Previous Article | Next Article 
Journal of Virology, September 1999, p. 7210-7217, Vol. 73, No. 9
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
An Endoplasmic Reticulum Retrieval Signal
Partitions Human Foamy Virus Maturation to Intracytoplasmic
Membranes
Paul A.
Goepfert,1,2,*
Kit
Shaw,2
George
Wang,2
Anju
Bansal,2
Bradley H.
Edwards,1 and
Mark J.
Mulligan1,2
Departments of
Medicine1 and
Microbiology,2 University of Alabama at
Birmingham, Birmingham, Alabama 35294-2170
Received 1 February 1999/Accepted 8 May 1999
 |
ABSTRACT |
Among all retroviruses, foamy viruses (FVs) are unique in that they
regularly mature at intracytoplasmic membranes. The envelope glycoprotein of FV encodes an endoplasmic reticulum (ER) retrieval signal, the dilysine motif (KKXX), that functions to localize the human
FV (HFV) glycoprotein to the ER. This study analyzed the function of
the dilysine motif in the context of infectious molecular clones of HFV
that encoded mutations in the dilysine motif. Electron microscopy (EM)
demonstrated virion budding both intracytoplasmically and at the plasma
membrane for the wild-type and mutant viruses. Additionally, mutant
viruses retained their infectivity, but viruses lacking the dilysine
signal budded at the plasma membrane to a greater extent than did
wild-type viruses. Interestingly, this relative increase in budding
across the plasma membrane did not increase the overall release of
viral particles into cell culture media as measured by protein levels
in viral pellets or infectious virus titers. We conclude that the
dilysine motif of HFV imposes a partial restriction on the site of
viral maturation but is not necessary for viral infectivity.
 |
INTRODUCTION |
All retroviruses encode for type 1 transmembrane glycoproteins translated at the surface of the rough
endoplasmic reticulum (ER) as a polyprotein precursor. For the majority
of retroviruses, the newly synthesized glycoproteins are transported
from the ER through the Golgi complex and to the plasma membrane.
Glycoprotein folding, carbohydrate modification, and cleavage into
surface (SU) and transmembrane (TM) subunits occur during transit to
the cell surface. These glycoprotein modifications are necessary for viral replication and infectivity (for a review, see reference 15).
Foamy viruses (FVs), or spumaviruses, exhibit several unusual
characteristics compared to all the other known members of the retrovirus family (33, 34). Furthermore, recent studies
suggested that FVs utilize assembly strategies much more reminiscent of hepadnaviruses. In addition to similarities seen for the internal structural proteins and the SU proteins (7, 12, 20a, 37, 41, 44,
45), both FVs and hepadnaviruses bud predominantly intracellularly, both encode for an ER retrieval signal in their glycoproteins, and both require SU glycoproteins for viral release from
the cell (1, 4, 8, 12, 13, 18, 29). For other retroviruses,
intracytoplasmic budding is an unusual event; Gag alone is able to
direct particle budding in the absence of Env (10, 38, 42);
and a putative ER retrieval signal has not been identified for any
other retroviral glycoprotein.
Since FVs were known to bud into the ER, we hypothesized that their
glycoproteins must contain an ER sorting signal (13). The
dilysine motif (KKXX) was one such signal known to function for ER
retrieval of type 1 transmembrane glycoproteins (17). Nevertheless, it was surprising that a dilysine motif was encoded by
the TM glycoprotein of all sequenced FVs (13, 41, 43). The
dilysine motif consists of lysines at position
3 and either position
4 or
5 with respect to the carboxy terminus of the glycoprotein
(17). Glycoproteins containing the dilysine signal resist
bulk transport to the plasma membrane and are retrieved from post-ER
compartments to the ER by cytosolic coat proteins (5, 20).
We previously reported that recombinant human FV (HFV) glycoproteins
were sorted to the ER, a function that was mediated by the dilysine
motif (12). In the present study, we attempted to define the
role of the dilysine motif in the replication of FVs. By constructing
infectious clones of HFV containing mutations in the dilysine motif, we
found that mutant viruses matured at the plasma membrane to a greater
extent than wild-type virus.
 |
MATERIALS AND METHODS |
Cells, transfections, and virus stock preparation.
Canine
thymocytes (CF2Th cells) (kindly provided by T. Folks), baby hamster
kidney (BHK-21) cells, and FV-activated
-gal (FAB) cells (kindly
provided by M. Linial; see below for description) were maintained in
Dulbecco's modified Eagle medium (DMEM) supplemented with 5 to 10%
fetal bovine serum. Transfections were performed by the LipofectAmine
method (Gibco Life Technologies, Grand Island, N.Y.) according to the
manufacturer's instructions. Seven days after transfection of BHK-21
cells, cells in medium were scraped from the culture dishes. The cells
and the media underwent three cycles of freezing and thawing in order
to release the virus. The viral titers were then determined by the FAB
assay as described below.
Constructs of HFV DNA.
