Previous Article | Next Article 
Journal of Virology, September 1999, p. 7255-7261, Vol. 73, No. 9
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Moloney Murine Sarcoma Virus Genomic RNAs Dimerize
via a Two-Step Process: a Concentration-Dependent Kissing-Loop
Interaction Is Driven by Initial Contact between Consecutive
Guanines
Hinh
Ly,1
Donald
P.
Nierlich,2,3
John C.
Olsen,4,5 and
Andrew H.
Kaplan1,4,6,*
Departments of Microbiology & Immunology1 and
Medicine,4 Lineberger Cancer
Center,6 and Cystic
Fibrosis/Pulmonary Research and Treatment
Center,5 School of Medicine, The University of
North Carolina at Chapel Hill, Chapel Hill, North Carolina, and
Department of Microbiology, Immunology, & Molecular
Genetics2 and Molecular Biology
Institute,3 University of California Los Angeles
School of Medicine, Los Angeles, California
Received 10 February 1999/Accepted 25 May 1999
 |
ABSTRACT |
Retroviruses contain two plus-strand genomic RNAs, which are stably
but noncovalently joined in their 5' regions by a dimer linkage
structure (DLS). Two models have been put forward to explain the
mechanisms by which the RNAs dimerize; each model emphasizes the role
of specific molecular determinants. The kissing-loop model implicates
interactions between palindromic sequences in the DLS region. The
second model proposes that purine-rich stretches in the region form
purine quartet structures. Here, we present an examination of the in
vitro dimerization of Moloney murine sarcoma virus (MuSV) RNA in the
context of these two models. Dimers were found to form spontaneously in
a temperature-, time-, concentration-, and salt-dependent manner. In
contrast to earlier reports, we found that deletion of neither the
palindrome nor the consensus purine motifs (PuGGAPuA) affected the
level of dimer formation at low concentrations of RNA. Rather,
different purine-rich sequences, i.e., consecutive stretches of
guanines, were found to enhance both in vitro RNA dimerization and in
vivo viral replication. Biochemical evidence further suggests that
these guanine-rich (G-rich) stretches form guanine quartet structures.
We also found that the palindromic sequences could support dimerization
at significantly higher RNA concentrations. In addition, the G-rich
stretches were as important as the palindromic sequence for maintaining
efficient viral replication. Overall, our data support a model that
entails contributions from both of the previously proposed mechanisms of retroviral RNA dimerization.
 |
INTRODUCTION |
A unique feature of retroviruses is
that they encapsidate a dimer of identical plus-strand genomic RNAs.
Electron microscopy and sedimentation studies indicate that the two
RNAs are held together noncovalently near their 5' ends in a union
referred to as the dimer linkage structure (DLS) (3, 21, 27,
35). This region of the genome also encodes major regulatory
features important to the viral life cycle, including the primer
binding site, the major splice donor, the gag start codon,
and the cis-acting encapsidation (
) signal. Thus, the DLS
directly or indirectly plays roles in reverse transcription of viral
genomic RNA, viral RNA splicing specificity, translational control, and
determination of the specificity of viral RNA encapsidation
(40).
Although it has been recognized for some time that the DLS resides near
the 5' end of the genome, the mechanism of dimerization remains
obscure. Currently, two models for dimerization have been put forward.
The kissing-loop model for DLS formation proposes that palindromic
sequences (Pal) in a hairpin loop interact through Watson-Crick base
pairing. An RNA containing the human immunodeficiency virus type 1 (HIV-1) DLS was shown to dimerize in vitro through interactions of a
6-base Pal (GUGCAC) (23, 34, 38, 41, 46).
Furthermore, studies with synthetic RNAs and antisense oligonucleotides
implicated a 16-base, self-complementary sequence of the Moloney murine
leukemia virus (MuLV) as part of a putative DLS region (16, 17,
42, 43, 49). However, mutations engineered to ablate Pal in MuLV
did not affect the stability of genomic RNAs isolated from virions
(4, 7, 18, 24, 45). Furthermore, the kissing-loop model
cannot explain some unusual features of the retroviral RNA dimers,
e.g., their resistance to denaturing conditions and the inability of
antisense DLS RNA to form dimers (29, 34). Finally, the
formation of heterodimers between the DLS sequences of HIV-1 and other
retroviruses that lack homology between their Pal sequences suggests a
role for other determinants of dimerization (29).
For the second model of dimerization, phylogenetic analyses of putative
retroviral DLSs revealed a unique purine-rich motif (PuGGAPuA) that is
conserved among retroviruses (29). It has been proposed that
these consensus purine motifs may form purine-base tetrads, in part
because they are stabilized by monovalent cations such as those
observed in human telomeric DNA (53). A similar kind of
structure that involves consecutive guanine stretches has also been
proposed (1, 48). Structural probing and biochemical studies
support the contention that the HIV-1 DLS is maintained by these
guanine-rich (G-rich) sequences (1, 2, 29, 48). In addition,
in vitro and in vivo studies of rat retrotransposon VL30 and Rous
sarcoma virus DLS RNAs provide evidence that G-rich sequences can
function in dimer pairing (12, 25, 50, 51).
Here, in an attempt to synthesize these apparently disparate findings,
we characterize each of the signals that constitute the two different
models of retroviral dimerization. Our results suggest that the G-rich
and Pal sequences both play roles in dimerization while the consensus
purine motifs do not. Although Pal was sufficient to allow dimerization
of Moloney murine sarcoma virus (MuSV) RNA at high concentrations, it
was dispensable at lower concentrations. By contrast, the G-rich
regions were critical for establishing dimers at low concentrations of
RNA. Overall, these observations support a novel model in which the
initial steps of MuSV RNA dimerization are mediated by the G-rich
sequences and in which this initial interaction then raises the local
RNA concentration to a point at which interactions might occur between
the Pal sequences. Finally, we present data, obtained with a viral
vector system, that show that both the palindromic and the G-rich
sequences play an important role in maintaining efficient viral replication.
 |
MATERIALS AND METHODS |
Plasmid constructions.
