphorylate the 25-kDa protein in vitro. wt or H1-deficient virions
(9 µg) were analyzed directly (lanes 1 and 2) or permeabilized with
NP-40 plus DTT and then incubated for 1 h at 37°C in the absence
(lane 3) or presence (lane 6) of 10 mM sodium orthovanadate or after
the addition of 1.5 µg of active or catalytically inert H1
phosphatase (H1 [lane 4] and H1C100S [lane 5],
respectively). The samples were then subjected to SDS-PAGE and
immunoblot analysis with anti-pTyr serum as described above.
|
The 25-kDa phosphoprotein is the product of the A17 gene.
Many
structural components of vaccinia virions have already been identified.
Among membrane proteins with MWs of approximately 25,000 the A17 and L1
proteins were possible candidates for the Tyr-phosphorylated species
(22, 26, 41). We metabolically labeled
vindH1-infected cells (without IPTG) with
[35S]met and subjected cell lysates to
immunoprecipitation with sera directed against pTyr, A17, L1, and L4 (a
core component of 25 to 29 kDa). Comparison of the electrophoretic
profile of the immunoprecipitates indicated that the protein doublet
immunoprecipitated by the anti-pTyr serum comigrated with that
immunoprecipitated by the anti-A17 serum (Fig. 2A). The migration of
the other proteins was quite dissimilar (not shown). The comigration of
the pTyr immunoprecipitate and A17 led us to investigate the pTyr
profile of cells infected with an inducible recombinant in which A17
expression is dependent on the inclusion of IPTG in the culture medium
(41). As shown in Fig. 2B, no 25-kDa protein was detected
with the anti-pTyr serum in lysates harvested at 12 hpi from uninduced
cultures (lane 3,
IPTG); inclusion of IPTG, however, restored
expression of the pTyr-containing 25-kDa protein, as it restored
expression of A17 (lane 3, +IPTG). This observation strongly suggested
that the A17 protein was indeed the 25-kDa phosphorylated protein. The
data shown in Fig. 2C and D extend this analysis. As shown in Fig. 2C,
uninfected or infected cells were metabolically labeled with
32PPi and then subjected to immunoprecipitation
analysis with sera directed against A17, pTyr, or I3. The latter, a
virally encoded single-stranded-DNA-binding protein, serves as an
internal control since it is phosphorylated on Ser residues in a manner
which appears to be independent of the B1 and F10 kinases as well as
the H1 phosphatase (25). The anti-A17 serum precipitated a
phosphorylated species from both wt- and vindH1-infected
cell extracts (lanes 1). The total levels of A17 phosphorylation
appeared to be approximately twofold higher when H1 expression was
repressed (compare lanes 1). The anti-pTyr serum immunoprecipitated a
comigrating phosphoprotein from infected cell lysates; in this case,
however, a dramatic increase in signal was seen when H1 expression was
repressed (compare lanes 2). As expected, a 34-kDa phosphoprotein was
seen when the I3 serum was used in immunoprecipitation analyses of wt-
and vindH1-infected extracts (lanes 3); none of the sera
immunoprecipitated any phosphorylated species from uninfected cells.
On which tyrosine is A17 phosphorylated?