Construction of pSVL-KKS and pSVL-SSS
has been previously described (12). These two env
constructs encode for HFV envelope glycoproteins containing mutations
to the ER retrieval signal under the control of a simian virus 40 promoter. All mutations were confirmed by dideoxynucleotide sequencing
of the mutagenesis plasmid pALTER and within pSVL (36). To
construct mutant full-length HFV clones, a 1,032-bp SpeI
restriction fragment was isolated from pHSRV1-Mod (a wild-type HFV DNA
clone that was provided by A. Rethwilm) and ligated into the
SpeI restriction site of pSVL-KKS or pSVL-SSS. A
3,489-bp EcoRI restriction fragment from either pSVL-KKS or
pSVL-SSS was then exchanged with the 3,489-bp EcoRI restriction fragment of pHSRV1-Mod to produce the mutant HFV DNA plasmids, pMod-KKS or pMod-SSS. Construction of pMod-RRR infectious clone was performed as follows: the PCR primers
5'-ACTGCCCAAGGAATATTTGGAACTGCCTT and
5'-ACGGGATCCGAATTCCAGAGGTGGAGGCTACTGATTCCTCCTTCTCGTAGG
contained XcmI or BamHI restriction sites,
respectively, with the latter primer predicted to encode three
arginines (RRR) in place of the three lysines (KKK) of the ER retrieval
signal. A pSP72 plasmid containing the wild-type env of HFV
(11) was PCR amplified by using the above primers. The
products were digested with XcmI and BamHI and
cloned back into the same sites of plasmid pSP72. An EcoRI
restriction fragment of this plasmid was then exchanged with pHSRV1-Mod
as above to produce pMod-RRR. Virus stocks prepared after transfections
with the plasmids were designated wild-type HFV, HFV-KKS, HFV-SSS, and
HFV-RRR.
RIPA and Western blot assays.
The radioimmunoprecipitation
assay (RIPA) was performed as previously described (11, 12,
26-28). Briefly, CF2Th or BHK-21 cells were labeled with
[35S]cysteine and [35S]methionine 3.5 days
after infection (multiplicity of infection [MOI] of 0.5 or 1). After
radiolabeling and chase, the cells were lysed, and the medium was
filtered through a 0.45-µm-pore-size filter and centrifuged through a
20% sucrose cushion. The cell lysates or pelleted material were
immunoprecipitated with chimpanzee serum and protein A-agarose at 4°C
overnight. Adult chimpanzees have a high prevalence of infection with
FVs (14, 30), and all chimpanzee plasma samples used in
these experiments were tested by RIPA to be certain that they reacted
with the envelope and Gag proteins of HFV (11). The agarose
beads were then washed and boiled in sodium dodecyl sulfate (SDS) for 5 min, and the immunoprecipitated proteins were characterized by
SDS-polyacrylamide gel electrophoresis (PAGE) (19) on a 10%
gel and autoradiography. Western blot assays were performed by
harvesting cell lysate or pelleted virus as described above. After
separation by SDS-PAGE on a 10 or 12% gel, the proteins were
transferred onto a nitrocellulose membrane. Western blotting was
performed using the Amersham ECL (enhanced chemiluminescence) detection
system (Amersham Life Science, Arlington Heights, Ill.). Chimpanzee
plasma and anti-human immunoglobulin G conjugated to horseradish
peroxidase were used for antibody reagents.
Reverse transcriptase (RT) assay.
BHK-21 cells were infected
at day 0 (MOI of 0.5) with wild-type HFV, HFV-SSS, or HFV-RRR. At the
indicated times, 100 µl of supernatant was transferred from each of
the infected cell cultures onto a 96-well plate; 75 µl of reaction
cocktail {1 M Tris HCl (pH 8.0), 1 M dithiothreitol, 1 M
Mn2+, 1 M KCl, 10% Triton X-100, 100 mM EGTA (pH 8.0), 1 µg of poly(dA-dT) per µl, 5 µCi [35S]TTP} was
added to the wells, and the solution was incubated at 37°C for 90 min. The reaction was stopped by adding 50 µl of 200 mM sodium
pyrophosphate. Samples were adsorbed onto NA45 filter paper and air
dried. After the filter was washed twice in 0.5 M NaPO4,
counts were measured with the AMBIS radioanalytic detection system
(AMBIS Systems, Inc., San Diego, Calif.).
Infectivity assay.
FAB cells contain the
-galactosidase
gene under the control of the HFV long terminal repeat; only cells
infected with HFV will express the transactivating protein (Bel-1 or
Tas) necessary for expression of
-galactosidase. BHK-21 cells were
infected (MOI of 0.5) at day 0 with wild-type HFV, HFV-KKS, or HFV-RRR; cell supernatants were collected at 2, 4, or 6 days after infection. The FAB assay was performed as previously described (46). At the indicated times, cells were incubated with dilutions of virus (resuspended in DMEM) for 2 h at 37°C; the virus was removed and replaced with DMEM containing 5% fetal bovine serum. Two days after
infection, the cell monolayers were fixed (0.5% glutaraldehyde in
phosphate-buffered saline [PBS]) for 5 min and washed three times
with PBS. The cells were then incubated 4 to 16 h at 37°C with
staining solution (4 mM potassium ferrocyanide, 4 mM potassium ferricyanide, 2 mM MgCl2, 0.4 mg of
5-bromo-4-chloro-3-indolyl-
-D-galactopyranosidase [X-gal] per ml). After the staining solution was removed
and the cells were washed with PBS, the number of blue cells per well was determined under a light microscope.
EM.
CF2Th cells were infected with wild-type HFV, HFV-KKS,
or HFV-SSS. Four days after infection, the culture media were removed and the cells were washed twice with PBS. The cells were subsequently fixed (1% glutaraldehyde) for 1 h and stored in PBS solution for analysis by electron microscopy (EM).
Sequencing of viral RNA.
BHK-21 cells were infected with
wild-type HFV, HFV-KKS, or HFV-SSS. Virus was harvested from infected
cells after 7 days and used to infect fresh cells. After
nine passages (9 weeks), total mRNA was isolated with Tri-Reagent
(Molecular Research Center, Inc., Cincinnati, Ohio) and reverse
transcribed with Superscript RT (Gibco BRL). The resulting DNA was then
amplified by PCR using primers (5'-GCTGAGCTCCTTCGACTGG-3'
and 5'-CTCATTTCCTCTGGTGTGG-3') that flank the
nucleotides encoding for the ER retrieval signal. The products were gel
purified and sequenced with a Perkin Elmer-Applied Biosystems model 377 automated sequencer.
 |
RESULTS |
The ER retrieval signal directed HFV budding to intracellular
membranes.
