Previous Article | Next Article 
Journal of Virology, August 1999, p. 6916-6922, Vol. 73, No. 8
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The H Gene of Rodent Brain-Adapted Measles Virus
Confers Neurovirulence to the Edmonston Vaccine Strain
W. Paul
Duprex,1,*
Iain
Duffy,1
Stephen
McQuaid,2
Louise
Hamill,1
S. Louise
Cosby,1,2
Martin A.
Billeter,3
Jürgen
Schneider-Schaulies,4
Volker
ter Meulen,4 and
Bert K.
Rima1
School of Biology and Biochemistry, The Queen's University
of Belfast, Belfast BT9 7BL,1 and
Neuropathology Laboratory, Royal Group of Hospitals Trust,
Belfast BT12 6B1,2 Northern Ireland, United
Kingdom; Institut fur Molekularbiologie, Abteilung I,
Universität Zürich, Hönggerberg, 8093 Zürich,
Switzerland3; and Institute for
Virology and Immunobiology, University of Würzburg, D-97078
Würzburg, Germany4
Received 11 March 1999/Accepted 3 May 1999
 |
ABSTRACT |
Molecular determinants of neuropathogenesis have been shown to be
present in the hemagglutinin (H) protein of measles virus (MV). An H
gene insertion vector has been generated from the Edmonston B vaccine
full-length infectious clone of MV. Using this vector, it is possible
to insert complete H open reading frames into the parental (Edtag)
background. The H gene from a rodent brain-adapted MV strain (CAM/RB)
was inserted into this vector, and a recombinant virus (EdtagCAMH) was
rescued by using a modified vaccinia virus which expresses T7 RNA
polymerase (MVA-T7). The recombinant virus grew at an equivalent rate
and to similar titers as the CAM/RB and Edtag parental viruses.
Neurovirulence was assayed in a mouse model for MV encephalitis.
Viruses were injected intracerebrally into the right cortex of C57/BL/6
suckling mice. After infection mice inoculated with the CAM/RB strain
developed hind limb paralysis and ataxia. Clinical symptoms were never
observed with an equivalent dose of Edtag virus or in sham infections.
Immunohistochemistry (IHC) was used to detect viral antigen in
formalin-fixed brain sections. Measles antigen was observed in neurons
and neuronal processes of the hippocampus, frontal, temporal, and
olfactory cortices and neostriatum on both sides of symmetrical
structures. Viral antigen was not detected in mice infected with Edtag
virus. Mice infected with the recombinant virus, EdtagCAMH, became
clinically ill, and virus was detected by IHC in regions of the brain
similar to those in which it was detected in animals infected with
CAM/RB. The EdtagCAMH infection had, however, progressed much less than the CAM/RB virus at 4 days postinfection. It therefore appears that
additional determinants are encoded in other regions of the MV genome
which are required for full neurovirulence equivalent to CAM/RB.
Nevertheless, replacement of the H gene alone is sufficient to cause neuropathology.
 |
INTRODUCTION |
Measles virus (MV) is a
negative-stranded RNA paramyxovirus which causes an acute human
infection leading to the death of over 1 million people in developing
countries per annum. As a member of the Mononegavirales, MV
has a nonsegmented genome which encodes six structural proteins,
nucleocapsid (N), phosphoprotein (P), matrix (M), fusion (F),
hemagglutinin (H), and polymerase (L); at least two nonstructural
proteins, C and V, are produced in infected cells. The F0
protein arises as an inactive precursor. Two disulfide-linked subunits,
F1 and F2, are generated by proteolysis, and
these associate with the H protein (50). Binding of the F1 cytoplasmic tail to the M protein, which in turn
associates with the NC proteins encapsidating the genome, completes the
interactions necessary for the assembly of an infectious virus particle
(28).
Entry of tissue culture adapted strains of MV is mediated by binding of
the H glycoprotein, which is tightly associated with the F
glycoprotein, to a cellular receptor, CD46 (9, 24). Cell-to-cell fusion is also mediated by these two glycoproteins (6, 50). As CD46 is not present on all cells which can be infected by MV, it is assumed the virus can utilize other receptors (47).
Two severe infections of the central nervous system (CNS) may follow MV
exposure: subacute sclerosing panencephalitis (41) and
measles inclusion body encephalitis (1). In the former, a
persistent virus infection ensues in the presence of high titers of
antiviral antibodies; mutations accumulate in the virus genome, especially in the F and M genes, and transcription of envelope genes is
reduced by an altered transcription gradient (2, 36, 40,
41). In attempts to generate a small animal model for CNS
infection neurovirulent, rodent-adapted strains of MV have been
generated by repeated passage in the brain (4, 7, 15, 19, 21, 26,
47). Sequencing studies have shown that the majority of
alterations, in such rodent brain-adapted strains, reside in the H
gene, and it is possible that these changes allow MV to infect rodent
neural cells by using a different receptor. Escape mutants, isolated in
vitro from a neuroadapted CAM/RB strain by using anti-H neutralizing
monoclonal antibodies, have altered neurotropism. The mutations are
located in what is described as a major antigenic determinant (residues
368 to 396) of the H gene, and it is assumed that residues in this
region may be functionally important for neurovirulence
(20).
The availability of the MV rescue system (29) allows more
defined investigations into virulence determinants in MV strains. A
number of recombinant MVs have been generated by using this system and
used to elucidate mechanisms of cell-to-cell spread (5) and
virulence (42, 50). To determine whether the CAM/RB H gene
in isolation is sufficient to confer neurovirulence to the
non-brain-adapted Edmonston B, we have inserted this gene into the
Edtag background and rescued a recombinant MV. The transfer of
neurovirulence determinants was successful. The ability to examine the
effects of the CAM H gene in isolation in a constant genetic background
will be of value in elucidating the molecular basis of MV neurotropism
in this model.
 |
MATERIALS AND METHODS |
Viruses and cells.
Edtag virus was rescued from the
full-length infectious antigenomic clone p(+)MV (29) as
described by Schneider et al. (35). Vero cells (American
Type Culture Collection) were grown in Dulbecco's modified Eagle's
medium supplemented with 8% newborn calf serum and used for the
production and titration of measles virus stocks. HeLa cells, grown in
RPMI medium (Gibco) supplemented with 5% fetal calf serum, were used
for the rescue of recombinant viruses. The rodent brain-adapted measles
virus CAM/RB was obtained from U. G. Liebert, Würzburg,
Germany. The virus was passaged on Vero cells, and retention of the
neurovirulent phenotype was verified routinely by inoculation of 200 50% tissue culture infective doses (TCID50) into the
brains of suckling C57/BL/6 mice. Modified vaccinia virus Ankara
expressing T7 RNA polymerase (MVA-T7) was obtained from Gerd Sutter,
GSF-Forschungszentrum, Neuherberg, Germany. This host-range-adapted
virus was passaged and titered in primary chicken embryo fibroblast
cells supplied by Mildred Wylie, Veterinary Sciences Division, Belfast,
Northern Ireland, as previously described (39).