To aid us in
identifying which kinase was responsible for phosphorylating A17, and
to set the stage for understanding how A17 phosphorylation might
regulate its function, we were interested in determining which Tyr
residue was the site of phosphorylation. Our analysis took advantage of
information regarding A17's topology as well as its evolutionary
conservation. First, the A17 protein is highly hydrophobic; it is
thought to be inserted into the endoplasmic reticulum membrane
cotranslationally and is predicted to span the bilayer two to four
times (13). The N and C termini are the least hydrophobic in
nature and are predicted to be exposed and project into the cytosol
and/or the interior of the virion. Second, if phosphorylation of A17 on
tyrosine residues is functionally significant, we predicted that the
Tyr residue(s) involved would be conserved throughout poxviruses. We
therefore aligned the deduced amino acid sequence of the vaccinia virus
A17 protein with that from molluscum contagiosum virus, a highly
divergent poxvirus (32, 33). We identified the Tyr residues
at positions 3, 6, 7, and 203 as being evolutionarily conserved
and located outside the membrane-spanning domains and therefore
reasonable candidates for the site(s) of phosphorylation. We used
overlap PCR mutagenesis to construct A17 alleles predicted to contain
Tyr
Phe substitutions at these positions. Plasmids containing the wt
allele and those directing Y3F, Y6F, Y7F, Y3+6+7F, and Y203F
substitutions under the regulation of a strong cowpox promoter were
constructed (20). Cells were then infected with
vindA17 in the absence of IPTG so that endogenous A17
synthesis was repressed, and the plasmids encoding the various A17
alleles were introduced by lipofection. Parallel plates received empty
plasmid or no DNA as controls, and a final plate was infected in the
presence of IPTG to induce endogenous A17 synthesis. At 30 hpi, cells
were harvested and lysates were fractionated and transferred to
membranes. Duplicate filters were developed with anti-A17 and anti-pTyr sera.
|
Phosphorylation of A17 on Ser/Thr and Tyr residues is dependent on the vaccinia virus F10 kinase in vivo. The F10 gene is one of two within the viral genome that encodes a protein kinase. The F10 kinase (also known as VRK2) is expressed at late times of infection and is encapsidated within virions. Previous studies from our laboratory and others have demonstrated a crucial role for the kinase in regulating the earliest steps of viral morphogenesis (37, 39). When cells infected nonpermissively with ts mutants carrying defects in the F10 kinase (ts28 and ts15) were examined by electron microscopy, none of the hallmarks of viral morphogenesis were observed. Cleared areas of cytoplasm devoid of cellular organelles were seen, but no crescents, immature virions (IV), or mature virions (IMV) were found. This block to morphogenesis occurs despite the synthesis of the full complement of late viral proteins.
Since the F10 kinase appears to drive virion morphogenesis, and since A17 is a multiply phosphorylated protein which is also essential for virion morphogenesis (26, 41), we investigated whether disruption of F10 function had an impact on the phosphorylation of A17. We compared the phosphorylation profiles of A17 in cells infected with either wt virus or ts28 (tsF10) at both 31.5°C (permissive temperature) and 39.5°C (nonpermissive for ts28). Infected cells were metabolically labeled with 32PPi, and extracts were subjected to immunoprecipitation with sera directed against A17, pTyr, and 13 (Fig. 4A). Whereas 32P-labeled A17 was retrieved from cells infected with wt virus at both temperatures (lanes 7 and 10), this signal was lost in cells infected nonpermissively with ts28 (compare lane 4 with lane 1). Thus, the global phosphorylation of A17 appears to be genetically dependent on the F10 kinase. No phosphorylated signal was seen when lysates from cells infected nonpermissively with ts28 were subjected to immunoprecipitation with anti-pTyr (lane 5). However, the signal seen in permissively infected cells or cells infected with wt virus was also minimal (lanes 2, 8, and 11), since the H1 phosphatase is active during these infections. To better address the question of whether the phosphorylation of A17 on Tyr residues is also dependent on a wt allele of the F10 kinase, extracts of infected cells were subjected to immunoblot analysis with anti-pTyr antiserum (12, 19). When this more sensitive assay was used (Fig. 4B), a striking deficit in the Tyr phosphorylation of A17 was seen in cells infected nonpermissively with ts28. These highly reproducible data were also seen when other ts mutants carrying lesions in F10 (e.g., ts15) were tested. (Development of parallel blots with anti-A17 serum confirmed that the loss of phosphorylation was not due to a decrease in the levels of A17 protein [not shown].) Thus, although F10 has previously been characterized as a Ser/Thr kinase, its genetic inactivation abrogates the phosphorylation of A17 on Tyr as well as on Ser/Thr residues.