We previously demonstrated that recombinant HFV
glycoproteins containing dilysine motif mutations were expressed to a
greater degree at the cell surface (3, 12). For several
enveloped viruses, including human immunodeficiency virus type 1, (HIV-1), the membrane site of glycoprotein localization determined the site of viral budding (21, 31, 39). We hypothesized that infectious clones lacking a complete ER retrieval signal in the glycoprotein should bud preferentially from the plasma membrane. To
investigate the role of the dilysine motif in viral budding, we
engineered infectious molecular clones of HFV which encode dilysine
motif mutations (Fig. 1). Because the
lysine at position
3 is essential for efficient ER retrieval of the
glycoprotein (12), we substituted an env gene
that encoded a mutation of the lysine at
3 (KKS) into the infectious
wild-type clone pHSRV1-Mod (Fig. 1). Additionally, since the three
positively charged lysines at the carboxy terminus of the HFV envelope
glycoprotein may be important for charge interactions with other viral
proteins (9), we constructed additional mutant viral clones
carrying replacements of all three lysines with either serines (SSS) or
arginines (RRR). The resultant mutant plasmid clones were designated
HFV-KKS, HFV-SSS, and HFV-RRR (Fig. 1).

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 1.
Mutations to the ER retrieval signal. The dilysine motif
located in the cytoplasmic tail of the TM glycoprotein of HFV is shown
(boldface KKK) along with the clones containing partially (HFV-KKS) or
fully (HFV-SSS and HFV-RRR) mutated ER retrieval signals. LTR, long
terminal repeat; PR, protease; WT, wild type.
|
|
CF2Th cells were infected with wild-type HFV, HFV-KKS, or HFV-SSS. Four
days postinfection, cells were fixed and studied by EM (Fig.
2). While viral budding at the plasma
membrane was occasionally seen for wild-type virus
(Fig. 2A and D), the majority of wild-type virus was seen inside the
cell (Fig. 2D). More virus was budding from or present at the plasma
membrane in cells infected with HFV-KKS or HFV-SSS than in cells
infected with wild-type HFV (Fig. 2B, C, E, and F). By visual
estimation, approximately three times as much mutant virus budded at
the plasma membrane. A significant amount of viral budding continued to
occur intracytoplasmically for both mutants (Fig. 2E and F), but less
intracytoplasmic budding was seen compared with wild-type virus.
Similar results were obtained with cells infected with HFV-RRR, and the
same phenotype was noted in both BHK-21 and human embryonic lung (HEL)
cells (data not shown). Taken together, our results indicated that the
dilysine ER retrieval signal of the FV envelope glycoprotein played a
significant role in partitioning the maturation of FV particles to
intracytoplasmic membranes. However other factors or signals must also
participate in the partitioning of viral maturation since
intracytoplasmic budding continued in the absence of the dilysine motif
ER retrieval signal.


View larger version (192K):
[in this window]
[in a new window]
|
FIG. 2.
The ER retrieval signal partitioned viral budding away
from the plasma membrane. CF2Th cells were infected with either
wild-type HFV (A and D), HFV-KKS (B and E), or HFV-SSS (C and F) and
then fixed and sectioned for EM analysis.
|
|
The ER retrieval signal did not impede viral exit from the
cell.
Because the dilysine mutant clones had shifted part of their
viral maturation to the plasma membrane, we expected their yield of
extracellular virus would be greater than for wild-type HFV. To address
this issue, CF2Th cells were infected at an MOI of 1 with wild-type
HFV, HFV-KKS, or HFV-SSS. At 3.5 days after infection, cells were
metabolically labeled for 1 h and chased for 12 h, and the
media and cells were harvested. To visualize virus-specific proteins
present within extracellular virus particles, the media were filtered
through a 0.45-µm-pore-size filter and centrifuged through a 20%
sucrose cushion. After immunoprecipitation, the proteins were resolved
by SDS-PAGE. The levels of pellet-associated viral proteins (SU, TM,
and Gag) were observed to be similar for wild-type and mutant viruses
(Fig. 3; compare lanes 6 to lanes 7 and
8). The amount of processed glycoprotein (gp80) was decreased for the
cell lysate fraction of wild-type infected cells (compare lane 2 with
lanes 3 and 4). A slight decrease in the amount of pelleted virus was
noted for HFV-SSS; however, this difference was neither significant nor
consistent among experiments. In contrast to the cell-associated
fraction, we noted that mature glycoprotein subunits (as determined by
gp80 or gp47) were present in the released viral particles of wild-type
as well as ER retrieval mutant viruses (Fig. 3, lanes 6 to 8). To
ascertain that these results are not limited to a particular cell type,
the RIPA was repeated with BHK-21 cells. The media were collected 4 days after infection and pelleted through 20% sucrose cushion. The
amounts of extracellular virus were not significantly different for
wild-type HFV, HFV-KKS, and HFV-SSS (Fig.
4A, lanes 6 to 8). Similar to the
experiment with CTh2 cells, decreased amounts of glycoprotein cleavage
were seen in wild-type HFV-infected cells (Fig. 4A; compare lane 2 to
lanes 3 and 4. Infection of HEL cells yielded similar results.

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 3.
The ER retrieval signal did not inhibit production of
extracellular virus. CF2Th cells were infected with wild-type HFV
(lanes 2 and 6), HFV-KKS (lanes 3 and 7), or HFV-SSS (lanes 4 and 8);
3.5 days after infection, cells were radiolabeled for 1 h, chased
for 12 h, and immunoprecipitated with chimpanzee plasma. Lanes 1 to 4, cell lysates; lanes 5 to 8, media; lanes 1 and 5, mock infection.