Single-step growth analysis.
Vero cells were cultured, to
80% confluency, in 35-mm-diameter petri dishes. Cells were infected at
a multiplicity of infection (MOI) of 5 with the parental and
recombinant viruses for 1 h at 37°C, after which time the
inoculum was removed. Infected cells were incubated for 86 h.
Every 4 or 5 h, monolayers were scraped from the petri dishes.
Cell-associated virus was recovered by freeze-thawing the cell samples
twice, and aliquots were stored at
70°C. Titers were obtained by
the 50% endpoint dilution assay (30) and are expressed in
TCID50.
Construction of H insertion vector.
A ClaI
subclone was generated from plasmid p(+)MV, which encodes the complete
antigenome of the Edmonston strain of MV (29). The 10,624-bp
ClaI fragment was subcloned into pGEM7ZF(+) (Promega). The
resulting subclone pscMV(ClaI) was digested with
PacI and SpeI to remove the majority of the H
gene. Two complementary oligonucleotides, containing the restriction
site AatII (underlined), were synthesized. These were
designated priHins+ (5'-TAATACAATAGACGTCAGGCATACCCA) and priHins
(5'-CTAGTGGGTATGCCTGACGTCTATTGTATTAAT).
Oligonucleotides priHins+ and priHins
were diluted to 10 ng/µl and mixed in an equimolar ratio in annealing buffer (20 mM
Tris, 10 mM MgCl2, 50 mM NaCl [pH 7.5]). They were heated
to 100°C for 3 min and cooled to 40°C over a period of 30 min.
After annealing, the double-stranded product contained ends which were
compatible with the PacI/AatII-cut vector
pscMV(ClaI). Ligation of the vector and annealed
oligonucleotides resulted in the production of the vector
pscMVins-H2(ClaI). Excision and reintroduction of this
mutagenized ClaI fragment into pscMV(ClaI) resulted in the generation of the insertion vector pMVins-H2. The
plasmid was sequenced by dideoxynucleotide chain termination (ABI
Prism) using an MV-specific primer (MF3) which binds in the 3'
untranslated region of F (5'-GGTTTATCGAGCACTAGCAT) to verify that the oligonucleotide had been inserted and replaced the H gene as expected.
RNA preparation and RT-PCR.
Total RNA was prepared by a
guanidinium isothiocyanate method (34, 46). Briefly, RNA was
prepared either from infected monolayers or from frozen brain tissue.
Monolayers were solubilized in guanidinium isothiocyanate solution, and
brain tissue was homogenized in the same solution. Total RNA was
prepared by cesium chloride gradient centrifugation. RNA was
precipitated with ethanol, and salts were removed by using cold 70%
ethanol. The Superscript one-step reverse transcription (RT)-PCR system
(Gibco) was used to produce DNA fragments which were used for cloning
strategies, restriction analysis, and DNA sequencing. One microgram of
total RNA was used as the template for one-step RT-PCR. Reverse
transcriptase was omitted to control for plasmid DNA contamination, and
-actin primers (5'-TCATGAAGTGTGACGTTGACATCCGTAAAG and
5'-CCTAGAAGCATTTGCGGTGCACGATGGAGG) were used as positive
controls. PCR products were analyzed on 1.5% DNA agarose gels
containing ethidium bromide, and PstI-digested
DNA was
used as size markers. Digitized bitmap images were collected with an
Imagestore 5000 analysis system (UVP).
Construction of p(+)MVCAMH.
Vero cells were infected, at an
MOI of 1, with the MV CAM/RB strain for 36 h, and total RNA was
prepared. Oligonucleotides uniH+
(5'-CGGTAGTTAATTAAAACTTAGGGTGCAAGATCATCCAC) and
uniH2
(5'-(ATGCCTGACGTCTGGGTGACATCATG), specific for MV H genes and compatible with the H insertion
vector, were designed to include the restriction sites PacI
and AatII (underlined). The H gene of the CAM/RB strain was
amplified by one-step RT-PCR using these primers. The PCR product was
digested with PacI and AatII and ligated into
similarly treated pMVins-H2. The resultant construct, designated
p(+)MVCAMH, was completely sequenced by using MV H-specific
oligonucleotides to verify that the PCR had not introduced nonspecific
mutations into the gene upon amplification.
Rescue of infectious viruses, Edtag, and EdtagCAMH.
HeLa
cells, grown to 50% confluency in 35-mm-diameter wells, were infected
with MVA-T7 at an MOI of 1. Transfections were carried out essentially
as outlined by Schneider et al. (35). Plasmids pEMC-Na (1.5 µg), pEMC-Pa (1.5 µg), and pEMC-La (0.5 µg) and the plasmids
containing copies of the full-length antigenomes (5 µg) were
transfected into the cells over 18 h. After this time, the medium
was replaced and transfections were further incubated for 5 days at
37°C. If syncytia were not visible by this time, the cells were
scraped from the wells. After two rounds of freeze-thawing, the
precleared supernatants were seeded onto HeLa or Vero cell monolayers.
Recovery of virus was verified by the appearance of syncytia 10 days
posttransfection, and the recombinant viruses were plaque purified
twice on Vero cells. Vero cells were infected with the recombinant
viruses, and total RNA was prepared as described above.
Neurovirulence in mice.
Four-day-old suckling C57/BL/6 mice
were obtained from in-house breeding colonies in the Laboratory Service
Unit, The Queen's University of Belfast. Animals were kept in a
barrier system with light negative pressure and a 12-h day (artificial
light). Mice were infected into the right cerebral hemisphere, under
mild halothane anaesthesia, with 200 TCID50 of the
recombinant viruses (20 µl). At least three animals were inoculated
for each virus pool. Negative control mice were injected with an
equivalent volume of tissue culture medium. Mice were checked for
clinical symptoms daily. At 4 days postinfection, mice were sacrificed
under ether narcosis. The whole brain was removed immediately and
immersed in 10% buffered formalin for 24 h. Brains were blocked
into right and left hemispheres, routinely processed, and embedded in
paraffin wax. Two EdtagCAMH-infected brains were frozen at
70°C and
used for RNA isolation.
Immunopathology.
A monoclonal antibody that recognizes the N
protein of MV (Harlan Seralabs) was used for immunohistochemistry at a
dilution of 1:1,000. Sections (8 µm) were cut from three levels of
the paraffin-embedded brain tissue, using a microtome. The levels were
cut to an approximate depth of 100 µm and were separated by 50 µm.
