Previous Article | Next Article 
Journal of Virology, August 1999, p. 6892-6902, Vol. 73, No. 8
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Long-Term Infection and Transformation of Dermal
Microvascular Endothelial Cells by Human Herpesvirus 8
Ashlee V.
Moses,1,*
Kenneth N.
Fish,1
Rebecca
Ruhl,1
Patricia P.
Smith,1
Joanne G.
Strussenberg,1
Liangjin
Zhu,2
Bala
Chandran,2 and
Jay A.
Nelson1
Department of Molecular Microbiology and
Immunology, Oregon Health Sciences University, Portland, Oregon
97201,1 and Department of Microbiology,
Molecular Genetics and Immunology, University of Kansas Medical
Center, Kansas City, Kansas 661602
Received 4 March 1999/Accepted 10 May 1999
 |
ABSTRACT |
Human herpesvirus 8 (HHV8) infects Kaposi's sarcoma (KS) spindle
cells in situ, as well as the lesional endothelial cells considered to
be spindle cell precursors. The HHV8 genome contains several oncogenes,
suggesting that infection of endothelial and spindle cells could induce
cellular transformation and tumorigenesis and promote the formation of
KS lesions. To investigate the potential of HHV8 infection of
endothelial cells to contribute to the development of KS, we have
developed an in vitro model utilizing dermal microvascular endothelial
cells that support significant HHV8 infection. In contrast to existing
in vitro systems used to study HHV8 pathogenesis, the majority of
dermal endothelial cells are infected with HHV8 and the viral genome is
maintained indefinitely. Infection is predominantly latent, with a
small percentage of cells supporting lytic replication, and latency is
responsive to lytic induction stimuli. Infected endothelial cells
develop a spindle shape resembling that of KS lesional cells and show
characteristics of a transformed phenotype, including loss of contact
inhibition and acquisition of anchorage-independent growth. These
results describe a relevant model system in which to study virus-host
interactions in vitro and demonstrate the ability of HHV8 to induce
phenotypic changes in infected endothelial cells that resemble
characteristics of KS spindle cells in vivo. Thus, our results are
consistent with a direct role for HHV8 in the pathogenesis of KS.
 |
INTRODUCTION |
Kaposi's sarcoma (KS) is a
multifocal vascular neoplasm involving the skin, visceral organs, and
lymph nodes. KS lesions contain distinctive proliferating spindle
cells, activated endothelial cells, fibroblasts, smooth muscle cells,
and infiltrating inflammatory cells (38, 42). Infection with
the gamma-2 herpesvirus, human herpesvirus 8 (HHV8), also known as
KS-associated herpesvirus, is closely associated with the
development of these lesions. HHV8 was first identified by
representation difference analysis of KS tissue from an AIDS patient
(11) and has subsequently been identified in >95% of KS
patients with all clinical forms of KS (2, 21, 30, 47). HHV8
sequences have also been identified in primary effusion lymphomas
(PEL), a subset of B-cell lymphomas largely confined to AIDS patients
(7), and a rare lymphoproliferative disorder known as
multicentric Castleman's disease (50). Seroepidemiologic studies also support a role for HHV8 in the etiology of KS in that HHV8
infection precedes KS development, and there is a consistent correlation between HHV8 seroprevalence and high-risk KS groups (17, 18, 23, 49, 56).
Molecular studies using PCR, in situ hybridization, and
immunohistochemical analyses have identified HHV8 in atypical
endothelial cells and spindle cells in KS lesions (6, 24, 28, 36, 51, 52). Endothelial cells are generally considered to be the
precursors of KS spindle cells (5, 12, 22, 41-45, 48), and
HHV8-infected endothelial cells are detected in very early lesions
prior to extensive spindle cell formation (24, 51, 52). HHV8
may thus promote the development of KS spindle cells as a direct
consequence of endothelial cell infection. In addition, induction of
paracrine stimuli that influence uninfected bystander cells may
facilitate spindle cell formation (14, 15, 45, 46).