Media were pelleted through a 20% sucrose cushion. Proteins were
separated by SDS-PAGE (12% gel).
|
|

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 4.
Similar levels of extracellular virus were released from
a different cell line, as visualized by RIPA and Western blot analysis.
BHK-21 cells were infected with wild-type (lanes 2 and 6), HFV-KKS
(lanes 3 and 7), or HFV-SSS (lanes 4 and 8). Cells were labeled
overnight for RIPA (A) or harvested for Western blot analysis (B). The
medium was pelleted through a 20% sucrose cushion, and proteins were
separated by SDS-PAGE (10% gel). Lanes 1 and 5, mock infection.
|
|
Labeling experiments may not be an accurate measure of the total amount
of extracellular virus production, a consideration especially
significant with respect to a mutation that may disrupt the normal
replication kinetics of the virus. For example, a mutant virus might
yield an increased level of total extracellular virus but have a longer
time to viral release. In such a case, the RIPA would underestimate the
actual amount of released virus. Western blot analysis, which is not
dependent on radiolabeling, was therefore performed to evaluate the
total amount of Gag present in the viral particles released from BHK-21
infected with wild-type HFV, HFV-KKS, or HFV-SSS. Four days after
infection, media were filtered and centrifuged through a sucrose
cushion as described above, and Western blotting was performed. The
amounts of Gag (p74/70) present in released viral particles were again
similar for mutant and wild-type viruses (Fig. 4B; compare lane 6 to
lanes 7 and 8). The HFV surface glycoproteins were poorly recognized by
the chimpanzee plasma in the Western blot, and only the precursor
(gp130) was detected. Results for HEL cells were similar. As indicated
by both radiolabeling and Western blot assays using three different cell types, the amounts of pellet-associated viral proteins for wild-type and mutant viruses were not different. Taken together, these
results showed that although electron micrographs indicated the ER
retrieval signal of wild-type HFV directed viral maturation away from
the plasma membrane, this did not reduce the total level of
extracellular virus as measured by levels of pellet-associated viral proteins.
The ER retrieval signal was not required for HFV infectivity.
Although in the above experiments extracellular viral particles were
detected in the media of cells infected with HFV clones containing
dilysine motif mutations, it remained uncertain if these released viral
particles represented infectious virus. The ER retrieval mutants
HFV-SSS and HFV-RRR were used in this experiment to determine if the
charged residues in the glycoprotein cytoplasmic domain play a role in
Gag-Env interaction. If these charges are important for Gag-Env
interactions in FVs, then their disruption should significantly
decrease viral replication. To address this question, BHK-21 cells were
infected at day 0 (MOI of 0.5), and the media were collected and
filtered through a 0.45-µm-pore-size filter at 2, 4, or 6 days after
infection. Serial dilutions of the virus-containing media were
inoculated onto FAB cells. Because FAB cells encode
-galactosidase
under the control of an HFV long terminal repeat promoter, infection
with HFV results in expression of
-galactosidase, which degrades
X-Gal to produce blue cells as detected by light microscopy. Two days
after inoculation, the FAB cells were fixed and stained with X-Gal, and
the blue cells were counted. The mutant viruses HFV-SSS and HFV-RRR
were infectious, albeit at slightly (<1 log) lower titers than
wild-type HFV (Fig. 5A). The replication
kinetics of the mutant and wild-type viruses were generally similar,
which demonstrated a peak of virus production at 4 days after infection
and a slight decrease by day 6. However, there appeared to be a slight
delay in replication for the mutants. At day 6, the titer of mutant
HFV-RRR was still increasing slightly, while the mutant HFV-SSS titer
had just reached a plateau (Fig. 5A). HEL cells exhibited similar
results, indicating that these findings were not limited to a
particular cell type (not shown). Assays of RT activity in the media of
infected BHK-21 cells again demonstrated similar infectivity profiles
for wild-type and mutant viruses, although the levels were increasing
for all viruses at day 6 (Fig. 5B). Taken together, the results
indicated that the ER retrieval signal, though required for optimal
viral replication, was not absolutely necessary for HFV infectivity.
Additionally, it did not appear that the positive charges found in the
ER retrieval signal played a role in virus replication kinetics, as the
mutants HFV-SSS and HFV-RRR (both lacking the ER retrieval signal)
demonstrated similar replication kinetics.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 5.
Viral replication kinetics were similar for wild-type
and mutant clones. BHK-21 cells were infected with wild-type (WT) or
mutant viruses, and the media were collected at the indicated times.
The media were inoculated onto FAB cells to measure viral infectivity
by numbers of blue cells (A) or by quantification of RT activity in the
media (B).
|
|
Because of the slight delay in mutant virus replication (Fig. 5A), we
hypothesized that disruption of the ER retrieval signal had created a
disadvantage for viral replication under cell culture conditions.
Mutant viruses may therefore be under pressure to revert to wild type
for more efficient growth. To identify possible revertants, BHK-21
cells were infected with HFV-KKS or HFV-SSS and passaged in cell
culture for a 9-week period. Viral RNA was subsequently harvested,
reverse transcribed to DNA, amplified by PCR, cloned, and sequenced.