|
Recombinant F10 kinase phosphorylates a peptide derived from the C terminus of A17. The data discussed above and shown in Fig. 4 demonstrate that the phosphorylation of A17 on Ser/Thr and Tyr residues is genetically dependent on the F10 kinase. Since F10 has not previously been shown to be a dual-specificity kinase, a determination of whether the enzyme plays a direct or indirect role in A17's phosphorylation is of high priority. F10 might indeed phosphorylate A17 with dual specificity. Alternatively, F10 might phosphorylate A17 on Ser/Thr residues and, by so doing, convert it into a good substrate for a cellular tyrosine kinase. Finally, F10 might not phosphorylate A17 at all, but its role in initiating virion morphogenesis might be required to position A17 for phosphorylation by a cellular kinase. Direct tests of whether A17 is a substrate for F10 would help in discriminating between these possibilities; however, A17 is a transmembrane protein with only short exposed regions, and thus producing soluble, recombinant protein is difficult if not impossible. Since we defined Tyr203 as being essential for tyrosine phosphorylation of A17, we chose instead to synthesize a peptide corresponding to the C terminus of A17 and encompassing residues 194 to 203. An N-terminal basic extension was added to the peptide to confer an affinity for P81 phosphocellulose paper and so facilitate assays of the phosphorylation of this peptide by F10 (4, 21). The sequence of the peptide was, therefore, N' RRRTFNSLNTDDY C'; the peptide contains four potential phosphorylation sites shown in boldface. Recombinant F10 was tested for its ability to phosphorylate this peptide in vitro; Fig. 5 provides a graphic representation of the kinase assay. F10 was indeed able to phosphorylate the peptide in a manner that was dependent on both the reaction duration and the substrate concentration. Although these results clearly suggested that F10 could phosphorylate the C terminus of A17 directly, their interpretation should be tempered by the fact that the in vitro phosphorylation reaction was extremely inefficient. Only a fraction of the substrate was shown to undergo modification, and the residue(s) phosphorylated by F10 has not yet been identified.
|
E. coli induced to express F10 contains multiple
proteins which react with anti-pTyr antiserum.
The genetic data
presented above suggested that F10 might indeed be a dual-specificity
protein kinase. To test whether F10 has tyrosine kinase activity, we
exploited the fact that bacteria do not contain tyrosine kinases and
therefore have no immunoreactive pTyr. The appearance of immunoreactive
pTyr upon expression of a kinase in E. coli has become a
classic approach to discovering tyrosine kinase activity
(16). The tyrosine kinase activity of dual specificity
kinases is often highly substrate specific, and an unbiased scan of all
bacterial proteins has frequently been more profitable than individual
testing of peptides or proteins. We therefore prepared mid-log-phase
cultures of BL21(DE3) and BL21(DE3):pET16b-F10 and subjected them to
identical inductions: addition of IPTG (to 0.2 mM) and EtOH (to 2%),
incubation on ice for 30 min, and vigorous agitation at 18°C for
48 h. Bacteria were harvested and disrupted, and crude lysates
were fractionated by SDS-PAGE. The overall protein profiles were
compared after staining with Coomassie blue, and the pTyr content was
determined by immunoblot analysis using a polyclonal anti-pTyr serum.
After ECL development, the immunoblots were stained with amido black to
ensure that equal amounts of protein were present in the samples. As
shown in Fig. 6, the results were
dramatic. Whereas no immunoreactive pTyr was seen in the BL21(DE3)
cultures, the F10-expressing cultures contained several strongly
immunoreactive species. The major species had an apparent MW of
55,000 and may therefore represent autophosphorylated F10. We have
obtained consistent results from several independent inductions and
analyses and feel that these data demonstrate that the F10 kinase does
indeed have the ability to phosphorylate Tyr residues in vivo.
|
| |
DISCUSSION |
|---|
|
|
|---|
The studies described in this report clearly demonstrate that the A17 protein is phosphorylated on Ser, Thr, and Tyr residues in vivo. This phosphorylation is genetically dependent on a wt allele of the F10 kinase and does not occur during nonpermissive infections performed with ts mutants which carry lesions in the F10 gene. The link between A17 and F10 is intuitively appealing, since both play a role in the earliest stages of virion morphogenesis (26, 27, 37, 39, 41). In vaccinia virus morphogenesis, membranes of the intermediate compartment are thought to be recruited to the cytoplasmic sites where viral proteins are concentrated. The first visual sign of morphogenesis is the appearance of membrane crescents, which then elongate and develop into spherical IV. Dense nucleoids then form within the IV, and finally the virion matures into a brick-shaped particle that encloses a biconcave core (IMV). In the absence of a wt allele of the F10 kinase, none of these intermediates or IMV are seen, and the most striking feature is the presence of large, cleared-out areas of the cytoplasm that are devoid of organelles. In the absence of A17 expression, dense aggregates appear within the cleared cytoplasm, but no crescents, IV, or IMV are seen.