The pLNBS plasmid contains the MuSV
DLS and a neomycin resistance gene. pLNBS is a modified version of the
pLNL6-based pLN plasmid (32). The modification involved
subcloning the retroviral sequences of pLN into a pBluescript II KS(+)
vector to permit a higher vector yield during propagation in
Escherichia coli (36). MuSV is a
replication-defective virus that was derived from MuLV and in which
most of the pol and env open reading frames have been replaced by that of the c-mos gene. The MuSV DLS
sequence possesses greater than 95% homology to that of the MuLV
(44). The nucleotides are numbered according to the MuSV
sequence recently submitted to GenBank (accession no. AF033813) (Fig.
1A and B).

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 1.
MuSV RNA sequences involved in dimerization. (A)
Representation of the MuSV genome. Numbering is with respect to the
viral mRNA, which begins at the transcriptional initiation site and
ends at the polyadenylation site (i.e., 5'R to 3'R) (GenBank accession
no. AF033813). Viral long terminal repeats, gag,
pol, and v-mos genes, and restriction
endonuclease cleavage sites are shown. (B) Diagram of the RNAs used in
this study. Gcon1, first consensus purine motif; Gcon2, second
consensus purine motif; G5 and G3, consecutive guanines; PBS, primer
binding site; SD, splice donor site; AUG, gag initiation
site. (C) Sequence of the DLS region of MuSV. The locations of
restriction sites of interest, the primer binding site (PBS), and the
splice donor site (SD) are indicated by lines above the sequence. Pal,
the consecutive guanines (G5 and G3), and the consensus purine motifs
(PuGGAPuA) are shown in boldface and are noted above the sequences. The
deletions of the Pal, G-rich, and first consensus purine motif
sequences are underlined.
|
|
By using PCR, DNA fragments were synthesized with the MuSV DLS region
of pLNBS as the template, a forward primer identical to the primer
binding site at nucleotide (nt) 105 and carrying a 5' EcoRI
site (5'GAATTCTGGGGGCTCGTCCGGGAT3'), and a reverse primer
beginning at position 557 (5'TATTTTCAGACAAATACAGAAAC3'). The
PCR products were then digested with EcoRI and
PstI (position 503) and cloned into the vector pGEM3Zf(+)
(Promega) behind its T7 promoter, which was used in transcribing the
inserted sequences. In a similar fashion, several deletion mutations
were constructed with primers that incorporated the desired deletions
(Fig. 1C) (20). The sequences of all the constructions were
confirmed by sequencing by the Sanger dideoxy termination method with
Sequenase 2.0 (USB).
Preparation of RNA samples.
Prior to transcription, template
DNAs (~2.0 µg) were linearized with various restriction enzymes
(PstI, BsiEI, and TthlllI) that
subsequently define the 3' ends of the products. The linearized DNAs
were phenol-chloroform extracted and ethanol precipitated, and the
pellets were resuspended in 2.0 µl of water. Transcription mixtures
(20 µl) contained 1.0 µg of DNA template, 0.5 mM (each) unlabeled
ATP, GTP, and UTP, 50 µM unlabeled CTP, and 2.5 µM
[
-32P]CTP. The reaction was carried out with a T7
MAXIscript kit as suggested by the manufacturer (Ambion). All RNA
transcripts starting at position 310 were the result of transcription
of PCR products of pLNBS with the forward primer carrying the T7
promoter sequence and the reverse primer as above.
RNA transcripts were separated by electrophoresis on 5%
polyacrylamide-8 M urea gels at 250 V for 2 h in 1× TBE buffer
(0.09
M Tris-borate, 0.002 M EDTA). RNA samples were eluted from the
gels with elution buffer as suggested by the manufacturer (Ambion).
The
purified RNAs were then ethanol precipitated, resuspended
in 100 µl
of diethylpyrocarbonate-treated water, and stored at

70°C. The
products were quantitated by counting in a Beckman
LS6500 scintillation
counter.
RNA dimerization assay.
For the dimerization assay, 8-µl
portions of ~1.5 nM [
-32P]RNA were heated at 95°C
for 3 min and chilled on ice for 3 min, and 2 µl of D5X buffer (500 mM NaCl, 250 mM Tris-HCl [pH 7]) was added. The samples were then
incubated at the temperatures indicated in the text for 1 h. At
the end of the incubation period, the samples were chilled and
separated by electrophoresis on 5% nondenaturing polyacrylamide gels
in the presence of 1× TBE buffer. The gels were dried and exposed
directly on a PhosphorImager screen for 18 to 20 h. The amount of
dimer formation was quantitated with a 445SI PhosphorImager system and
ImageQuaNT image analysis software. The fraction of RNA in dimeric form
was estimated by taking the ratio of the amount of dimeric RNA to the
amount of the sum of both the monomeric and dimeric species.
Concentration-dependent, time-dependent, and salt-dependent
measurements were made in a similar manner, varying the appropriate
parameters. In the salt-dependent dimerization assays of f587-985, the
reaction mixtures were incubated for 30 min rather than 1 h. The
time-dependent dimerization comparisons of f105-503, f105-503
Pal,
and f105-503
G5 were done in a manner similar to the standard
dimerization reaction, except that f105-503
Pal RNA was incubated at
50°C whereas the other RNAs were incubated at 60°C.
Cation-dependent thermal dissociation.
The RNA sample
f792-1040 (52.5 nM) was incubated for 3 h at 60°C in
dimerization buffer containing a final concentration of 100 mM NaCl and
50 mM Tris-HCl (pH 7). At the end of the incubation, the RNA was
precipitated by addition of 2 volumes of ethanol and 0.1 volume of 3 M
sodium acetate (pH 5.2), and after centrifugation, the pellet was
washed twice with 70% ethanol. After being dried, the RNA was
resuspended in water. Equal amounts of RNA (9.0 nM) were then diluted
into buffer to give final concentrations of 100 mM each monovalent salt
(LiCl, NaCl, KCl, RbCl, and CsCl) in 50 mM Tris-HCl (pH 7). The samples
were heated at temperatures ranging from 40 to 95°C, and aliquots
were taken out at 10-min intervals and chilled on ice until needed for
electrophoresis. For an untreated control, an equivalent sample of the
RNA was taken prior to temperature treatment. All samples were
separated on 5% nondenaturing polyacrylamide gels as described above.