Neither mutant had generated any nucleotide changes in the region of
the ER retrieval signal. Furthermore, even after 9 weeks of cell
passage, RIPA of BHK-21 cells infected with the mutant viruses
maintained glycoprotein cleavage and electrophoretic mobility
characteristic of the mutant glycoprotein (gp80) (not shown). The same
phenotype as seen with viruses that were minimally passaged prior to
infection of BHK-21 cells was observed (Fig. 4A, lanes 2 to 4). This
latter result did not rule out the possibility of second-site
mutations; however, the mutant phenotype was still detected after 9 weeks of viral passage, making second-site mutations less likely to
have occurred.
 |
DISCUSSION |
Based on knowledge of certain other viruses, we surmised that the
envelope glycoprotein of HFV would play a significant role in
determining the site of HFV budding. On the other hand, redirecting the
glycoprotein of HIV-1 to the ER did not change the budding site of
viral particles (32, 35). In the present study, EM indicated
that the ER retrieval signal of HFV played an important role in
establishing the intracellular site of budding; however, other
determinants diverting HFV budding to an intracellular site must also
exist since budding across intracellular membranes continued to be
observed for mutant viruses (Fig. 2E and F). Unexpectedly, metabolic
labeling and Western blot analysis of viral proteins did not
demonstrate an expected increase in the levels of HFV particles in the
media of cells infected with ER retrieval signal mutant viruses. These
results were confirmed in multiple experiments using different cell
lines. Cotransfection of plasmids encoding for HFV Gag and either
wild-type or dilysine motif mutant glycoproteins also indicated that
wild-type and mutant particles were present in the media at similar
amounts (3). Therefore the results obtained were not
dependent on different efficiencies of viral infectivity since
these coexpression experiments did not produce infectious virus.
It is not clear why changing the major site of HFV budding to the
plasma membrane did not increase the amount of extracellular HFV.
Although viral budding occurs at the ER membranes, transit through the
cell via the Golgi apparatus and release at the plasma membrane may
continue to take place. Despite the fact that wild-type HFV
glycoprotein precursor gp130 was not efficiently cleaved when expressed
alone (12), wild-type HFV particles collected from the media
of infected cell cultures contained mostly the proteolytically processed subunits gp80 and gp47 (Fig. 3 and 4A, lane 6 in both). Thus,
after wild-type HFV buds into the ER, in order for viral glycoprotein
cleavage to occur, the virus must transit through the secretory pathway
to access the cellular subtilisin-like proteases in the distal Golgi
apparatus. Furthermore, virus released by cell lysis without transit
through the Golgi apparatus would presumably result in particles
containing the uncleaved precursor gp130, but such particles have not
been described. Finally, FVs produced a noncytopathic infection in
certain lymphocyte cell lines (24, 25, 47), also shown to be
the site of persistent viral infection in vivo (40),
suggesting that FVs have developed mechanisms for exiting the cell
without causing cytopathology.
The reason why FVs but no other retroviruses have evolved a highly
conserved ER retrieval signal in their envelope glycoprotein remains
unclear. While it was required for efficient intracellular budding of
virus, it was unnecessary for the production of extracellular infectious virus. Furthermore, the signal was not required for in vitro
replication of HFV, and only minor effects on the replication kinetics
with ER retrieval mutants were observed. Potentially, the presence of
the three lysines of the dilysine motif could facilitate Gag-Env
assembly through important charge interactions. In addition, the
coordinated interaction between Gag and Env may require that these
proteins be colocalized to the site of viral maturation. However, these
possibilities are not supported by our work demonstrating that
neutralizing the entire charge of the glycoprotein's cytoplasmic
domain (HFV-SSS) did not result in a significant change in infectious
virus titer, nor did it affect Gag incorporation into viral particles.
Overall, our findings suggest that the ER retrieval signal does not
play a significant role for the replication of FV in immortalized cell
types during laboratory cultures. This conclusion was further supported
by the absence of detectable revertant mutants after 9 weeks of mutant virus passage in such cells.
Other possible roles that the ER retrieval signal plays in vitro have
not been studied. A protein sorting signal somewhat analogous to the
dilysine motif may be seen with other retroviruses, where a tyrosine
(located on the cytoplasmic tail of the TM glycoprotein) was shown to
be important for decreasing the level of SU glycoprotein when expressed
in the absence of other viral particles. This effect was partially
abrogated when HIV-1 Gag was coexpressed with Env (6), a
finding similar to our present and earlier results which demonstrated
that when the HFV glycoprotein is expressed alone, most of it remains
in the ER (12). The present study showed that when the
glycoprotein is expressed as part of a complete viral infection, a
significant portion of the glycoprotein exits the ER, suggesting a role
for other viral proteins in facilitating glycoprotein transit through
the Golgi network and beyond. It is also interesting that the same
tyrosine signal was shown to be important for basolateral targeting of
lentiviral particles (2, 22), again analogous to the present
work, where the ER retrieval signal was shown to be important for
efficient intracytoplasmic targeting of FV particles.
By decreasing the amount of SU glycoprotein expression, FVs may
minimize the level not only of syncytium formation but also of
apoptosis, which has been demonstrated with FV infections of cells
(16, 23). Another possibility is that by directing the major
site of assembly intracytoplasmically, FVs temporarily escape immune
detection, thereby giving the virus an important advantage early in the
replication cycle. FVs have undoubtedly devised several mechanisms of
immune system evasion, though data on this question are scant. The
conservation of the dilysine motif in FVs isolated from several
different mammalian species indicates that this signal must play an
extremely important role in the replication of these viruses. This
paper describes some of its in vitro effects, but clearly more will be
learned of this highly conserved motif.
 |
ACKNOWLEDGMENTS |
This project was supported by NIH awards AI 01380, AI 33784, and
Cystic Fibrosis Foundation award R464.
We thank Eric Hunter for use of the AMBIS radioanalytic detection
system, Richard W. Compans for EM studies of infected HEL cells, and
Doug Ritter for technical support.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: University of
Alabama at Birmingham, Division of Infectious Diseases, BBRB 220, Birmingham, AL 35294-2170. Phone: (205) 975-5667. Fax: (205) 975-5718. E-mail: paulg{at}uab.edu.
 |
REFERENCES |
| 1.
|
Baldwin, D. N., and M. L. Linial.
1998.
The roles of Pol and Env in the assembly pathway of human foamy virus.