Because F10 and A17 function along the same morphogenetic pathway, an enzyme-substrate relationship seems quite reasonable. However, F10 has been characterized as a Ser/Thr kinase and has not previously been shown to phosphorylate substrates on Tyr residues as well. The dual-specificity class of protein kinases is poorly understood in terms of diagnostic sequence motifs and biochemical properties. The mammalian mitogen-activated protein kinase kinases that phosphorylate the Thr and Tyr residues within the TXY motif of their substrates (8, 16) are among the best-studied examples of such enzymes. Dual-specificity kinases resemble Ser/Thr kinases in their primary sequences (16). However, they possess the ability to undergo autophosphorylation, or to direct the phosphorylation of exogenous substrates, on Tyr residues. Tyr phosphorylation has typically been detected by monitoring immunoreactivity with anti-pTyr antisera and has often been identified upon expression of candidate kinases in bacteria. Although F10 does have some of the conserved motifs of a Ser/Thr protein kinase, it appears to lack several of the others and may therefore have unique properties (14). Recombinant F10 has previously been shown to phosphorylate exogenous substrates and to undergo autophosphorylation on Ser and Thr residues. In this report we provide new evidence that multiple proteins containing immunoreactive pTyr are found within bacterial strains expressing F10; the most abundant of these is likely to be F10 itself (Fig. 5B). Together, these data strongly suggest that F10 is a dual-specificity kinase.
Although we have not addressed the site(s) on which A17 undergoes
Ser/Thr phosphorylation, our data argue that Tyr203 is the
only site of Tyr phosphorylation. Mutation of this terminal residue to
Phe leads to the synthesis and accumulation of A17 protein that lacks
any detectable pTyr. (Although we favor the direct interpretation of
these data, it remains formally possible that the
Tyr203
Phe substitution causes a structural change that
prevents phosphorylation of residues elsewhere.) The nine residues
upstream of Tyr203 (underlined) contain three potential
sites (boldfaced) for Ser/Thr phosphorylation (N'
TFNSLNTDDY 3'), making this region a reasonable target for a dual-specificity kinase. We have
shown that F10 has the capacity to phosphorylate a peptide representing
the 10 C-terminal amino acids of A17, albeit inefficiently. This lack
of efficiency is often seen with peptide substrates, suggesting that a
strong kinase-substrate interaction involves contacts with regions
distal from the target residue. It will be of obvious interest to
pursue a further biochemical analysis of F10's apparent dual
specificity and to analyze its interactions with A17 and other
potential substrates.
Hyperphosphorylation of A17 is seen when expression of the H1 phosphatase is repressed. The total amount of 32P incorporated into intracellular A17 (as assessed by immunoprecipitation with anti-A17 serum) is increased only twofold when H1 expression is blocked. However, the levels of phosphorylated A17 that can be retrieved by precipitation with anti-pTyr sera increase dramatically upon repression of the phosphatase. Immunoblot analysis reveals that intracellular A17 is indeed phosphorylated on Tyr residues during wt infections, albeit at a level significantly lower than that seen in the absence of H1 expression. Since the A17 encapsidated within purified, wt virions does not contain any immunoreactive pTyr, dephosphorylation must normally occur during or after morphogenesis. H1-deficient virions, in contrast, contain A17 that retains tyrosine phosphorylation.