Cell culture, transfections, and infections.
GP+E86 murine
ecotropic packaging cells (28) and NIH 3T3 murine fibroblast
cells (ATCC CRL 1658) were maintained in Dulbecco's modified Eagle's
medium containing high glucose (4.5 g/liter) and either 10% newborn
calf serum or 10% calf serum. Then 20 µg of wild-type or mutant
pLNBS DNAs were transfected into 5.0 × 105 GP+E86
cells in a 60-mm polystyrene dish by calcium phosphate precipitation
with a transfection kit (Gibco-BRL). The efficiency of transfection was
monitored by a colorimetric assay of secretory alkaline phosphatase
gene expression from the pCMV-SEAP (Tropix) vector, which was
cotransfected (0.25 µg) with the pLNBS vector. Virus particles in the
transfection supernatant collected 48 h posttransfection were
normalized to the level of the alkaline phosphatase gene expression and
used to infect 2.5 × 105 NIH 3T3 cells in the
presence of 8 µg of Polybrene per ml. Viral titers were determined on
these cells by measuring G418-resistant colony formation as described
previously (37). The deletions of the palindromic and the
G-rich stretches are outlined in Fig. 1C.
Psi was made by deleting
part of the
sequence from the SpeI site (position 243)
to the EcoRI site (41 nt upstream of the neo AUG site).
 |
RESULTS |
MuSV DLS dimerizes in a temperature-, concentration-, and
salt-dependent manner.
Initial experiments were designed to
evaluate the effects of reaction conditions on spontaneous dimerization
of the DLS region of MuSV RNA (Fig. 1). Dimerization of a 398-nt
fragment containing the Pal as well as purine-rich sequences
(f105-503) was optimal at 60°C and was not supported by temperatures
lower than 40°C or higher than 70°C (Fig.
2). In addition, we found that f105-503 dimer formation was RNA concentration, time, and salt dependent (data
not shown).

View larger version (96K):
[in this window]
[in a new window]
|
FIG. 2.
Pal is dispensable in dimer formation but is required to
stabilize the dimeric structure. (A) An RNA fragment lacking 10 of the
16 nt of Pal (f105-503 Pal) dimerizes less efficiently than the
full-length fragment (f105-503). (B) The RNA fragment containing Pal
alone (f105-310) does not form dimers [B(ii)], whereas [B(i)] one
lacking Pal but carrying the downstream sequence (f310-557) forms
dimers efficiently [B(i)]. M, monomeric RNA; D,
dimeric RNA; M1, monomeric f310-557 RNA; M2,
monomeric f105-310 RNA; , an RNA marker of 330 nt was transcribed
from the -globin gene (Ambion).
|
|
Neither the Pal sequences nor the consensus purine motifs
(PuGGAPuA) are required for dimerization.
RNAs lacking part or all
of the self-complementary sequence were tested to determine whether the
Pal sequence is required for dimer pairing (Fig. 2). The
f105-503
Pal fragment (Fig. 1A and C), which carries a deletion of
10 of the 16 nt of Pal, was still able to dimerize (Fig. 2A). The
optimal temperature for dimer formation of this fragment was 50°C,
10°C lower than that of the full-length f105-503 fragment (compare
lanes 2 and 6). Also, at optimal temperatures, f105-503
Pal
dimerized only 50% as efficiently as the full-length molecule did.
These observations imply that the palindromic sequence may help
stabilize dimeric RNA.
To examine whether the palindrome itself was sufficient for dimer
formation, an RNA fragment (f105-310) spanning the Pal sequence
was
tested under conditions identical to those used for the full-length
construct. Figure 2B(ii) shows that Pal alone was not sufficient
for
dimerization. In contrast, a downstream fragment (f310-557),
lacking
Pal altogether, dimerized in a manner similar to that
seen for the
full-length fragment [Fig. 2B(i)]. This region carries
multiple
purine-rich sequences (Fig.
1C).
A close examination of the f310-557 sequence reveals two stretches of
the consensus purine motif (GGGAGA [Gcon1] at positions
319 to 324 and AGGAGA [Gcon2] at positions 417 to 422)
(Fig.
1C).
Deletion of either one or both Gcon motifs did not inhibit
dimer
formation (Fig.
3), suggesting that
these phylogenetically conserved
sequences do not function in
dimerization.

View larger version (121K):
[in this window]
[in a new window]
|
FIG. 3.
The consensus purine motifs (Gcon) are dispensable in
MuSV dimerization. Temperature-dependent dimerization of RNA fragments
carrying deletions of either one [(A) and B(i)] or both [B(ii)]
motifs was carried out as described in Materials and Methods, except
that f310-557 Gcon1 was incubated for 30 min rather than 60 min.
|
|
At different concentrations of RNA, both guanine-rich and Pal
sequences promote dimerization.
The f310-557 sequence also
carries stretches of consecutive guanines at positions 340 to 344 (G5)
and 371 to 373 (G3) (Fig. 1C). Since similar G-rich sequences are
involved in initiating dimerization of HIV-1 DLS RNA (2,
48), the influence of these G-rich sequences was tested with MuSV
RNA. As shown in Fig. 4, the deletion of
either of these sequences virtually eliminated dimer formation. By
contrast, extending the RNA fragment carrying only Pal (f105-310),
which by itself did not dimerize [Fig. 2B(ii)], to include these two
G-rich sequences restored the ability of the fragment to dimerize
(f105-394) (Fig. 5A). No obvious
structural rearrangement was predicted for f105-310 compared to
f105-394 as calculated with MFold, a program to predict RNA secondary
structures based on free-energy minimization (data not shown) (52,
55). Moreover, when G5 or G3 was individually deleted from
f105-394, dimerization was severely diminished (Fig. 5B and C). The
percentage of dimeric RNA at optimal temperature was reduced from 65%
to as low as 15%. These data suggest that the G-rich stretches play an
important role in dimer formation.