J. Virol.
72:3658-3665[Abstract/Free Full Text].
|
| 2.
|
Ball, J. M.,
M. J. Mulligan, and R. W. Compans.
1996.
Basolateral sorting of the HIV-2 and SIV glycoproteins in polarized epithelial cells: role of the cytoplasmic domain.
Submitted for publication.
|
| 3.
| Bansal, A., K. L. Shaw, P. A. Goepfert, and
M. J. Mulligan. Characterization of the R572T point mutant of
the putative cleavage site of the foamy virus glycoprotein. Submitted
for publication.
|
| 4.
|
Bruss, V., and D. Ganem.
1991.
The role of envelope proteins in hepatitis B virus assembly.
Proc. Natl. Acad. Sci. USA
88:1059-1063[Abstract/Free Full Text].
|
| 5.
|
Cosson, P., and F. Letourneur.
1994.
Coatomer interaction with di-lysine endoplasmic reticulum retention motifs.
Science
263:1629-1631[Abstract/Free Full Text].
|
| 6.
|
Egan, M. A.,
L. M. Carruth,
J. F. Rowell,
X. Yu, and R. F. Siliciano.
1996.
Human immunodeficiency virus type 1 envelope protein endocytosis mediated by a highly conserved intrinsic internalization signal in the cytoplasmic domain of gp41 is suppressed in the presence of the Pr55gag precursor protein.
J. Virol.
70:6547-6556[Abstract/Free Full Text].
|
| 7.
|
Enssle, J.,
I. Jordan,
B. Mauer, and A. Rethwilm.
1996.
Foamy virus reverse transcriptase is expressed independently from the gag protein.
Proc. Natl. Acad. Sci. USA
93:4137-4141[Abstract/Free Full Text].
|
| 8.
|
Fischer, N.,
M. Heinkelein,
D. Lindemann,
J. Enssle,
C. Baum,
E. Werder,
H. Zentgraf,
J. G. Muller, and A. Rethwilm.
1998.
Foamy virus particle formation.
J. Virol.
72:1610-1615[Abstract/Free Full Text].
|
| 9.
|
Flügel, R. M.
1991.
Spumaviruses: a group of complex retroviruses.
J. Acquired Immune Defic. Syndr. Hum. Retrovirol.
4:739-750.
|
| 10.
|
Gheysen, D.,
E. Jacobs,
F. de Foresta,
C. Thiriart,
M. Francotte,
D. Thines, and M. De Wilde.
1989.
Assembly and release of HIV-1 precursor Pr55gag virus-like particles from recombinant baculovirus-infected insect cells.
Cell
59:103-112[Medline].
|
| 11.
|
Goepfert, P. A.,
G. D. Ritter, Jr.,
X. Peng,
A. A. Gbakima,
Y. Zhang, and M. J. Mulligan.
1996.
Analysis of West African hunters for foamy virus infections.
AIDS Res. Hum. Retroviruses
12:1725-1730[Medline].
|
| 12.
|
Goepfert, P. A.,
K. L. Shaw,
G. D. Ritter, Jr., and M. J. Mulligan.
1997.
A sorting motif localizes the foamy virus glycoprotein to the endoplasmic reticulum.
J. Virol.
71:778-784[Abstract].
|
| 13.
|
Goepfert, P. A.,
G. Wang, and M. J. Mulligan.
1995.
Identification of an ER retrieval signal in a retroviral glycoprotein.
Cell
82:543-544[Medline].
|
| 14.
|
Hooks, J. J., and C. J. Gibbs.
1975.
The foamy viruses.
Bacteriol. Rev.
39:169-185[Free Full Text].
|
| 15.
|
Hunter, E., and R. Swanstrom.
1990.
Retrovirus envelope glycoproteins.
Curr. Top. Microbiol. Immunol.
157:187-253[Medline]. (Review.)
|
| 16.
|
Ikeda, Y.,
S. Itagaki,
S. Tsutsui,
Y. Inoshima,
M. Fukasawa,
K. Tomonaga,
Y. Tohya, and K. Maeda.
1997.
Replication of feline syncytial virus in feline T-lymphoblastoid cells and induction of apoptosis in the cells.
Microbiol. Immunol.
41:431-435[Medline].
|
| 17.
|
Jackson, M. R.,
T. Nilsson, and P. A. Peterson.
1990.
Identification of a consensus motif for retention of transmembrane proteins in the endoplasmic reticulum.
EMBO J.
9:3153-3162[Medline].
|
| 18.
|
Kuroki, K.,
R. Russnak, and D. Ganem.
1989.
Novel N-terminal amino acid sequence required for retention of a hepatitis B virus glycoprotein in the endoplasmic reticulum.
Mol. Cell. Biol.
9:4459-4466[Abstract/Free Full Text].
|
| 19.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[Medline].
|
| 20.
|
Letourneur, F.,
E. C. Gaynor,
S. Hennecke,
C. Demolliere,
R. Duden,
S. D. Emr,
H. Riezman, and P. Cosson.
1994.
Coatomer is essential for retrieval of dilysine-tagged proteins to the endoplasmic reticulum.
Cell
79:1199-1207[Medline].
|
| 20a.
|
Löchelt, M., and R. M. Fl gel.
1996.
The human foamy virus pol gene is expressed as a Pol-Pol polyprotein and not as a Gag-Pol fusion protein.
J. Virol.
70:1033-1040[Abstract].
|
| 21.
|
Lodge, R.,
H. Gottlinger,
D. Gabuzda,
E. A. Cohen, and G. Lemay.
1994.
The intracytoplasmic domain of gp41 mediates polarized budding of human immunodeficiency virus type 1 in MDCK cells.
J. Virol.
68:4857-4861[Abstract/Free Full Text].
|
| 22.
|
Lodge, R.,
J. P. Lalonde,
G. Lemay, and E. A. Cohen.
1997.