Sections were dewaxed, and MV N protein was detected as described
previously (22). A semiquantitative scoring system was used
to determine the extent of viral infection in both the right and left
hemispheres of each animal; when possible, overall number of foci were counted.
 |
RESULTS |
Generation of MV H insertion vector.
The ability to modify
full-length genomic DNA constructs of MV in a single step is of great
benefit. This is not often possible in large cDNA clones due to the
paucity of unique restriction sites. To this end, we have generated an
insertion vector which enables the rapid exchange of MV H genes in a
full-length infectious clone (Fig. 1).
The preferred approach aimed to minimize both the number of additional
nucleotides, which due to the rule of six (14) must be added
in hexamers, and specific sequence alterations, within the genome of
the virus. In the production of pMVins-H2, only one nucleotide exchange
has been incorporated into the 3' untranslated region (UTR) of the H
gene at position 9162 (A
G). The two unique restriction sites
PacI, already present in the 3' UTR of the F gene, and
AatII, introduced using synthetic oligonucleotides, permit
the insertion of H genes from other MV strains. Almost the entire H
gene (97.4%) was deleted, leaving only 50 nucleotides from the 3' UTR
in the insertion vector backbone. Additionally, the presence of the
AatII restriction site within this construct acts as a
genetic tag for all recombinant viruses produced via this cloning
strategy.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 1.
Construction of the MV insertion vector p(+)MVins-H2.
The full-length infectious clone of MV, p(+)MV (a), was used to
generate a ClaI subclone in pGEM7Zf(+) (b). The subclone was
restricted with PacI and SpeI to remove the H
gene (c). Complementary oligonucleotides were annealed (d) to generate
compatible ends with the pscMV(ClaI) cut vector and inserted
(e) to introduce a unique AatII restriction site. The
ClaI fragment was religated into p(+)MV to generate the
insertion vector (f). Nucleotide sequence numbers are given as in EMBL
accession no. Z66517; numbers below the plasmid names indicate MV
genome lengths before and after modification.
|
|
Production and rescue of recombinant MV.
With reference to MV
sequence alignments (32), universal H primers were designed
to facilitate the amplification of H genes from any strain of the
virus. The 5' primer, uniH+ (nucleotides 7238 to 7272) as numbered in
the complete antigenome sequence, includes a PacI
restriction site located in the polyadenylation site of the F gene
along with the intragenic spacer (CTT) found between the F and H genes.
The 3' primer, uniH2
(9164 to 9145), includes the novel
AatII restriction site and thereby generates the single
nucleotide exchange at antigenome position 9162 (A
G). Six random
nucleotides precede or follow the unique restriction sites in these
primers to prevent partial cleavage by the restriction enzyme due to
the proximity of the recognition site to the end of the primer. These
primers were used to amplify the H gene from the rat brain-adapted
CAM/RB strain of MV which, following PacI and
AatII restriction, was ligated into similarly treated
p(+)MVins-H2.
Recombinant virus was rescued in HeLa cells by using the
host-range-adapted helper virus MVA-T7 to provide T7 RNA polymerase in
the cytoplasm of infected cells. Plasmids expressing the MV proteins N,
P, and L were transfected along with the recombinant full-length
construct. Virus was rescued 6 to 10 days posttransfection and was
plaque purified on Vero cells. The parental virus (Edtag) was rescued
as a positive control. This virus contains three nucleotide alterations
in the noncoding region between the N and P genes to allow it to be
discriminated from the standard vaccine strain of MV (29).
Due to the increase in recombination frequency associated with the
introduction of MVA-T7, rescued viruses were extensively characterized.
Total RNA was prepared from both Edtag- and EdtagCAMH-infected cell
monolayers. For molecular characterization, two sections of the virus
genome were amplified by RT-PCR using MV-specific primers: (i)
nucleotides 9010 to 9202, which contain the AatII genetic
tag at position 9163, and (ii) nucleotides 8420 to 8752, which include
two CAM/RB-specific mutations at positions 8634 and 8707. Figure
2 shows the restriction digestion and
electrochromatograms from this analysis, which confirms the presence of
the AatII restriction site and the C
A exchange at
position 8634. This indicated that the engineered mutations were stably
retained during cell passage. Additionally, the complete H gene from
the rescued virus was sequenced to confirm that all CAM/RB mutations
were present.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 2.
Molecular characterization of rescued viruses after
passage in Vero cells [Edtag(c) and EdtagCAMH(c)] or intracerebral
injection into in C57/BL/6 mouse brain [EdtagCAMH(b)]. (A) Total RNA
was prepared from either infected cell sheets or infected brain tissue,
and viral RNA was amplified by RT-PCR. Reverse transcriptase was
omitted as a negative control (C). Products were restricted with
AatII (+), which as a genetic tag for recombinant virus
produced by using insertion vector p(+)MVins-H2; undigested samples
( ) were included for comparison. Samples were analyzed on 1.5% DNA
agarose gels. (B) PR-PCR products from cells infected with Edtag(c) and
EdtagCAMH(c) and brain tissue from mice infected with EdtagCAMH(b) were
sequenced to verify that CAM/RB sequences were retained upon
replication. Sequences which represent nucleotides 8629 to 8647 of the
viral genome are shown in the three panels. The C-to-A mutation at
nucleotide 8634, which is CAM/RB specific, is indicated by an arrow.
|
|
Characterization of recombinant virus.
The H gene of measles
virus CAM/RB differs from that of Edmonston B strain by 12 nucleotides
(20). To gain an understanding of the growth characteristics
of the recombinant virus, we carried out a single-step growth analysis.
Virus was harvested at four or five hourly time points over 86 h.
Titers of cell-associated virus, parental (Edtag and CAM/RB) and
recombinant (EdtagCAMH), were obtained in triplicate by determining
TCID50. Figure 3 shows the
growth curves for the three viruses. Similar titers, approximately 2 × 106, were attained with all three viruses by
60 h postinfection. By this stage, many areas of the cell sheet
had detached from the flask. Edtag virus titers were higher than either
the CAM/RB or the EdtagCAMH virus at equivalent time points up to
60 h postinfection, indicating that this virus grows slightly
faster. Replacement of the Edtag H gene with that of the CAM/RB strain
seems to result in a virus which exhibits a growth rate more akin to
that of the CAM/RB virus. After this time, the cell-associated titers
of all the viruses began to decrease as virus was released from the
cells into the supernatant and cells detached from the flask. It
appears, therefore, that replacement of the H glycoprotein between the brain-adapted and Edmonston vaccine strains had no apparent effect on
the growth of the virus in tissue-cultured Vero cells.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 3.
Growth curves of cell-associated virus in Vero cells.