The demonstration that the H1 phosphatase is responsible for dephosphorylation of tyrosine residues on A17 as well as Ser/Thr residues on F18 and A14 (17) provides a clear demonstration that H1 is indeed a dual-specificity phosphatase. The levels of pTyr within A17 are exquisitely sensitive to the levels of H1, suggesting that A17 is an excellent substrate for H1 and a poor substrate for cellular phosphatases. Interestingly, the residues preceding Tyr203, 194TFNSLNTDDY203, contain several potential sites of Ser/Thr phosphorylation. It has previously been shown that dual-specificity phosphatases act preferentially on diphosphorylated substrates in which the pTyr residue is in proximity to pSer or pThr and that the dephosphorylation of the Tyr residue is the first and most rapid step in the reaction (7, 18). Moreover, the acidic character of the residues preceding the Tyr residue in the N' TFNSLNTDDY C-terminal sequence are a common feature of preferred sites for Tyr dephosphorylation.
Although phosphorylation of A17 has not previously been reported, a significant amount is known about the topology of the protein. A17 is predicted to insert its central, hydrophobic region into the lipid bilayer during translation on membrane-bound polysomes (13). Residues 1 to 63 and 158 to 203 are the only residues predicted to extend beyond the membrane and are therefore the most likely to sustain phosphorylation and to participate in protein-protein interactions. The 15 N-terminal amino acids of A17 are proteolytically removed during virion morphogenesis, with cleavage occurring at the diagnostic Ala-Gly-Ala motif found at the processing site of several virion proteins (28, 40). This processing converts the 23-kDa precursor into the mature 21-kDa form of A17.
As mentioned above, A17 is essential for early stages of IMV morphogenesis; in the absence of A17 expression, morphogenesis arrests prior to the formation of crescents, IV, or IMV (26, 27, 41). Similar results have been reported for the A14 protein, another component of the virion membrane (31, 38). This functional overlap suggests that some interaction of the A17 and A14 proteins is likely; indeed, such an association has been reported (30). A17 is also thought to recruit the viral A27 protein (p14) to the surface of IMV, where the latter plays an essential role in enabling a subset of IMV to become wrapped in membranes of the trans-Golgi network (28, 29). These wrapped virions mature into the cell-associated and extracellular enveloped virions that are responsible for cell-to-cell and distal spread of the virus. p14 interacts only with the N-terminally processed, 21-kDa form of A17. Whether phosphorylation or dephosphorylation of A17 affects its interaction with p14 is not yet known.
The role of A17 in anchoring p14 relies on A17 being exposed on the external surface of the virion. The N and C termini of A17 have indeed been shown to be accessible to protease digestion within postnuclear supernatants of infected cells and in purified IMV (13). However, analysis by immunoelectron microscopy has indicated that the N and C termini of A17 are exposed on the inner surface of crescents and IV, with little or no A17 exposed on the outer surface (13, 41). Moreover, A17 is virtually undetectable on IMV when a C-terminus-specific antiserum is used, although the same antibody easily detects encapsidated A17 in immunoblot assays. Presumably, immunoreactive epitopes on the outer surface of crescents and IV are masked, perhaps because of steric interference due to protein-protein interactions, conformational changes, or posttranslational modification. Comparable mechanisms might contribute to the masking of C-terminal epitopes in IMV. The immunoelectron microscopic data do indicate, however, that some molecules of A17 are clearly exposed on the inner surface of the virion membrane.
A full understanding of the topology of the A17 molecule within the virion awaits a clarification of the biogenesis and structure of the membrane itself. Early studies suggested that a single bilayer enclosing the virion was formed de novo in the cytoplasm (6). Although the concept of de novo membrane formation remains controversial, a recent study provides careful measurements that provide support for the presence of a single 5-nm-thick membrane surrounding the virion (10). In contrast, other investigators have hypothesized that membranes from the intermediate compartment (between the endoplasmic reticulum and Golgi apparatus) become tightly apposed and curve to form the oval membrane that defines IV (34). In this scenario, the virion is delimited by two adjacent lipid bilayers, with the cytoplasmic face of one facing outward and the cytoplasm face of the other facing inward. The latter model could easily account for the cumulative findings that the termini of A17 are exposed on both the inner and outer faces of the virion membrane. In any case, it is quite possible that the reversible phosphorylation of the C terminus of A17 affects the internal as well as the external structure of the virion.