Despite compelling evidence, verification of viral etiology and
identification of mechanisms of HHV8 pathogenesis have remained elusive. Clarification of these issues would be greatly assisted by the
establishment of in vitro models that accurately reflect HHV8 infection
in KS lesional tissue in vivo. The study of latently infected PEL cell
lines that support lytic replication following treatment with phorbol
esters and sodium butyrate has proved invaluable for virus
characterization and development of serological assays (3, 8, 17,
29, 39). However, the in vivo infection status of these cell
lines precludes evaluation of the consequences of a de novo viral
infection. In addition, HHV8 infection of B-lymphocyte-derived PEL
cells may differ in significant aspects from infection of cell lineages
that harbor the viral genome in KS lesions.
In vivo, the majority of spindle and endothelial cells in KS lesions
maintain a latent HHV8 infection with virus in only a small percentage
of cells spontaneously entering the lytic replication cycle (33,
36, 51, 52, 57). Current tissue culture models developed for the
study of KS pathogenesis do not adequately reproduce this viral
strategy in vitro. Spindle cells isolated from KS lesions generally
have a limited life in tissue culture, and even in established KS cell
lines, the viral genome is not well maintained (1, 2, 25).
In culture systems based on in vitro infection of endothelial,
epithelial, and fibroblastoid cells, infection occurs in only low
percentages of cells and is generally not well maintained (15, 16,
34, 40). In this report, we describe an endothelial cell-based
tissue culture model that reflects the HHV8 life cycle in KS lesions in
vivo. This model utilizes immortalized dermal microvascular
endothelial cells (DMVEC) that allow the extended maintenance of
age- and passage-matched mock-infected controls for evaluation of
virus-induced cellular changes. In this model, HHV8 established a
robust long-term infection in the majority of DMVEC. Infection was
primarily latent with a small percentage of cells spontaneously
entering the lytic cycle, and lytic replication could be significantly
induced by treatment with chemical agents. Infected DMVEC developed a
spindle shape resembling that of KS spindle cells in vivo and displayed
elements of a transformed phenotype including loss of contact
inhibition and acquisition of anchorage-independent growth.
Consequently, HHV8 infection of DMVEC represents an ideal model system
in which to study molecular mechanisms of HHV8 infection and KS
pathogenesis in vitro.
 |
MATERIALS AND METHODS |
Cells.
Primary DMVEC were obtained from Clonetics
Corporation (San Diego, Calif.) and maintained in the culture medium
recommended by Clonetics. Primary cells were immortalized by infection
with the recombinant retrovirus LXSN16 E6E7 derived from the
amphotropic retrovirus-packaging cell line PA317 (20, 35).
The recombinant virus contains the E6 and E7 genes of human
papillomavirus (HPV) type 16 flanked by the long terminal repeats of
Moloney murine leukemia virus and a neomycin resistance marker.
Briefly, primary DMVEC were infected by exposure to PA317 cell
supernatant and cultured in the presence of G418 (200 µg/ml; GIBCO
BRL, Gaithersburg, Md.) for selection of resistant clones that were
expanded and cryopreserved for subsequent use. Immortalized DMVEC were
maintained in Endothelial-SFM medium (GIBCO BRL) supplemented with 10%
human AB serum (HS; Sigma, St. Louis, Mo.), 100 U of penicillin per ml,
100 µg of streptomycin per ml, 2 mM glutamine, 25 µg of endothelial cell growth supplement (Becton-Dickinson, Bedford, Mass.) per ml, 40 µg of heparin (Sigma) per ml, and 200 µg of G418 per ml. The BCBL-1
cell line (39) was obtained through the AIDS Research and
Reference Reagent Program, Division of AIDS, National Institute of
Allergy and Infectious Diseases, National Institutes of Health (contributed by Michael McGrath and Don Ganem) and cultured in RPMI
1640 supplemented with 10% fetal bovine serum, 100 U of penicillin per
ml, 100 µg of streptomycin per ml, 2 mM glutamine, and 5 × 10
5 M 2-mercaptoethanol.
Virus infections.