View larger version (95K):
[in this window]
[in a new window]
|
FIG. 4.
The consecutive guanine stretches (G-rich) are essential
in MuSV dimerization. Dimerization of an RNA fragments carrying a
deletion of the five consecutive guanines (f310-557 G5) (A) and the
three consecutive guanines (f310-557 G3) (B) is severely inhibited.
L, the RNA marker of 300, 400, and 500 nt was transcribed from the
Century-Plus DNA templates (Ambion); M, monomeric RNA;
D, dimeric RNA.
|
|

View larger version (89K):
[in this window]
[in a new window]
|
FIG. 5.
The G-rich sequences downstream from Pal rescue the
dimerization defect of f105-310, and the deletions of the G-rich
sequences greatly diminish dimer formation. (A) An extended molecule
(f105-394) including Pal and downstream purine-rich sequences
dimerizes efficiently. (B and C) Dimers of f310-557 G5 (B) and of
f310-557 G3 (C) which lack the G-rich sequences are greatly reduced.
All samples were assayed under the same conditions and separated on the
same gel. L, the RNA marker of 300, 400, and 500 nt was transcribed
from Century-Plus DNA templates (Ambion); M, monomeric RNA;
D, dimeric RNA.
|
|
The observation that Pal is dispensable for RNA dimerization is at odds
with results obtained by others (
9,
10,
16,
23,
41,
49).
Since we used an assay system with 10
3-fold less viral RNA
than was used previously, we decided to examine
the effects of RNA
concentration on the role played by the different
determinants. In
these experiments, increasing amounts (0.25 to
2.0 µg, equivalent to
0.2 to 1.5 µM) of the identical but unlabeled
RNA were added to the
standard assay mixture containing a fixed
amount of
[

-
32P]RNA (1.5 nM). Figure
6A shows that although the fragment
carrying
Pal alone, f105-310, was not able to form dimers at 1.5 nM
(lane
2), it did dimerize at higher concentrations. A similar
experiment
was carried out with the full-length f105-503 fragment
(Fig.
6B).
The result mirrors the concentration dependence of the
shorter
fragment, except that a small amount of dimer was observed even
at the lowest RNA concentration (Fig.
6B, lane 2). These data
emphasize
that dimerization of Pal is concentration dependent
across the range of
concentrations tested. Also, the observation
that f105-310 RNA at 1.5 µM dimerized 10% less efficiently than
did the full-length f105-503
suggests that the dimeric structure
of this short fragment of RNA is
less stable than that of the
full-length molecule (Fig.
6A and B, lanes
6).

View larger version (87K):
[in this window]
[in a new window]
|
FIG. 6.
f105-310 dimerizes in a concentration-dependent manner.
[ -32P]RNA (1.5 nM) was incubated with increasing
amounts of unlabeled RNA at 60°C for 1 h before being separated
on a nondenaturing 5% polyacrylamide gel as described in Materials and
Methods. (A) f105-310 fragment. For this experiment, a 0.25-µg
addition in a 10-µl reaction mixture represents 3.8 × 104 nM RNA. (B) f105-503 fragment. All samples were
assayed under the same conditions and separated on the same gel.
M, monomeric RNA; D, dimeric RNA.
|
|
Dimers of the guanine-rich sequences are preferentially stabilized
by monovalent cations with the smallest radius.
DNA or RNA
containing runs of consecutive guanines may form four-stranded
structures (G tetrads) by the formation of Hoogsteen base pairs. These
structures are markedly stabilized by specific monovalent cations,
apparently by reducing the electrostatic repulsion of the bases across
the central tube of the molecules (6, 15, 19, 22, 54).
Depending on their primary sequence, dimers containing quartet
structures dissociate at various temperatures and also are stabilized
to various degrees in different monovalent cations. These
considerations prompted us to define the melting temperature of the
G-rich f310-557 RNA in the presence of different monovalent cations.
This RNA shows a preference for the cation with the smallest radius
(Li+) (Fig. 7). The melting
temperature of f310-557 in the presence of Li+ was higher
than 80°C, about 10°C higher than observed in the presence of
cations with larger radii. This preference for a small cation suggests
that DLS RNA forms an ordered structure which contains G tetrads.

View larger version (100K):
[in this window]
[in a new window]
|
FIG. 7.
The f310-557 dimeric structure is preferentially
stabilized by lithium cations. Samples of f310-557 RNA were allowed to
dimerize, and the dimers were precipitated, washed with ethanol, and
resuspended in water as described in Materials and Methods. Aliquots
were then incubated at 40 to 95°C in the presence of the indicated
salts. M, monomeric RNA; D, dimeric RNA; L, the
RNA marker of 300, 400, and 500 nt was transcribed from the
Century-Plus DNA templates (Ambion).
|
|
Viral replication is reduced by mutations in the Pal and G-rich
sequences.