Further analysis of the phosphorylation state of A17 and its dephosphorylation by H1 is clearly of interest. Reversible phosphorylation of the C-terminal region might well regulate protein-protein interactions which are essential in driving virion morphogenesis; alternatively, such modifications might mediate A17's recruitment of p14, the association of IMV with the Golgi apparatus, and the subsequent formation of enveloped virus. Dephosphorylation does not appear to be an essential step in morphogenesis, since H1-deficient virions mature normally. The dephosphorylation of A17, however, might contribute to virion stability or infectivity, since these parameters are affected by the repression of H1.
In sum, this report brings together the A17, F10, and H1 proteins, all of which are essential for the production of infectious viral progeny. F10 initiates virion morphogenesis and mediates the phosphorylation of A17 on Ser/Thr and Tyr residues. These events are localized on the membranes of the endoplasmic reticulum, intermediate compartment, and developing virions, and unraveling their intricacies will have relevance not only to vaccinia virus morphogenesis but also to questions of organelle biogenesis and vesicle trafficking. H1 reverses much of the action of F10, and its cumulative actions are key to ensuring that nascent virions are infectious. The amenability of vaccinia virus to genetic and biochemical dissection should facilitate a thorough analysis of this intriguing network of protein phosphorylation.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by a grant to P.T. from the NIH (5R01 GM 53601) and by a special group of donors from the Dorothy Rodbell Cohen Foundation. M.D. was a fellow of the Charles H. Revson Foundation.
We thank D. Hruby, E. Wolffe, B. Moss, M. Esteban, D. Pickup, and N. Tonks for graciously providing reagents.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology and Molecular Genetics, Medical College of Wisconsin, 8701 Watertown Plank Rd., Milwaukee, WI 53226. Phone: (414) 456-8253. Fax: (414) 456-6535. E-mail: ptrakt{at}mcw.edu.
Present address: Laboratoire de Biologie des Retrovirus,
Departement de Virologie, Institut Pasteur, 75724 Paris Cedex 15, France.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Banham, A. H., and G. L. Smith. 1992. Vaccinia virus gene B1R encodes a 34-kDa serine/threonine protein kinase that localizes in cytoplasmic factories and is packaged into virions. Virology 191:803-812[Medline]. |
| 2. |
Beaud, G.,
A. Sharif,
A. Topa-Masse, and D. P. Leader.
1994.
Ribosomal protein S2/Sa kinase purified from HeLa cells infected with vaccinia virus corresponds to the B1R protein kinase and phosphorylates in vitro the viral ssDNA-binding protein.
J. Gen. Virol.
75:283-293 |
| 3. |
Betakova, T.,
E. J. Wolffe, and B. Moss.
1999.
Regulation of vaccinia virus morphogenesis: phosphorylation of the A14L and A17L membrane proteins and C-terminal truncation of the A17L protein are dependent on the F10L kinase.
J. Virol.
73:3534-3543 |
| 4. | Casnellie, J. E. 1991. Assay of protein kinases using peptides with basic residues for phosphocellulose binding. Methods Enzymol. 200:115-121[Medline]. |
| 5. | Condit, R. C., A. Motyczka, and G. Spizz. 1983. Isolation, characterization and physical mapping of temperature sensitive mutants of vaccinia virus. Virology 128:429-443[Medline]. |
| 6. | Dales, S., and E. H. Mosbach. 1968. Vaccinia as a model for membrane biogenesis. Virology 35:564-583[Medline]. |
| 7. |
Denu, J. M.,
G. Zhou,
L. Wu,
R. Zhao,
J. Yuvaniyama,
M. A. Saper, and J. E. Dixon.
1995.
The purification and characterization of a human dual-specific protein tyrosine phosphatase.
J. Biol. Chem.
270:3796-3803 |
| 8. | Dhanasekaran, N., and E. P. Reddy. 1998. Signaling by dual specificity kinases. Oncogene 17:1447-1455[Medline]. |
| 9. | Guan, K., S. S. Broyles, and J. E. Dixon. 1991. A tyr/ser phosphatase encoded by vaccinia virus. Nature 350:359-362[Medline]. |
| 10. |
Hollinshead, M.,
A. Vanderplasschen,
G. L. Smith, and D. J. Vaux.
1999.