BCBL-1 cells were used as a source of HHV8
for DMVEC infections. To generate HHV8-containing supernatants, BCBL
cells (106 cells/ml) were exposed to tetradecanoyl phorbol
acetate (TPA) (20 ng/ml) for 48 h and cell-free virus inoculum was
obtained by filtration through a 0.45-µm-pore-size membrane. Since no
protocol for determining the infectious titer of HHV8-containing
supernatants currently exists, fresh inocula prepared for different
experiments were standardized by ensuring that identical numbers of
passage-matched BCBL cells were likewise treated for virus induction.
For HHV8 infection, DMVEC were grown to 60 to 80% confluency in 60- or 35-mm-diameter Primaria tissue culture dishes. Heparin was omitted from
the culture medium for at least 24 h prior to virus challenge. Virus inoculum was added to monolayers (0.8 ml per 35-mm-diameter dish;
1.5 ml per 60-mm-diameter dish) for 4 h in the presence of
Polybrene (2 µg/ml) followed by the addition of equal volumes of
heparin-free culture medium for an additional 12 h or overnight. For every experiment, mock infections were performed in parallel with
BCBL supernatants exposed to UV light to inactivate HHV8. For
inactivation, BCBL supernatants were decanted into six-well trays (2 ml/well) and placed in a Stratalinker UV chamber (Stratagene, La Jolla,
Calif.) for two 10-min pulses with tray lids removed. Supernatants were
then filtered through 0.45-µm-pore-size membranes and equilibrated in
a 7% CO2 incubator for 30 min before use. To remove virus
inoculum, cells were rinsed twice in Hanks balanced salt solution and
once in culture medium and recultured in culture medium containing
heparin. Thereafter, cells were fed every 3 or 4 days and passaged by
trypsinization as required or as dictated by the experimental protocol.
For infections with virus produced by HHV8-infected DMVEC, supernatants
were harvested from uninduced and TPA-treated infected DMVEC, treated
as described above, and used to infect naive DMVEC cultures.
DNA PCR.
Infected DMVEC were examined for the presence of
HHV8-specific DNA by using primers that amplify a 233-bp fragment of
the KS330233 BamHI fragment of open reading
frame (ORF) 26 (11, 30). Genomic DNA was prepared from
serial dilutions of cells, and PCR was performed on samples equivalent
to the amount of DNA from 2 × 103, 4 × 102, 2 × 102, and 4 × 101 HHV8-exposed DMVEC. Samples prepared from 2 × 103 uninduced BCBL-1 cells and mock-infected DMVEC were
used as positive and negative controls, respectively. DNA was amplified
as follows: 3 min at 94°C (hot start); 35 cycles, with 1 cycle
consisting of 1 min at 94°C, 1 min at 58°C, and 1 min at 72°C;
and 5 min at 72°C. PCR products were visualized following
electrophoresis through agarose-ethidium bromide gels.
RT-PCR.
HHV8 genes ORF 29 and ORF K12 (kaposin) were used as
reverse transcriptase PCR (RT-PCR) targets. ORF 29 is spliced and
expressed late in the lytic infection cycle following viral DNA
replication (40), while ORF K12 is encoded by the
latency-associated 0.7-kb transcript T0.7 (57). Total RNA
was extracted from DMVEC with a Qiagen RNeasy Kit (Qiagen) according to
the manufacturer's protocol, and cDNA was reverse transcribed by using
Superscript RT (Life Technologies, Gaithersburg, Md.) at 200 U/µg of
RNA. For each reaction, controls in the absence of RT were included.