Finally, we examined the relative roles played by the
Pal and G-rich elements of MuSV DLS in the context of a single round of
virus replication. To do this, sequences containing various mutations
were placed into the 5' leader region of pLNBS, an MuLV-MuSV-derived retroviral vector containing a neo gene. The effect of the
mutations on vector production following transfection into the GP+E86
retroviral packaging cell line was determined. The results obtained
from three independent experiments for each of the mutants indicate the
replication ability of each of the viral constructs (Fig. 1C) relative
to the wild type (Table 1). While
deletion of either the Pal sequence (
Pal) or the G-rich stretches
(
G5 or
G3) alone slightly reduced the titer of the virus,
deletion of both signals (
Pal/
G5 or
Pal/
G3) produced up to
a sevenfold-reduction in titer. Also, there was an additive effect of
viral reduction when both signals were deleted. These data demonstrate
that both the Pal and G-rich sequences play important roles in the MuSV
viral life cycle.
 |
DISCUSSION |
Several lines of observations have been made that support a
two-stage model of MuSV-RNA dimerization. First, G-rich sequences, and
not the phylogenetically conserved purine-rich motifs, drive the
initial dimer formation, perhaps via the formation of an ordered quartet structure. Second, kissing-loop interactions are highly concentration dependent and their formation stabilizes RNA dimers. Finally, our data suggest that the G-rich stretches are as important as
the Pal sequence in viral replication.
Girard et al. demonstrated that the rate constant for MuLV RNA
dimerization is between 2 × 102 and 7 × 103 M
1 s
1, significantly lower
than that expected for annealing of complementary oligonucleotides
(16). This observation suggests that the Watson-Crick base
pairing implicit in the kissing-loop model may not be the only factor
responsible for dimer formation. Recently, Tapia et al. indicated that
although Pal sequences are important in promoting dimerization of MuLV
RNA, this interaction occurs slowly and is kinetically enhanced by
downstream sequences (49). It is worth noting that the
consecutive guanine stretches are located downstream of the Pal
sequence and may serve to enhance dimer formation.
The enhanced stability of the MuSV dimers in the presence of
Li+ supports a role for the guanines in quartet-structure
formation (Fig. 7). Also, Torrent et al. found that the VL30 dimeric
RNA was stabilized in the presence of LiCl (50), and similar
results were obtained with RSV RNA (25). In contrast, the
proposed HIV-1 quartet structure is stabilized by KCl and is thought to
involve the phylogenetically conserved purine-rich motifs (PuGGAPuA)
(1, 48). These differences in the stabilizing cation,
Li+ versus K+, may reflect structural
differences: deletion of the MuSV consensus purine-rich motifs did not
affect dimerization (Fig. 3). Similarly, the deletion of all five
consensus purine motifs in the HIV-2 DLS did not alter the level of
dimerization (5).
An important finding of this study is the demonstration that the
influence of the Pal and the G-rich regions on dimerization varies with
concentration. While RNA fragments carrying the G-rich regions
effectively dimerized at low, possibly more physiologically relevant,
concentrations, RNA fragments carrying the Pal sequence alone paired at
only very high concentrations [Fig. 2B(ii) and 6A]. The observation
of MuSV Pal sequence dimerization at high concentrations corroborates
the features of MuLV Pal sequence dimerization observed by others
(42, 43). In addition, it appears that the kissing loop
serves as an important factor in determining dimer stability (Fig. 2A).
Our findings are also consistent with the observation that
uncharacterized sequences downstream from the kissing loop in MuLV play
a role in dimer stability (49).
Viral replication assays with a vector system carrying the MuSV
region show that removal of either the Pal or the G-rich sequence
affects viral replication. Of note, deletions of both signals (Pal and
G-rich sequences) reduced viral production to a much greater extent
than did deletion of either sequence alone (Table 1). These data
corroborate recent observations indicating a dispensable but
nonetheless significant role of the Pal sequence in several other viral
systems. It was previously noted that Pal mutations affect steps other
than dimerization in the viral life cycle (40). For
instance, mutations in the palindrome of HIV-1 decreased viral
infectivity (8, 24, 26, 39) and slowed viral replication
(4, 18, 39). Most characteristically, the palindromic
mutations greatly affected RNA encapsidation (4, 7, 8, 24, 30, 31,
39) and the synthesis of proviral DNA (39). However,
no effect of these mutations on the synthesis of viral proteins
(4) or the genomic RNA dimers isolated from the virions
(7, 24, 45) was observed. Similarly, Mougel et al. found
that a deletion spanning the Pal sequence in an MuLV vector moderately
reduced viral RNA encapsidation and reverse transcription of the
genomic RNA (33). Recently, Doria-Rose and Vogt observed
that the Pal sequence is preferred but not required to maintain stable
viral replication in RSV (11).
Overall, our data support a role for both the previously identified Pal
region as well as two stretches of downstream guanines in retroviral
dimerization. Mutational analysis points to the G-rich sequences as
important determinants of dimer formation. The results presented here
further indicate that the Pal sequences also act in the dimerization
process, most probably by stabilizing the structure (Fig. 2A). It
appears that the roles played by these determinants differ at different
concentrations of RNA. At low concentrations of RNA, the G-rich regions
appeared to be necessary for dimerization and the Pal sequence
dispensable; fragments containing only the Pal regions could support
dimerization at higher concentrations of RNA (Fig. 6A). These data
suggest a two-stage model for MuSV dimerization in which the initial,
low-concentration interaction between RNA molecules is mediated by the
G-rich regions. This interaction may act to increase the local
concentration of RNA, thereby facilitating base pairing of the Pal
sequences to stabilize the dimer linkage structure. Similar strategies
may be used by other viral systems to induce stable dimer formation
(13, 14, 47).
Our viral infectivity data provide, for the first time, direct evidence
that in addition to Pal, the guanine stretches play important
functional roles in dimerization and/or other steps of the viral life
cycle. Although we have identified the importance of both molecular
determinants in efficient MuSV replication, the mechanisms through
which the mutations exert their effect remain unknown. We are currently
examining in more detail the precise biological and molecular roles of
these elements.
 |
ACKNOWLEDGMENTS |
This work was supported by NIH grant K11 AI01107 to A.H.K. and a
seed grant from the UCLA AIDS Institute to D.P.N. H.L. was supported in part by the UCLA Presidential Research Fellowship, the
College Honors Naumburg Research Scholarship, and the AAP Drown
Foundation Research Scholarship.