Vaccinia virus intracellular mature virions contain only one lipid membrane.
J. Virol.
73:1503-1517 |
| 11. | Johnson, G. P., S. J. Goebel, and E. Paoletti. 1993. An update on the vaccinia virus genome. Virology 196:381-401[Medline]. |
| 12. | Kamps, M. P., and B. M. Sefton. 1988. Most of the substrates of oncogenic viral tyrosine protein kinases can be phosphorylated by cellular tyrosine protein kinases in normal cells. Oncogene Res. 3:105-115[Medline]. |
| 12a. | Kovacs, G. Personal communication. |
| 13. |
Krijnse-Locker, J.,
S. Schleich,
D. Rodriguez,
B. Goud,
E. J. Snijder, and G. Griffiths.
1996.
The role of a 21-kDa viral membrane protein in the assembly of vaccinia virus from the intermediate compartment.
J. Biol. Chem.
271:14950-14958 |
| 14. |
Lin, S., and S. S. Broyles.
1994.
Vaccinia protein kinase 2: a second essential serine/threonine kinase encoded by vaccinia virus.
Proc. Natl. Acad. Sci. USA
91:7653-7657 |
| 15. |
Lin, S.,
W. Chen, and S. S. Broyles.
1992.
The vaccinia virus B1R gene product is a serine/threonine protein kinase.
J. Virol.
66:2717-2723 |
| 16. | Lindberg, R. A., A. M. Quinn, and T. Hunter. 1992. Dual-specificity protein kinases: will any hydroxyl do? Trends Biochem. Sci. 17:114-119[Medline]. |
| 17. | Liu, K., B. Lemon, and P. Traktman. 1995. The dual-specificity phosphatase encoded by vaccinia virus, VH1, is essential for viral transcription in vivo and in vitro. J. Virol. 69:7823-7834[Abstract]. |
| 18. | Martell, K. J., T. Angelotti, and A. Ullrich. 1998. The "VH1-like" dual-specificity protein tyrosine phosphatases. Mol. Cell 8:2-11. |
| 19. |
Morla, A. O., and J. Y. Wang.
1986.
Protein tyrosine phosphorylation in the cell cycle of BALB/c 3T3 fibroblasts.
Proc. Natl. Acad. Sci. USA
83:8191-8195 |
| 20. |
Patel, D. D.,
C. A. Ray,
R. P. Drucker, and D. J. Pickup.
1988.
A poxvirus-derived vector that directs high levels of expression of cloned genes in mammalian cells.
Proc. Natl. Acad. Sci. USA
85:9431-9435 |
| 21. | Ploegh, H. L. 1997. Phosphorylation and phosphatases, p. 13.7.15-13.7.17. In J. E. Coligan, B. M. Dunn, H. L. Ploegh, D. W. Speicher, and P. T. Wingfield (ed.), Current protocols in protein science. John Wiley & Sons, Inc., New York, N.Y. |
| 22. |
Ravanello, M. P., and D. E. Hruby.
1994.
Conditional lethal expression of the vaccinia virus L1R myristylated protein reveals a role in virion assembly.
J. Virol.
68:6401-6410 |
| 23. |
Rempel, R. E.,
M. K. Anderson,
E. Evans, and P. Traktman.
1990.
Temperature-sensitive vaccinia virus mutants identify a gene with an essential role in viral replication.
J. Virol.
64:574-583 |
| 24. |
Rempel, R. E., and P. Traktman.
1992.
Vaccinia virus B1 kinase: phenotypic analysis of temperature-sensitive mutants and enzymatic characterization of recombinant proteins.
J. Virol.
66:4413-4426 |
| 25. |
Rochester, S. C., and P. Traktman.
1998.
Characterization of the single-stranded DNA binding protein encoded by the vaccinia virus I3 gene.