Monolayers were infected at an MOI of 5 with the three viruses. Lines
join an average titer which was obtained from three separate tissue
culture infectious dose experiments.
|
|
Assessment of neurovirulence and immunopathology.
We wished to
determine if the neurovirulent phenotype was transferred to the Edtag
virus following replacement of the H glycoprotein with its CAM/RB
analogue. A single litter of six to seven C57/BL/6 suckling mice was
infected intracerebrally with each virus (200 TCID50) into
the right cortex. The infection was allowed to proceed for 4 days,
during which time the mice were monitored daily for clinical symptoms
of infection. Three days postinfection, mice infected with the CAM/RB
strain were showing an awkward gait and ataxia. Mice infected with the
EdtagCAMH virus showed similar clinical symptoms. Clinical signs of
infection were not observed in either the sham- or Edtag-infected
animals. Brains were dissected out from the infected mice and either
frozen directly or fixed in formalin. Total RNA was isolated from the
frozen brains. RT-PCR followed by restriction digestion was used to
confirm that the recombinant virus retained the AatII tag
sequence in the untranslated region of the H gene (Fig. 2A). DNA
sequencing confirmed that the CAM/RB-specific mutations were retained
in the H open reading frame following replication in the mouse brain
(Fig. 2B).
Brain sections were examined for the presence or absence of virus
antigen by immunohistochemistry. Representative sections
from each
virus infection are shown in Fig.
4.
Sham-infected mice,
inoculated with tissue culture medium, showed no
positive staining
for MV antigen, as was expected. A pronounced
infection can be
seen in the CAM/RB-infected C57/BL/6 suckling animals
(Fig.
4C
and E). Virus was observed in cells with the morphological
characteristics
of neurons. Anatomically such cells were found in the
hippocampus,
frontal, temporal, and olfactory cortices and neostriatum
on both
sides of symmetrical structures. Viral antigen was not found in
the ependymal cells of the ventricular layer, the cerebellum,
meninges,
or choroid plexus. Antigen was detected in the neuronal
cytoplasm and
along the entire length of processes up to the synaptic
terminals.
Astrocytes, oligodendrocytes, and microglial cells
were all
consistently negative for viral antigen. The recombinant
EdtagCAMH
virus gives rise to a less pronounced but clearly positive
infection in
the mouse brain (Fig.
4B and D). The same cell type
is infected as with
the CAM/RB virus, and the MV-infected cells
are located in the same
anatomical areas of the brain. However,
the foci are smaller at the
same time point (4 days postinfection),
as is obvious in the higher
magnification.

View larger version (101K):
[in this window]
[in a new window]
|
FIG. 4.
Immunohistochemistry of brain sections 4 days after
infection with rodent brain-adapted CAM/RB, rescued parental Edtag, and
recombinant EdtagCAMH (200 TCID50). Sections were formalin
fixed, and MV antigen was detected with an anti-(N) monoclonal
antibody; positive viral staining appears brown. (A) Edtag; (B)
EdtagCAMH; (C) CAM/RB (magnification, ×5.) Sections were digitized
with a Kodak RFS 2035 Plus Film scanner directly from the slide. (D)
EdtagCAMH; (E) CAM/RB (magnification, ×80.) Sections were photographed
on slide film and digitized with a Kodak RFS 2035 Plus Film scanner.
The final resolution of all scanned images was 300 dots per in.
|
|
To further characterize the virus infections, we used a
semiquantitative scoring system that reflects both the degree to which
each infection had progressed and the number of MV-positive foci
in the
three levels of brain tissue (Table
1).
Due to the progression
of the CAM/RB infection (Fig.
4C), it was
impossible to accurately
count the foci in the brain sections because
they were merged
to a large degree. Generally, viral antigen was more
abundant
in the right cortex, which was the side of infection.
Variation
was observed between the three animals examined, and this is
reflected
in the scoring system. It was possible to determine accurate
foci
numbers in the EdtagCAMH-infected brain sections due to the lower
level of infection. Once again, we observed variation between
animals
and greater abundance of viral antigen in sections from
the right
cortex. Infected cells were not observed in sections
from animals
infected with the Edtag virus. Clearly, at the time
point observed, the
recombinant virus EdtagCAMH replicates in
the brains of the C57/BL/6
animals, though to a lesser extent
than the CAM/RB virus.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Detection of MV N protein by immunohistochemistry in
right and left cortices of C57/BL16 mice 4 days after intracerebral
infection of the right cortex with 200 TCID50 of
brain-adapted (CAM/RB), parental (Edtag), or recombinant
virus (EdtagCAMH).
|
|
 |
DISCUSSION |
Prior to the development of the MV rescue system, it was
impossible to modify specific regions of the virus genome. This made the study of the molecular determinants of neuropathogenesis difficult. Nevertheless, when neutralizing monoclonal antibodies were used to
modulate the disease process and isolate escape mutants in vitro, a
major site was identified in the H gene, residues 368 to 396, which
appeared to be functionally important for neurovirulence (20). These observations prompted the present study to
investigate whether the H gene alone was sufficient to transfer the
neurovirulent phenotype to the parental, attenuated Edmonston
strain-derived Edtag virus. To this end, we have generated an insertion
vector which permits the addition of variant H genes into a plasmid, thereby generating full-length antigenomic constructs in a single step.
In this study, we used the vector to insert the H gene from the
brain-adapted CAM/RB and generated an infectious, recombinant virus,
EdtagCAMH. This vector has also been used to generate other recombinant
viruses with a number of single amino acid changes in the H protein and
to accept mutagenized H genes from other MV strains (10a).
The recombinant virus grows to similar titers as Edtag and CAM/RB,
indicating that the interaction of the newly incorporated H gene with
the Edmonston F gene is not impaired and that these proteins can
complement each other and give rise to a productive infection. We have
shown that the CAM/RB strain and EdtagCAMH recombinant exclusively
infect neurons, viral antigen being clearly present in the processes,
and have demonstrated the association of neurovirulence with amino
acids in the H protein.
Small changes in envelope glycoproteins have profound effects on the
neurovirulent phenotype of many viruses, such as lymphocytic choriomeningitis virus mumps virus, rabies virus, and Japanese encephalitis virus (8, 16, 23, 25, 31, 37). Dengue virus
provides one of the best models for neurovirulence in rodents. Major
determinants of mouse neurovirulence have been identified in the E
glycoprotein of the virus. One of these, in common with MV, is in a
known antigenic site, residues 383 to 393 (13, 43). Another
is comprised of only one amino acid change, E126Q-K (11). The usefulness of this model for mouse neurovirulence is augmented by
the availability of the three-dimensional structure, at atomic resolution, of the E glycoprotein of another flavivirus, tick-borne encephalitis virus (31, 38). The three-dimensional structure for the MV H glycoprotein is not, unfortunately, available. However, a
putative structure for the protein has been proposed based on the
homology modeling with active-site residues in the influenza virus
neuraminidase glycoprotein and the paramyxovirus
hemagglutinin-neuraminidase glycoprotein. The major determinants of
neurovirulence (20) are predicted to be external in this
structure (17).