We thank John Sechelski, Nan N. Lee, Amy T. A. Tran, Liza Kim,
Yanli Yang, and James Matsunaga for their help. We also thank Steve
Pettit for his critical reading of the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: CB#7030, 547 Burnett-Womack, UNC-Chapel Hill, Chapel Hill, NC 27599-7030. Phone:
(919) 966-2536. Fax: (919) 966-6714. E-mail:
akaplan{at}med.unc.edu.
 |
REFERENCES |
| 1.
|
Awang, G., and D. Sen.
1993.
Mode of dimerization of HIV-1 genomic RNA.
Biochemistry
32:11453-11457[Medline].
|
| 2.
|
Baudin, F.,
R. Marquet,
C. Isel,
J.-L. Darlix,
B. Ehresmann, and C. Ehresmann.
1993.
Functional sites in the 5' region of human immunodeficiency virus type 1 RNA from defined structural domains.
J. Mol. Biol.
229:382-397[Medline].
|
| 3.
|
Bender, W.,
Y.-H. Chien,
S. Chattopadhyay,
P. K. Vogt,
M. B. Gardner, and N. Davidson.
1978.
High-molecular-weight RNAs of AKR, NZB, and wild mouse viruses and avian reticuloendotheliosis virus all have similar dimer structures.
J. Virol.
25:888-896[Abstract/Free Full Text].
|
| 4.
|
Berkhout, B., and J. L. van Wamel.
1996.
Role of the DIS hairpin in replication of human immunodeficiency virus type 1.
J. Virol.
70:6723-6732[Abstract/Free Full Text].
|
| 5.
|
Berkhout, B.,
B. B. Oude Essink, and I. Schneveld.
1993.
In vitro dimerization of HIV-2 leader RNA in the absence of PuGGAPuA motifs.
FASEB J.
7:181-187[Abstract].
|
| 6.
|
Cheong, C., and P. B. Moore.
1992.
Solution structure of an unusually stable RNA tetraplex containing G- and U-quartet structures.
Biochemistry
31:8406-8414[Medline].
|
| 7.
|
Clever, J. L.,
M. L. Wong, and T. G. Parslow.
1996.
Requirements for kissing-loop-mediated dimerization of human immunodeficiency virus RNA.
J. Virol.
70:5902-5908[Abstract/Free Full Text].
|
| 8.
|
Clever, J. L., and T. G. Parslow.
1997.
Mutant human immunodeficiency virus type 1 genomes with defects in RNA dimerization or encapsidation.
J. Virol.
71:3407-3414[Abstract/Free Full Text].
|
| 9.
|
Darlix, J.-L.
1990.
Cis elements and trans-acting factors involved in dimer formation of murine leukemia virus RNA.
J. Virol.
64:774-783[Abstract/Free Full Text].
|
| 10.
|
Darlix, J.-L.,
C. Gabus,
M.-T. Nugeyre,
F. Clavel, and F. Barre-Sinoussi.
1990.
cis elements and trans-acting factors involved in the RNA dimerization of the human immunodeficiency virus HIV-1.
J. Mol. Biol.
216:689-699[Medline].
|
| 11.
|
Doria-Rose, N., and V. M. Vogt.
1998.
In vivo selection of Rous sarcoma virus mutants with randomized sequences in the packaging signal.
J. Virol.
72:8073-8082[Abstract/Free Full Text].
|
| 12.
|
Feng, Y. X.,
W. Fu,
A. J. Winter,
J. G. Levin, and A. Rein.
1995.
Multiple regions of Harvey sarcoma virus RNA can dimerize in vitro.
J. Virol.
69:2486-2490[Abstract/Free Full Text].
|
| 13.
|
Fu, W., and A. Rein.
1993.
Maturation of dimeric viral RNA of Moloney murine leukemia virus.
J. Virol.
67:5443-5449[Abstract/Free Full Text].
|
| 14.
|
Fu, W.,
R. J. Gorelick, and A. Rein.
1994.
Characterization of human immunodeficiency virus type 1 dimeric RNA from wild-type and protease-defective virions.
J. Virol.
68:5013-5018[Abstract/Free Full Text].
|
| 15.
|
Gellert, M.,
M. N. Lipsett, and D. R. Davies.
1962.
Helix formation by guanylic acid.
Proc. Natl. Acad. Sci. USA
48:2013-2018[Free Full Text].
|
| 16.
|
Girard, P. M.,
B. Bonnet-Mathoniere,
D. Muriaux, and J. Paoletti.
1995.
A short autocomplementary sequence in the 5' leader region is responsible for dimerization of MoMuLV genomic RNA.
Biochemistry
34:9785-9794[Medline].
|
| 17.
|
Girard, P. M.,
H. de Rocquigny,
B. P. Roques, and J. Paoletti.
1996.
A model of psi dimerization: destabilization of the C278-G303 stem-loop by the nucleocapsid protein (NCp10) of MoMuLV.
Biochemistry
35:8705-8714[Medline].
|
| 18.
|
Haddrick, M.,
A. L. Lear,
A. J. Cann, and S. Heaphy.
1996.
Evidence that a kissing loop structure facilitates genomic RNA dimerization in HIV-1.
J. Mol. Biol.
259:58-68[Medline].
|
| 19.
|
Hud, N. V.,
F. W. Smith,
F. A. Anet, and J. Feigon.
1996.
The selectivity for K+ versus Na+ in DNA quadruplexes is dominated by relative free energies of hydration: a thermodynamic analysis by 1H NMR.
Biochemistry
35:15383-15390[Medline].
|
| 20.
|
Kunkel, T. A.,
K. Bebenek, and J. McClary.
1991.
Efficient site-directed mutagenesis using uracil-containing DNA.
Methods Enzymol.
204:125-139[Medline].
|
| 21.
|
Kung, H. J.,
S. Hu,
W. Bender,
J. M. Bailey,
N. Davidson,
M. O. Nicolson, and R. M. McAllister.
1976.
RD-114, baboon, and wolly monkey viral RNAs compared in size and structure.