J. Virol.
72:2917-2926 |
| 26. | Rodriguez, D., M. Esteban, and J. R. Rodriguez. 1995. Vaccinia virus A17L gene product is essential for an early step in virion morphogenesis. J. Virol. 69:4640-4648[Abstract]. |
| 27. | Rodriguez, D., C. Risco, J. R. Rodriguez, J. L. Carrascosa, and M. Esteban. 1996. Inducible expression of the vaccinia virus A17L gene provides a synchronized system to monitor sorting of viral proteins during morphogenesis. J. Virol. 70:7641-7653[Abstract]. |
| 28. |
Rodriguez, D.,
J. R. Rodriguez, and M. Esteban.
1993.
The vaccinia virus 14-kilodalton fusion protein forms a stable complex with the processed protein encoded by the vaccinia virus A17L gene.
J. Virol.
67:3435-3440 |
| 29. |
Rodriguez, J. F., and G. L. Smith.
1990.
IPTG-dependent vaccinia virus: identification of a virus protein enabling virion envelopment by Golgi membrane and egress.
Nucleic Acids Res.
18:5347-5351 |
| 30. | Rodriguez, J. R., C. Risco, J. L. Carrascosa, M. Esteban, and D. Rodriguez. 1997. Characterization of early stages in vaccinia virus membrane biogenesis: implications of the 21-kilodalton protein and a newly identified 15-kilodalton envelope protein. J. Virol. 71:1821-1833[Abstract]. |
| 31. |
Rodriguez, J. R.,
C. Risco,
J. L. Carrascosa,
M. Esteban, and D. Rodriguez.
1998.
Vaccinia virus 15-kilodalton (A14L) protein is essential for assembly and attachment of viral crescents to virosomes.
J. Virol.
72:1287-1296 |
| 32. | Senkevich, T. G., J. J. Bugert, J. R. Sisler, E. V. Koonin, G. Darai, and B. Moss. 1996. Genome sequence of a human tumorigenic poxvirus: prediction of specific host responses-evasion genes. Science 273:813-816[Abstract]. |
| 33. | Senkevich, T. G., E. V. Koonin, J. J. Bugert, G. Darai, and B. Moss. 1997. The genome of molluscum contagiosum virus: analysis and comparison with other poxviruses. Virology 233:19-42[Medline]. |
| 34. |
Sodeik, B.,
R. W. Doms,
M. Ericsson,
G. Hiller,
C. E. Machamer,
W. van't Hof,
G. van Meeer,
B. Moss, and G. Griffiths.
1993.
Assembly of vaccinia virus: role of the intermediate compartment between the endoplasmic reticulum and the Golgi stacks.
J. Cell Biol.
121:521-541 |
| 35. | Studier, F. W., A. L. Rosenberg, J. J. Dunn, and J. W. Dubendorff. 1990. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185:60-89[Medline]. |
| 36. |
Traktman, P.,
M. K. Anderson, and R. E. Rempel.
1989.
Vaccinia virus encodes an essential gene with strong homology to protein kinases.
J. Biol. Chem.
264:21458-21461 |
| 37. | Traktman, P., A. Caligiuri, S. A. Jesty, K. Liu, and U. Sankar. 1995. Temperature-sensitive mutants with lesions in the vaccinia virus F10 kinase undergo arrest at the earliest stage of virion morphogenesis. J. Virol. 69:6581-6587[Abstract]. |
| 38. | Traktman, P., K. Liu, B. Unger, R. Rollins, and S. A. Jesty. Elucidating the essential role of the A14 phosphoprotein in vaccinia morphogenesis: construction and characterization of a tetracycline-inducible recombinant. Submitted for publication. |
| 39. | Wang, S., and S. Shuman. 1995. Vaccinia virus morphogenesis is blocked by temperature-sensitive mutations in the F10 gene, which encodes protein kinase 2. J. Virol. 69:6376-6388[Abstract]. |
| 40. | Whitehead, S. S., and D. E. Hruby. 1994. Differential utilization of a conserved motif for the proteolytic maturation of vaccinia virus proteins. Virology 200:154-161[Medline]. |
| 41. | Wolffe, E. J., D. M. Moore, E. J. Peters, and B. Moss. 1996. Vaccinia virus A17L open reading frame encodes an essential component of nascent viral membranes that is required to initiate morphogenesis. J. Virol. 70:2797-2808[Abstract]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»