The membrane-proximal intracytoplasmic tyrosine residue of HIV-1 envelope glycoprotein is critical for basolateral targeting of viral budding in MDCK cells.
EMBO J.
16:695-705[Medline].
|
| 23.
|
Mergia, A.,
J. Blackwell,
G. Papadi, and C. Johnson.
1997.
Simian foamy virus type 1 (SFV-1) induces apoptosis.
Virus Res.
50:129-137[Medline].
|
| 24.
|
Mergia, A.,
N. J. Leung, and J. Blackwell.
1996.
Cell tropism of the simian foamy virus type 1 (SFV-1).
J. Med. Primatol.
25:2-7[Medline].
|
| 25.
|
Mikovits, J. A.,
P. M. Hoffman,
A. Rethwilm, and F. W. Ruscetti.
1996.
In vitro infection of primary and retrovirus-infected human leukocytes by human foamy virus.
J. Virol.
70:2774-2780[Abstract].
|
| 26.
|
Mulligan, M. J.,
P. Kumar,
H. Hui,
R. J. Owens,
G. D. Ritter, Jr.,
B. H. Hahn, and R. W. Compans.
1990.
The env protein of an infectious noncytopathic HIV-2 is deficient in syncytium formation.
AIDS Res. Hum. Retroviruses
6:707-720[Medline].
|
| 27.
|
Mulligan, M. J.,
G. D. Ritter, Jr.,
M. A. Chaikin,
G. V. Yamshchikov,
P. Kumar,
B. H. Hahn,
R. W. Sweet, and R. W. Compans.
1992.
Human immunodeficiency virus type 2 envelope glycoprotein: differential CD4 interactions of soluble gp120 versus the assembled envelope complex.
Virology
187:233-241[Medline].
|
| 28.
|
Mulligan, M. J.,
G. V. Yamschikov,
G. D. Ritter, Jr.,
F. Gao,
M. J. Jin,
C. D. Nail,
C. P. Spies,
B. H. Hahn, and R. W. Compans.
1992.
Cytoplasmic domain truncation enhances fusion activity by the exterior glycoprotein complex of human immunodeficiency virus type 2 in selected cell types.
J. Virol.
66:3971-3975[Abstract/Free Full Text].
|
| 29.
|
Nemecková, S.,
D. Kunke,
M. Press,
Nemeck, and L. Kutinová.
1994.
A carboxy-terminal portion of the PreS1 domain of hepatitis B virus (HBV) occasioned retention in endoplasmic reticulum of HBV envelope proteins expressed by recombinant vaccinia viruses.
Virology
202:1024-1027[Medline].
|
| 30.
|
Neumann-Haefelin, D.,
U. Fleps,
R. Renne, and M. Schweizer.
1993.
Foamy viruses.
Intervirology
35:196-207[Medline].
|
| 31.
|
Owens, R. J.,
J. W. Dubay,
E. Hunter, and R. W. Compans.
1991.
Human immunodeficiency virus envelope protein determines the site of virus release in polarized epithelial cells.
Proc. Natl. Acad. Sci. USA
88:3987-3991[Abstract/Free Full Text].
|
| 32.
|
Pfeiffer, T.,
H. Zentgraf,
B. Freyaldenhoven, and V. Bosch.
1997.
Transfer of endoplasmic reticulum and Golgi retention signals to human immunodeficiency virus type 1 gp160 inhibits intracellular transport and proteolytic processing of viral glycoprotein but does not influence the cellular site of virus particle budding.
J. Gen. Virol.
78:1745-1753[Abstract].
|
| 33.
|
Rethwilm, A.
1995.
Regulation of foamy virus gene expression.
Curr. Top. Microbiol. Immunol.
193:1-24[Medline].
|
| 34.
|
Rethwilm, A.
1996.
Unexpected replication ways of foamy viruses.
J. Acquired Immune Defic. Syndr. Hum. Retrovirol.
13:S248-S253.
|
| 35.
|
Salzwedel, K.,
J. T. West, Jr.,
M. J. Mulligan, and E. Hunter.
1998.
Retention of the human immunodeficiency virus type 1 envelope glycoprotein in the endoplasmic reticulum does not redirect virus assembly from the plasma membrane.
J. Virol.
72:7523-7531[Abstract/Free Full Text].
|
| 36.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 37.
|
Schliephake, A. W., and A. Rethwilm.
1994.
Nuclear localization of foamy virus Gag precursor protein.
J. Virol.
68:4946-4954[Abstract/Free Full Text].
|
| 38.
|
Shioda, T., and H. Shibuta.
1990.
Production of human immunodeficiency virus (HIV)-like particles from cells infected with recombinant vaccinia viruses carrying the gag gene of HIV.
Virology
175:139-148[Medline].
|
| 39.
|
Tucker, S. P., and R. W. Compans.
1993.
Virus infection of polarized epithelial cells.
Adv. Virus Res.
42:187-247[Medline].
|
| 40.
|
von Laer, D.,
D. Neumann-Haefelin,
J. L. Heeney, and M. Schweizer.
1996.
Lymphocytes are the major reservoir for foamy viruses in peripheral blood.
Virology
22:240-244.
|
| 41.
|
Wang, G., and M. J. Mulligan.
1999.
Comparative sequence analysis and predictions for the envelope glycoproteins of foamy viruses.
J. Gen. Virol.
80:245-254[Abstract].
|
| 42.
|
Wills, J. W., and R. C. Craven.
1991.
Form, function, and use of retroviral gag proteins.
AIDS
5:639-654[Medline].
|
| 43.
|
Winkler, I.,
J. Boden,
L. Haas,
M. Zemba,
H. Delius,
R. Flower,
R. M. Flugel, and M. Lochelt.
1997.