Cell
7:609-620[Medline].
|
| 22.
|
Laughlan, G.,
A. I. Murchie,
D. G. Norman,
M. H. Moore,
P. C. Moody,
D. M. Lilley, and B. Luisi.
1994.
The high-resolution crystal structure of a parallel-stranded guanine tetraplex.
Science
265:520-524[Abstract/Free Full Text].
|
| 23.
|
Laughrea, M., and L. Jette.
1994.
A 19-nucleotide sequence upstream of the 5' major splice donor is part of the dimerization domain of human immunodeficiency virus 1 genomic RNA.
Biochemistry
33:13464-13474[Medline].
|
| 24.
|
Laughrea, M.,
L. Jette,
J. Mak,
L. Kleiman,
C. Liang, and M. A. Wainberg.
1997.
Mutations in the kissing-loop hairpin of human immunodeficiency virus type 1 reduce viral infectivity as well as genomic RNA packaging and dimerization.
J. Virol.
71:3397-3406[Abstract/Free Full Text].
|
| 25.
|
Lear, A. L.,
M. Haddrick, and S. Heaphy.
1995.
A study of the dimerization of Rous sarcoma virus RNA in vitro and in vivo.
Virology
212:47-57[Medline].
|
| 26.
|
Louis, D. C.,
D. Gotte,
E. Sanders-Buell,
D. W. Ritchey,
M. O. Salminen,
J. K. Carr, and F. E. McCutchan.
1998.
Infectious molecular clones with the nonhomologous dimer initiation sequences found in different subtypes of human immunodeficiency virus type 1 can recombine and initiate a spreading infection in vitro.
J. Virol.
72:3991-3998[Abstract/Free Full Text].
|
| 27.
|
Maisel, J.,
W. Bender,
S. Hu,
P. H. Duesberg, and N. Davidson.
1978.
Structure of 50 to 70S RNA from Moloney sarcoma viruses.
J. Virol.
25:384-394[Abstract/Free Full Text].
|
| 28.
|
Markowitz, D.,
S. Goff, and A. Bank.
1988.
A safe packaging cell line for gene transfer: separating viral genes on two different plasmids.
J. Virol.
62:1120-1124[Abstract/Free Full Text].
|
| 29.
|
Marquet, R.,
F. Baudin,
C. Gabus,
J.-L. Darlix,
M. Mougel,
C. Ehresmann, and B. Ehresmann.
1991.
Dimerization of human immunodeficiency virus (type 1) RNA: stimulation by cations and possible mechanism.
Nucleic Acids Res.
91:2349-2357.
|
| 30.
|
McBride, M. S., and A. T. Panganiban.
1996.
The human immunodeficiency virus type 1 encapsidation site is a multipartite RNA element composed of functional hairpin structures.
J. Virol.
70:2963-2973[Abstract/Free Full Text].
|
| 31.
|
McBride, M. S.,
M. D. Schwartz, and A. T. Panganiban.
1997.
Efficient encapsidation of human immunodeficiency virus type 1 vectors and further characterization of cis elements required for encapsidation.
J. Virol.
71:4544-4554[Abstract/Free Full Text].
|
| 32.
|
Adam, M. A., and D. Miller.
1988.
Identification of a singnal in a murine retrovirus that is sufficient for packagaing of nonretroviral RNA into virions.
J. Virol.
62:3802-3806[Abstract/Free Full Text].
|
| 33.
|
Mougel, M.,
Y. Zhang, and E. Barklis.
1996.
cis-active structural motifs involved in specific encapsidation of Moloney murine leukemia virus RNA.
J. Virol.
70:5043-5050[Abstract/Free Full Text].
|
| 34.
|
Muriaux, D.,
P.-M. Girard,
B. Bonnet-Mathoniere, and J. Paoletti.
1995.
Dimerization of HIV-1Lai RNA at low ionic strength: an autocomplementary sequence in the 5' leader region is evidenced by an antisense oligonucleotide.
J. Biol. Chem.
270:8209-8216[Abstract/Free Full Text].
|
| 35.
|
Murti, K. G.,
M. Bondurant, and A. Tereba.
1981.
Secondary structural features in the 70S RNAs of Moloney murine leukemia and Rous sarcoma viruses as observed by electron microscopy.
J. Virol.
37:411-419[Abstract/Free Full Text].
|
| 36.
| Olsen, J. C. Unpublished data.
|
| 37.
|
Olsen, J. C., and J. Sechelski.
1995.
Use of sodium butyrate to enhance production of retroviral vectors expressing CFTR cDNA.
Hum. Gene Ther.
6:1195-1202[Medline].
|
| 38.
|
Paillart, J. C.,
R. Marquet,
E. Skripkin,
B. Ehresmann, and C. Ehresmann.
1994.
Mutational analysis of the bipartite dimer linkage structure of human immunodeficiency virus type 1 genomic RNA.
J. Biol. Chem.
269:27486-27493[Abstract/Free Full Text].
|
| 39.
|
Paillart, J. C.,
L. Berthoux,
M. Ottmann,
J. L. Darlix,
R. Marquet,
B. Ehresmann, and C. Ehresmann.
1996.
A dual role of the putative RNA dimerization initiation site of human immunodeficiency virus type 1 in genomic RNA packaging and proviral DNA synthesis.
J. Virol.
70:8348-8354[Abstract/Free Full Text].
|
| 40.
|
Paillart, J. C.,
R. Marquet,
E. Skripkin,
C. Ehresmann, and B. Ehresmann.
1996.
Dimerization of retroviral genomic RNAs: structural and functional implications.
Biochimie
78:639-653[Medline].
|
| 41.
|
Paillart, J. C.,
E. Skripkin,
B. Ehresmann,
C. Ehresmann, and R. Marquet.
1996.
A loop-loop "kissing" complex is the essential part of the dimer linkage of genomic HIV-1 RNA.