An increase in neurovirulence needs not be due only to the ability to
bind a mouse receptor. Neurovirulent Sindbis virus with an alteration
in the E2 glycoprotein binds to and enters cells no more efficiently
than nonneurovirulent virus. Rather, RNA synthesis is initiated more
rapidly and attained fivefold higher levels for the neurovirulent
strain (10, 44, 45). For MV, alterations in the H protein
have profound effects on CD46 receptor downregulation; the exchange of
two amino acids also alters the ability of the virus to use CD46 as a
receptor (3, 18).
Rodent models have been generated to investigate the pathogenesis of
many viruses, including mumps virus. Alterations in the neuroanatomy
and pronounced hydrocephalus were observed upon infection. Cerebellar
abnormalities caused by defects in granule cell migration which
distinguished neurovirulent and nonneurovirulent mumps strains were
also identified (33). We have not observed cerebellar
abnormalities in any MV-infected animal. A persistent in vivo infection
has been demonstrated in newborn hamsters infected with MV from
persistently infected cell cultures. In some cases this infection was
accompanied by hydrocephalus which was most likely due to an infection
of ependymal cells (12, 27). We have no evidence from the
present study for the infection of ependymal cells. It will be
interesting to use the EdtagCAMH recombinant virus, in which the
progression of the virus is slower, to examine cerebella at later time
points to see if later sequelae can be observed in this recombinant MV infection. The relevance of these mouse brain models to human CNS
infection by MV is not clear. However, the present study shows that the
H gene is very important in MV neuropathogenesis in the model. The H
gene has been examined in isolation from the remainder of the
brain-adapted CAM/RB genome, and it is clear that its presence allows
virus to both enter and replicate in mouse neurons. In particular, it
appears that the interactions between the CAM/RB H protein and its F
protein counterpart are not perturbed in the recombinant virus. There
are six amino acid differences between the Edmonston and CAM/RB F
proteins, three of which are nonconservative changes (31a).
Clearly, in spite of these differences, the protein interactions
necessary for the virus to initiate an infection and grow to equivalent
titers in cell culture can occur. Additionally, it is apparent that
other regions of the virus genome are involved in neurovirulence. We
have demonstrated that for MV, no single gene is exclusively linked to
a neurovirulent phenotype, and this correlates well with observations
for many other RNA viruses. Future studies will (i) investigate the
molecular determinants in the H protein in greater detail and (ii)
begin to introduce other genes, M, F, and L, from CAM/RB strain into
the Edmonston B strain. We believe that these studies will give
important insights into MV neuropathogenesis in the mouse model of encephalitis.
 |
ACKNOWLEDGMENTS |
We thank Gudrun Christiansen for helpful discussions and
invaluable advice on the establishment of the MV rescue system, Mildred Wylie for providing the chicken embryo fibroblast cells, and Gerd Sutter for the original MVA-T7 virus. Additionally, we thank Roy Creighton for photographic work and Paula Haddock for excellent technical assistance. We acknowledge the help of Uta Gassen in critical
reading of the manuscript.
This work was supported by the Wellcome Trust (grant 047245), the
European Social Fund, the Deutsche Forschungsgemeinschaft, and the
Swiss National Science Foundation (grant 31-43475.95).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: School of
Biology and Biochemistry, The Queen's University of Belfast, Medical
Biology Centre, 97 Lisburn Rd., Belfast BT9 7BL, Northern Ireland,
United Kingdom. Phone: 1232 272060. Fax: 1232 236505. E-mail:
p.duprex{at}qub.ac.uk.
 |
REFERENCES |
| 1.
|
Agamanolis, D. P.,
J. S. Tan, and D. L. Parker.
1979.
Immunosuppressive measles encephalitis in a patient with a renal transplant.
Arch. Neurol.
36:686-690[Abstract/Free Full Text].
|
| 2.
|
Baczko, K.,
J. Lampe,
U. G. Liebert,
U. G. Brinckmann,
V. ter Meulen,
I. Pardowitz,
H. Budka,
S. L. Cosby,
S. Isserte, and B. K. Rima.
1993.
Clonal expansion of hypermutated measles virus in a SSPE brain.
Virology
197:188-195[Medline].
|
| 3.
|
Bartz, R.,
R. Firsching,
B. K. Rima,
V. ter Meulen, and J. Schneider-Schaulies.
1998.
Differential receptor usage by measles virus strains.
J. Gen. Virol.
79:1015-1025[Abstract].
|
| 4.
|
Bellini, W.,
G. Englund,
K. Rammohan, and D. E. McFarlin.
1986.
Evaluation of the structural proteins of the hamster neurotropic strain of measles virus with monoclonal antibodies.
J. Neuroimmunol.
11:149-163[Medline].
|
| 5.
|
Cathomen, T.,
H. Y. Naim, and R. Cattaneo.
1998.
Measles virus with altered envelope protein cytoplasmic tails gain cell fusion competence.
J. Virol.
72:1224-1234[Abstract/Free Full Text].
|
| 6.
|
Cattaneo, R., and J. K. Rose.
1993.
Cell fusion by the envelope glycoproteins of persistent measles viruses which cause lethal human brain disease.
J. Virol.
67:1493-1502[Abstract/Free Full Text].
|
| 7.
|
Chan, S. P.
1985.
Induction of chronic measles encephalitis in C57BL/6 mice.
J. Gen. Virol.
66:2071-2076[Abstract/Free Full Text].
|
| 8.
|
Dietzschold, B.,
T. J. Wiktor,
J. Q. Trojanowski,
R. I. Macfarlan,
W. H. Wunner,
M. J. Torres-Anjel, and H. Koprowski.
1985.
Differences in cell-to-cell spread of pathogenic and apathogenic rabies virus in vivo and in vitro.
J. Virol.
56:12-18[Abstract/Free Full Text].
|
| 9.
|
Dörig, R. E.,
A. Marcil,
A. Chopra, and C. D. Richardson.
1993.
The human CD46 is a receptor for measles virus (Edmonston strain).
Cell
75:295-305[Medline].
|
| 10.
|
Dropulic, L. K.,
J. M. Hardwick, and D. E. Griffin.
1997.
A single amino acid in the E2 glycoprotein of sindbis virus confers neurovirulence by altering an early step of virus replication.