Characterization of the genome of feline foamy virus and its proteins shows distinct features different from those of primate spumaviruses.
J. Virol.
71:6727-6741[Abstract].
|
| 44.
|
Yu, S. F.,
D. N. Baldwin,
S. R. Gwynn,
S. Yendapalli, and M. L. Linial.
1996.
Human foamy virus replication: a pathway distinct from that of retroviruses and hepadnaviruses.
Science
271:1579-1582[Abstract].
|
| 45.
|
Yu, S. F.,
K. Edelmann,
R. K. Strong,
A. Moebes,
A. Rethwilm, and M. L. Linial.
1996.
The carboxyl terminus of the human foamy virus Gag protein contains separable nucleic acid binding and nuclear transport domains.
J. Virol.
70:8255-8262[Abstract].
|
| 46.
|
Yu, S. F., and M. L. Linial.
1993.
Analysis of the role of the bel and bet open reading frames of human foamy virus by using a new quantitative assay.
J. Virol.
67:6618-6624[Abstract/Free Full Text].
|
| 47.
|
Yu, S. F.,
J. Stone, and M. L. Linial.
1996.
Productive persistent infection of hematopoietic cells by human foamy virus.
J. Virol.
70:1250-1254[Abstract].
|
Journal of Virology, September 1999, p. 7210-7217, Vol. 73, No. 9
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Patton, G. S., Morris, S. A., Chung, W., Bieniasz, P. D., McClure, M. O.
(2005). Identification of Domains in Gag Important for Prototypic Foamy Virus Egress. J. Virol.
79: 6392-6399
[Abstract]
[Full Text]
-
Lontok, E., Corse, E., Machamer, C. E.
(2004). Intracellular Targeting Signals Contribute to Localization of Coronavirus Spike Proteins near the Virus Assembly Site. J. Virol.
78: 5913-5922
[Abstract]
[Full Text]
-
Delelis, O., Saib, A., Sonigo, P.
(2003). Biphasic DNA Synthesis in Spumaviruses. J. Virol.
77: 8141-8146
[Abstract]
[Full Text]
-
Shikova-Lekova, E., Lindemann, D., Pietschmann, T., Juretzek, T., Rudolph, W., Herchenroder, O., Gelderblom, H. R., Rethwilm, A.
(2003). Replication-Competent Hybrids between Murine Leukemia Virus and Foamy Virus. J. Virol.
77: 7677-7681
[Abstract]
[Full Text]
-
Shaw, K. L., Lindemann, D., Mulligan, M. J., Goepfert, P. A.
(2003). Foamy Virus Envelope Glycoprotein Is Sufficient for Particle Budding and Release. J. Virol.
77: 2338-2348
[Abstract]
[Full Text]
-
Lecellier, C.-H., Neves, M., Giron, M.-L., Tobaly-Tapiero, J., Saib, A.
(2002). Further Characterization of Equine Foamy Virus Reveals Unusual Features among the Foamy Viruses. J. Virol.
76: 7220-7227
[Abstract]
[Full Text]
-
Eastman, S. W., Linial, M. L.
(2001). Identification of a Conserved Residue of Foamy Virus Gag Required for Intracellular Capsid Assembly. J. Virol.
75: 6857-6864
[Abstract]
[Full Text]
-
Lindemann, D., Pietschmann, T., Picard-Maureau, M., Berg, A., Heinkelein, M., Thurow, J., Knaus, P., Zentgraf, H., Rethwilm, A.
(2001). A Particle-Associated Glycoprotein Signal Peptide Essential for Virus Maturation and Infectivity. J. Virol.
75: 5762-5771
[Abstract]
[Full Text]
-
Meiering, C. D., Maxine L. Linial,
(2001). Historical Perspective of Foamy Virus Epidemiology and Infection. Clin. Microbiol. Rev.
14: 165-176
[Abstract]
[Full Text]
-
Pietschmann, T., Zentgraf, H., Rethwilm, A., Lindemann, D.
(2000). An Evolutionarily Conserved Positively Charged Amino Acid in the Putative Membrane-Spanning Domain of the Foamy Virus Envelope Protein Controls Fusion Activity. J. Virol.
74: 4474-4482
[Abstract]
[Full Text]
-
Tobaly-Tapiero, J., Bittoun, P., Neves, M., Guillemin, M.-C., Lecellier, C.-H., Puvion-Dutilleul, F., Gicquel, B., Zientara, S., Giron, M.-L., de Thé, H., Saïb, A.
(2000). Isolation and Characterization of an Equine Foamy Virus. J. Virol.
74: 4064-4073
[Abstract]
[Full Text]
-
Ono, A., Orenstein, J. M., Freed, E. O.
(2000). Role of the Gag Matrix Domain in Targeting Human Immunodeficiency Virus Type 1 Assembly. J. Virol.
74: 2855-2866
[Abstract]
[Full Text]
-
Bansal, A., Shaw, K. L., Edwards, B. H., Goepfert, P. A., Mulligan, M. J.
(2000). Characterization of the R572T Point Mutant of a Putative Cleavage Site in Human Foamy Virus Env. J. Virol.
74: 2949-2954
[Abstract]
[Full Text]
-
Wang, G., Mulligan, M. J., Baldwin, D. N., Linial, M. L.
(1999). Endogenous Virus of BHK-21 Cells Complicates Electron Microscopy Studies of Foamy Virus Maturation. J. Virol.
73: 8917-8917
[Full Text]
-
Lambert, G., Becker, B., Schreiber, R., Boucherot, A., Reth, M., Kunzelmann, K.
(2001). Control of Cystic Fibrosis Transmembrane Conductance Regulator Expression by BAP31. J. Biol. Chem.
276: 20340-20345
[Abstract]
[Full Text]