Proc. Natl. Acad. Sci. USA
93:5572-5577[Abstract/Free Full Text].
|
| 42.
|
Paoletti, J.,
M. Mougel,
N. Tounekti,
P. M. Girard,
C. Ehresmann, and B. Ehresmann.
1993.
Spontaneous dimerization of retroviral MoMuLV RNA.
Biochimie
75:681-686[Medline].
|
| 43.
|
Prats, A.-C.,
C. Roy,
P. Wan,
M. Erard,
V. Housset,
C. Gabus,
C. Paoletti, and J. L. Darlix.
1990.
cis-elements and trans-acting factors involved in dimer formation of murine leukemia virus RNA.
J. Virol.
64:774-783.
|
| 44.
|
Reddy, P. E.,
M. J. Smith, and S. A. Aaroson.
1981.
Complete nucleotide sequence and organization of the Moloney murine sarcoma virus genome.
Science
214:445-450[Abstract/Free Full Text].
|
| 45.
|
Sakuragi, J.-I., and A. T. Panganiban.
1997.
Human immunodeficiency virus type 1 RNA outside the primary encapsidation and dimer linkage region affects RNA dimer stability in vivo.
J. Virol.
71:3250-3254[Abstract/Free Full Text].
|
| 46.
|
Skripkin, E.,
J. C. Paillart,
R. Marquet,
B. Ehresmann, and C. Ehresmann.
1994.
Identification of the primary site of the human immunodeficiency virus type 1 RNA dimerization in vitro.
Proc. Natl. Acad. Sci. USA
91:4945-4949[Abstract/Free Full Text].
|
| 47.
|
Stoltzfus, C. M., and P. N. Snyder.
1975.
Structure of B77 sarcoma virus RNA: stabilization of RNA after packaging.
J. Virol.
16:1161-1170[Abstract/Free Full Text].
|
| 48.
|
Sundquist, W. I., and S. Heaphy.
1993.
Evidence for interstrand quadruplex formation in the dimerization of human immunodeficiency virus type 1 genomic RNA.
Proc. Natl. Acad. Sci. USA
90:3393-3397[Abstract/Free Full Text].
|
| 49.
|
Tapia, M. D.,
V. Metzler,
M. Mougel,
B. Ehresmann, and C. Ehresmann.
1998.
Dimerization of MoMuLV genomic RNA: redefinition of the role of the plaindromic stem-loop H1 (278-303) and new roles for stem-loops H2 (310-352) and H3 (355-374).
Biochemistry
37:6077-6085[Medline].
|
| 50.
|
Torrent, C.,
T. Bordet, and J. L. Darlix.
1994.
Analytical study of rat retrotransposon VL30 RNA dimerization in vitro and packaging in murine leukemia virus.
J. Mol. Biol.
240:434-444[Medline].
|
| 51.
|
Torrent, C.,
C. Gabus, and J. L. Darlix.
1994.
A small and efficient dimerization/packaging signal of rat VL30 RNA and its use in murine leukemia virus-VL30-derived vectors for gene transfer.
J. Virol.
68:661-667[Abstract/Free Full Text].
|
| 52.
|
Tounekti, N.,
M. Mougel,
C. Roy,
R. Marquet,
J.-L. Darlix,
J. Paoletti,
B. Ehresmann, and C. Ehresmann.
1992.
Effect of dimerization on the conformation of the encapsidation Psi domain of Moloney murine leukemia virus RNA.
J. Mol. Biol.
223:205-220[Medline].
|
| 53.
|
Wang, Y., and D. J. Patel.
1993.
Solution structure of the human telomeric repeat d[AG3(T2AG3)3] G-tetraplex.
Structure
1:263-282[Medline].
|
| 54.
|
Williamson, J. R.,
M. K. Raghuraman, and T. R. Cech.
1989.
Monovalent cation-induced structure of telomeric DNA: the G-quartet model.
Cell
59:871-880[Medline].
|
| 55.
|
Zuker, M.
1989.
On finding all suboptimal foldings of an RNA molecule.
Science
244:48-52[Abstract/Free Full Text].
|
Journal of Virology, September 1999, p. 7255-7261, Vol. 73, No. 9
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Shen, W., Gao, L., Balakrishnan, M., Bambara, R. A.
(2009). A Recombination Hot Spot in HIV-1 Contains Guanosine Runs That Can Form a G-quartet Structure and Promote Strand Transfer in Vitro. J. Biol. Chem.
284: 33883-33893
[Abstract]
[Full Text]
-
Gherghe, C., Weeks, K. M.
(2006). The SL1-SL2 (Stem-Loop) Domain Is the Primary Determinant for Stability of the Gamma Retroviral Genomic RNA Dimer. J. Biol. Chem.
281: 37952-37961
[Abstract]
[Full Text]
-
Beasley, B. E., Hu, W.-S.
(2002). cis-Acting Elements Important for Retroviral RNA Packaging Specificity. J. Virol.
76: 4950-4960
[Abstract]
[Full Text]
-
Ly, H., Parslow, T. G.
(2002). Bipartite Signal for Genomic RNA Dimerization in Moloney Murine Leukemia Virus. J. Virol.
76: 3135-3144
[Abstract]
[Full Text]
-
Cain, D., Erlwein, O., Grigg, A., Russell, R. A., McClure, M. O.
(2001). Palindromic Sequence Plays a Critical Role in Human Foamy Virus Dimerization. J. Virol.
75: 3731-3739
[Abstract]
[Full Text]
-
Ly, H., Nierlich, D. P., Olsen, J. C., Kaplan, A. H.
(2000). Functional Characterization of the Dimer Linkage Structure RNA of Moloney Murine Sarcoma Virus. J. Virol.
74: 9937-9945
[Abstract]
[Full Text]
-
Jossinet, F., Lodmell, J. S., Ehresmann, C., Ehresmann, B., Marquet, R.
(2001). Identification of the in Vitro HIV-2/SIV RNA Dimerization Site Reveals Striking Differences with HIV-1. J. Biol. Chem.
276: 5598-5604
[Abstract]
[Full Text]