J. Virol.
71:6100-6105[Abstract].
|
| 10a.
| Duprex, W. P. Unpublished results.
|
| 11.
|
Gualano, R. C.,
M. J. Pryor,
M. R. Cauchi,
P. J. Wright, and A. D. Davidson.
1998.
Characterisation of dengue 2 virus mutants that induce fusion at elevated pH.
Virology
194:219-223.
|
| 12.
|
Haspel, M. V., and F. Rapp.
1975.
Measles virus: an unwanted variant causing hydrocephalus.
Science
187:450-451[Abstract/Free Full Text].
|
| 13.
|
Hiramatsu, K.,
M. Tadano,
R. Men, and C.-J. Lai.
1996.
Mutational analysis of a neutralisation epitope on the dengue type 2 virus (DEN-2) envelope protein: monoclonal antibody resistant DEN-2/DEN-4 chimeras exhibit reduced mouse neurovirulence.
Virology
224:437-445[Medline].
|
| 14.
|
Kaelin, K.
1995.
Ph.D. thesis.
University of Zurich, Zurich, Switzerland.
|
| 15.
|
Kobune, K.,
F. Kobune,
K. Yamanouchi,
K. Nagashima,
Y. Yoshikawa, and M. Hayami.
1993.
Neurovirulence of rat brain-adapted measles virus.
Jpn. J. Exp. Med.
53:177-180.
|
| 16.
|
Kovamees, J.,
R. Rydbeck,
C. Orvell, and E. Norrby.
1983.
Haemagglutinin-neuraminidase (HN) amino acid alterations in neutralisation escape mutants of Kilham mumps virus.
Virus Res.
17:117-129.
|
| 17.
|
Langedijk, J. P.,
F. J. Daus, and J. T. van Oirschot.
1997.
Sequence and structure alignment of Paramyxoviridae attachment proteins and discovery of enzymatic activity for a morbillivirus hemagglutinin.
J. Virol.
71:6155-6167[Abstract].
|
| 18.
|
Lecouturier, V.,
J. Fayolle,
M. Caballero,
J. Carabana,
M. L. Celma,
R. Fernandez-Munoz,
T. F. Wild, and R. Buckland.
1996.
Identification of two amino acids in the hemagglutinin glycoprotein of measles virus (MV) that govern hemadsorption, HeLa cell fusion, and CD46 downregulation: phenotypic markers that differentiate vaccine and wild-type MV strains.
J. Virol.
70:4200-4204[Abstract].
|
| 19.
|
Liebert, U. G., and V. ter Meulen.
1987.
Virological aspects of measles virus-induced encephalomyelitis in Lewis and BN rats.
J. Gen. Virol.
68:1715-1722[Abstract/Free Full Text].
|
| 20.
|
Liebert, U. G.,
S. G. Flanagan,
S. Loffler,
K. Baczko,
V. ter Meulen, and B. K. Rima.
1994.
Antigenic determinants of measles virus hemagglutinin associated with neurovirulence.
J. Virol.
86:1486-1493.
|
| 21.
|
Liebert, U. G., and D. Finke.
1995.
Measles virus infections in rodents, p. 149-166.
In
V. ter Meulen, and M. A. Billeter (ed.), Measles virus. Springer-Verlag, Berlin, Germany.
|
| 22.
|
McQuaid, S.,
S. L. Cosby,
J. Kirk,
K. Koffi,
M. Hond, and S. Lucas.
1998.
Distribution of measles virus in the CNS of HIV seropositive children.
Acta Neuropathol.
96:637-642[Medline].
|
| 23.
|
Matloubian, M.,
T. Somasundaram,
S. R. Kolhekar,
R. Selvakumar, and R. Ahmed.
1990.
Genetic basis of viral persistence: single amino acid change in the viral glycoprotein affects ability of lymphocytic choriomeningitis virus to persist in adult mice.
J. Exp. Med.
172:1043-1048[Abstract/Free Full Text].
|
| 24.
|
Naniche, D.,
G. Varior-Krishnan,
F. Cervoni,
T. F. Wild,
B. Rossi,
C. Rabourdin-Combe, and D. Gerlier.
1993.
Human membrane cofactor protein (CD46) acts as a cellular receptor for measles virus.
J. Virol.
67:6025-6032[Abstract/Free Full Text].
|
| 25.
|
Ni, H., and A. D. Barrett.
1998.
Attenuation of Japanese encephalitis virus by selection of its mouse brain membrane receptor preparation escape variants.
Virology
241:30-36[Medline].
|
| 26.
|
Niewiesk, S.,
U. Brinckmann,
B. Bankamp,
S. Sirak,
U. G. Liebert, and V. ter Meulen.
1993.
Susceptibility to measles virus-induced encephalitis in mice correlates with impaired antigen presentation to cytotoxic T lymphocytes.
J. Virol.
67:75-81[Abstract/Free Full Text].
|
| 27.
|
Norrby, E.,
P. Swoveland,
K. Kristensson, and K. P. Johnson.
1980.
Further studies on subacute encephalitis and hydrocephalus in hamsters caused by measles virus from persistently infected cell cultures.
J. Med. Virol.
5:109-116[Medline].
|
| 28.
|
Peebles, M. E.
1991.
Paramyxovirus M proteins. Pulling it all together and taking it on the road, p. 247-256.
In
D. W. Kingsbury (ed.), The paramyxoviruses. Plenum Press, New York, N.Y.
|
| 29.
|
Radecke, F.,
P. Spielhofer,
H. Schneider,
K. Kaelin,
M. Huber,
C. Dotsch,
G. Christiansen, and M. A. Billeter.
1995.
Rescue of measles virus from cloned DNA.
EMBO J.
14:5773-5784[Medline].
|
| 30.
|
Reed, L. J., and H. Muench.
1938.
A simple method for estimating fifty percent endpoints.
Am. J. Hyg.
27:493-497.
|
| 31.
|
Rey, F. A.,
F. X. Heinz,
C. Mandl,
C. Kunz, and S. C. Harrison.
1995.
The envelope glycoprotein from tick-borne encephalitis at 2Å resolution.
Nature
375:291-298[Medline].
|
| 31a.
| Rima, B. K. Unpublished results.
|
| 32.
|
Rima, B. K.,
J. A. P. Earle,
K. Baczko,
V. ter Meulen,
U. G. Liebert,
C. Carstens,
J. Carabana,
M. Caballero,
M. L. Celma, and R. Fernandez-Munoz.
1997.
Sequence divergence of measles virus haemagglutinin during natural evolution and adaptation to cell culture.
J. Gen. Virol.
78:97-106[Abstract].
|
| 33.
|
Rubin, S. A.,
M. Pletnikov, and K. M. Carbone.
1998.
Comparison of the neurovirulence of a vaccine and wild-type mumps virus strain in the developing rat brain.
J. Virol.
72:8037-8042[Abstract/Free Full Text].
|
| 34.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 35.
|
Schneider, H.,
P. Spielhofer,
K. Kaelin,
C. Dotsch,
F. Radecke,
G. Sutter, and M. A. Billeter.
1997.
Rescue of measles virus using a replication-deficient vaccinia-T7 vector.
J. Virol. Methods
64:57-64[Medline].
|
| 36.
|
Schneider-Schaulies, S., and U. G. Liebert.
1991.
Pathogenic aspects of persistent measles virus infections of brain tissue.
Semin. Neurosci.
3:139-147.
|
| 37.
|
Seif, I.,
P. Coulon,
P. E. Rollin, and A. Flamand.
1985.
Rabies virulence: effect on pathogenicity and sequence characterization of rabies virus mutations affecting antigenic site III of the glycoprotein.
J. Virol.
53:926-934[Abstract/Free Full Text].
|
| 38.
|
Stiasny, K.,
S. L. Allison,
A. Marchler-Bauer,
C. Kunz, and F. X. Heinz.
1996.
Structural requirements for low-pH-induced rearrangements in the envelope protein of tick-borne encephalitis virus.
J. Virol.
70:207-212[Abstract].
|
| 39.
|
Sutter, G.,
M. Ohlmann, and V. Erfle.
1995.
Non-replicating vaccinia vector efficiently expresses bacteriophage T7 RNA polymerase.
FEBS Lett.
371:9-12[Medline].
|
| 40.
|
Taylor, M. J.,
E. Godfrey,
K. Baczko,
V. ter Meulen,
T. F. Wild, and B. K. Rima.
1991.
Identification of several different lineages of measles virus.
J. Gen. Virol.
57:357-364[Abstract/Free Full Text].
|
| 41.
|
ter Meulen, V.,
J. R. Stephenson, and H. W. Kreth.
1983.
Subacute sclerosing panencephalitis, p. 105-159.
In
H. Fraenkel-Conrat, and R. R. Wagner (ed.), Comprehensive virology, vol. 18. Plenum, New York, N.Y.
|
| 42.
|
Tober, C.,
M. Seufert,
H. Schneider,
M. A. Billeter,
I. C. Johnston,
S. Niewiesk,
V. ter Meulen, and S. Schneider-Schaulies.
1998.
Expression of measles virus V protein is associated with pathogenicity and control of viral RNA synthesis.
J. Virol.
72:8124-8132[Abstract/Free Full Text].
|
| 43.
|
Trirawatanapong, T.,
B. Chandran,
R. Putnak, and R. Padmanabhan.
1992.
Mapping of a region of dengue virus type-2 glycoprotein required for binding by a neutralising monoclonal antibody.
Gene
116:139-150[Medline].
|
| 44.
|
Tucker, P. C.,
E. G. Strauss,
R. J. Kuhn,
J. H. Strauss, and D. E. Griffin.
1993.
Viral determinants of age-dependent virulence of Sindbis virus for mice.
J. Virol.
67:4605-4610[Abstract/Free Full Text].
|
| 45.
|
Tucker, P. C.,
S. H. Lee,
N. Bui,
D. Martinie, and D. E. Griffin.
1997.
Amino acid changes in the Sindbis virus E2 glycoprotein that increase neurovirulence improve entry into neuroblastoma cells.
J. Virol.
71:6106-6112[Abstract].
|
| 46.
|
Ullrich, A.,
J. Shine,
J. Chirgwin,
R. Pictet,
E. Tischer,
W. J. Rutter, and H. M. Goodman.
1977.
Rat insulin genes: construction of plasmids containing the coding sequences.
Science
196:1313-1319[Abstract/Free Full Text].
|
| 47.
|
Urbanska, E. M.,
B. J. Chambers,
H.-G. Ljunggren,
E. Norrby, and K. Kristensson.
1997.
Spread of measles virus through axonal pathways into limbic structures in the brain of TAP1 / mice.
J. Med. Virol.
52:362-369[Medline].
|
| 48.
|
Valsamakis, A.,
H. Schneider,
P. G. Auwaerter,
H. Kaneshima,
M. A. Billeter, and D. E. Griffin.
1998.
Recombinant measles viruses with mutations in the C, V, or F gene have altered growth phenotypes in vivo.
J. Virol.
72:7754-7761[Abstract/Free Full Text].
|
| 49.
|
Wild, T. F.,
E. Malvoisin, and R. Buckland.
1991.
Measles virus. Both the hemagglutinin and fusion glycoproteins are required for fusion.
J. Gen. Virol.
72:439-442[Abstract/Free Full Text].
|
| 50.
|
Wild, T. F., and R. Buckland.
1995.
Functional aspects of envelope-associated measles virus proteins, p. 51-64.
In
V. ter Meulen, and M. A. Billeter (ed.), Measles virus. Springer-Verlag, Berlin, Germany.
|
Journal of Virology, August 1999, p. 6916-6922, Vol. 73, No. 8
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Silin, D., Lyubomska, O., Ludlow, M., Duprex, W. P., Rima, B. K.
(2007). Development of a Challenge-Protective Vaccine Concept by Modification of the Viral RNA-Dependent RNA Polymerase of Canine Distemper Virus. J. Virol.
81: 13649-13658
[Abstract]
[Full Text]
-
Moeller-Ehrlich, K., Ludlow, M., Beschorner, R., Meyermann, R., Rima, B. K., Duprex, W. P., Niewiesk, S., Schneider-Schaulies, J.
(2007). Two functionally linked amino acids in the stem 2 region of measles virus haemagglutinin determine infectivity and virulence in the rodent central nervous system. J. Gen. Virol.
88: 3112-3120
[Abstract]
[Full Text]
-
Bonami, F., Rudd, P. A., von Messling, V.
(2007). Disease Duration Determines Canine Distemper Virus Neurovirulence. J. Virol.
81: 12066-12070
[Abstract]
[Full Text]
-
Lemon, K., Rima, B. K., McQuaid, S., Allen, I. V., Duprex, W. P.
(2007). The F Gene of Rodent Brain-Adapted Mumps Virus Is a Major Determinant of Neurovirulence. J. Virol.
81: 8293-8302
[Abstract]
[Full Text]
-
Clarke, D. K., Nasar, F., Lee, M., Johnson, J. E., Wright, K., Calderon, P., Guo, M., Natuk, R., Cooper, D., Hendry, R. M., Udem, S. A.
(2007). Synergistic Attenuation of Vesicular Stomatitis Virus by Combination of Specific G Gene Truncations and N Gene Translocations. J. Virol.
81: 2056-2064
[Abstract]
[Full Text]
-
Carsillo, T., Traylor, Z., Choi, C., Niewiesk, S., Oglesbee, M.
(2006). hsp72, a Host Determinant of Measles Virus Neurovirulence. J. Virol.
80: 11031-11039
[Abstract]
[Full Text]
-
Rudd, P. A., Cattaneo, R., von Messling, V.
(2006). Canine Distemper Virus Uses both the Anterograde and the Hematogenous Pathway for Neuroinvasion. J. Virol.
80: 9361-9370
[Abstract]
[Full Text]
-
Schubert, S., Moller-Ehrlich, K., Singethan, K., Wiese, S., Duprex, W. P., Rima, B. K., Niewiesk, S., Schneider-Schaulies, J.
(2006). A mouse model of persistent brain infection with recombinant Measles virus. J. Gen. Virol.
87: 2011-2019
[Abstract]
[Full Text]
-
Sellin, C. I., Davoust, N., Guillaume, V., Baas, D., Belin, M.-F., Buckland, R., Wild, T. F., Horvat, B.
(2006). High Pathogenicity of Wild-Type Measles Virus Infection in CD150 (SLAM) Transgenic Mice.. J. Virol.
80: 6420-6429
[Abstract]
[Full Text]
-
Brown, D. D., Rima, B. K., Allen, I. V., Baron, M. D., Banyard, A. C., Barrett, T., Duprex, W. P.
(2005). Rational Attenuation of a Morbillivirus by Modulating the Activity of the RNA-Dependent RNA Polymerase. J. Virol.
79: 14330-14338
[Abstract]
[Full Text]
-
Ludlow, M., McQuaid, S., Cosby, S. L., Cattaneo, R., Rima, B. K., Duprex, W. P.
(2005). Measles virus superinfection immunity and receptor redistribution in persistently infected NT2 cells. J. Gen. Virol.
86: 2291-2303
[Abstract]
[Full Text]
-
Yoneda, M., Miura, R., Barrett, T., Tsukiyama-Kohara, K., Kai, C.
(2004). Rinderpest Virus Phosphoprotein Gene Is a Major Determinant of Species-Specific Pathogenicity. J. Virol.
78: 6676-6681
[Abstract]
[Full Text]
-
Huang, Z., Panda, A., Elankumaran, S., Govindarajan, D., Rockemann, D. D., Samal, S. K.
(2004). The Hemagglutinin-Neuraminidase Protein of Newcastle Disease Virus Determines Tropism and Virulence. J. Virol.
78: 4176-4184
[Abstract]
[Full Text]
-
Neumann, G., Whitt, M. A., Kawaoka, Y.
(2002). A decade after the generation of a negative-sense RNA virus from cloned cDNA - what have we learned?. J. Gen. Virol.
83: 2635-2662
[Abstract]
[Full Text]
-
Schneider, U., von Messling, V., Devaux, P., Cattaneo, R.
(2002). Efficiency of Measles Virus Entry and Dissemination through Different Receptors. J. Virol.
76: 7460-7467
[Abstract]
[Full Text]
-
Duprex, W. P., Collins, F. M., Rima, B. K.
(2002). Modulating the Function of the Measles Virus RNA-Dependent RNA Polymerase by Insertion of Green Fluorescent Protein into the Open Reading Frame. J. Virol.
76: 7322-7328
[Abstract]
[Full Text]
-
Erlenhofer, C., Duprex, W. P., Rima, B. K., ter Meulen, V., Schneider-Schaulies, J.
(2002). Analysis of receptor (CD46, CD150) usage by measles virus. J. Gen. Virol.
83: 1431-1436
[Abstract]
[Full Text]
-
Yoneda, M., Bandyopadhyay, S. K., Shiotani, M., Fujita, K., Nuntaprasert, A., Miura, R., Baron, M. D., Barrett, T., Kai, C.
(2002). Rinderpest virus H protein: role in determining host range in rabbits. J. Gen. Virol.
83: 1457-1463
[Abstract]
[Full Text]
-
Takeuchi, K., Takeda, M., Miyajima, N., Kobune, F., Tanabayashi, K., Tashiro, M.
(2002). Recombinant Wild-Type and Edmonston Strain Measles Viruses Bearing Heterologous H Proteins: Role of H Protein in Cell Fusion and Host Cell Specificity. J. Virol.
76: 4891-4900
[Abstract]
[Full Text]
-
Moeller, K., Duffy, I., Duprex, P., Rima, B., Beschorner, R., Fauser, S., Meyermann, R., Niewiesk, S., ter Meulen, V., Schneider-Schaulies, J.
(2001). Recombinant Measles Viruses Expressing Altered Hemagglutinin (H) Genes: Functional Separation of Mutations Determining H Antibody Escape from Neurovirulence. J. Virol.
75: 7612-7620
[Abstract]
[Full Text]
-
Weidinger, G., Henning, G., ter Meulen, V., Niewiesk, S.
(2001). Inhibition of Major Histocompatibility Complex Class II-Dependent Antigen Presentation by Neutralization of Gamma Interferon Leads to Breakdown of Resistance against Measles Virus-Induced Encephalitis. J. Virol.
75: 3059-3065
[Abstract]
[Full Text]
-
Duprex, W. P., Mcquaid, S., Roscic-Mrkic, B., Cattaneo, R., Mccallister, C., Rima, B. K.
(2000). In Vitro and In Vivo Infection of Neural Cells by a Recombinant Measles Virus Expressing Enhanced Green Fluorescent Protein. J. Virol.
74: 7972-7979
[Abstract]
[Full Text]
-
Schmid, E., Zurbriggen, A., Gassen, U., Rima, B., ter Meulen, V., Schneider-Schaulies, J.
(2000). Antibodies to CD9, a Tetraspan Transmembrane Protein, Inhibit Canine Distemper Virus-Induced Cell-Cell Fusion but Not Virus-Cell Fusion. J. Virol.
74: 7554-7561
[Abstract]
[Full Text]
-
Schneider-Schaulies, J.
(2000). Cellular receptors for viruses: links to tropism and pathogenesis. J. Gen. Virol.
81: 1413-1429
[Full Text]
-
Evlashev, A., Moyse, E., Valentin, H., Azocar, O., Trescol-Biémont, M.-C., Marie, J. C., Rabourdin-Combe, C., Horvat, B.
(2000). Productive Measles Virus Brain Infection and Apoptosis in CD46 Transgenic Mice. J. Virol.
74: 1373-1382
[Abstract]
[Full Text]
-
Duprex, W. P., McQuaid, S., Hangartner, L., Billeter, M. A., Rima, B. K.
(1999). Observation of Measles Virus Cell-to-Cell Spread in Astrocytoma Cells by Using a Green Fluorescent Protein-Expressing Recombinant Virus. J. Virol.
73: 9568-9575
[Abstract]
[Full Text]