ORF 29 sequences (300 bp) were amplified with primers flanking the
splice donor (ORF 29A [GCACGTAGCCAACTCCGTG]) and acceptor
(ORF 29B [GCAGGAAACTCGTGGAGCG]) regions of the gene as
previously described (40). ORF K12 sequences (225 bp) were
amplified with primers (5' TCCTCACTCCAATCCCAATGC and 3'
CTTTGGGAGGGCACGCTAGCT) as previously described (31). The cellular hypoxanthine-guanine phosphoribosyltransferase (HPRT) gene
was amplified from each sample as a control for cDNA synthesis and
yielded consistent amplification products from sample to sample. PCR
products were visualized following electrophoresis through agarose-ethidium bromide gels.
IFA for HHV8 proteins.
Immunofluorescence assays (IFA) were
performed with a polyclonal antibody raised in rabbit against
full-length ORF 73 expressed as a glutathione S-transferase
fusion protein in baculovirus and monoclonal antibodies (MAbs) against
ORF 59 (MAb 11D1) (9) and ORF K8.1A/B (10). For
ORF 73 and ORF 59, HHV8-infected DMVEC monolayers were fixed in 95%
ethanol-5% glacial acetic acid, permeabilized with 0.5% Triton
X-100, and blocked with 20% normal goat serum (NGS) in
phosphate-buffered saline (PBS) for 20 min prior to staining with
primary antibodies followed by fluorescein isothiocyanate (FITC)-conjugated goat anti-rabbit and anti-mouse secondary antibodies (Tago, Burlingame, Calif.). For ORF K8.1A/B, monolayers were fixed with
2% paraformaldehyde (pH 7.4) in PBS followed by blocking and staining
essentially as described above. Antibodies were diluted 1:100 in 1%
NGS in PBS and incubated with monolayers for 60 min at 37°C. Staining
controls included omission of primary antibody and staining of
mock-infected monolayers with MAb 11D1. Stained cells were mounted in
SlowFade antifade reagent in 50% glycerol (Molecular Probes, Eugene,
Oreg.) and viewed on a Nikon fluorescence microscope.
IFA for cellular proteins.
Uninduced mock- and HHV8-infected
DMVEC were stained with MAbs against CD31 (clone JC/70A; DAKO,
Carpinteria, Calif.) and VE-cadherin (clone 55-7H1; Pharmingen)
followed by a FITC-conjugated goat anti-mouse secondary antibody
(TAGO), or a rabbit polyclonal antibody against von Willebrand factor
(vWF) (DAKO) followed by a tetramethyl rhodamine isocyanate
(TRITC)-conjugated goat anti-rabbit secondary antibody. For CD31 and
VE-cadherin staining, cell monolayers were fixed and permeabilized by
immersion in 2% paraformaldehyde-0.25% Triton X-100 in PBS and then
in 2% paraformaldehyde alone (both immersions for 5 min each at room
temperature). For vWF staining, cells were fixed and permeabilized as
described above for staining with the HHV8 MAb 11D1. Cells were blocked
with 20% NGS and incubated with the relevant antibodies diluted 1:100
in PBS containing 1% NGS for 60 min at 37°C. Cells were mounted and
viewed as described above.
Electron microscopy.
To prepare DMVEC for transmission
electron microscopy, HHV8-infected and mock-infected monolayers were
rinsed twice in cacodylate buffer and scraped into Karnovsky's
fixative. Cell pellets were postfixed in 1% OsO4,
dehydrated in a graded series of solutions of ethanol and propylene
oxide and embedded in Spurr's resin for thin sectioning. Thin sections
were stained with uranyl acetate and lead citrate and examined on a
Philips EM 300 electron microscope.
Morphology changes.
To assess changes in cell morphology in
mock- and HHV8-infected DMVEC, cells were examined on a regular basis
on an inverted light microscope. Cells were examined for evidence of
spindling, virus-induced cytopathic effect, and evidence of
transformation reflected by loss of contact inhibition and development
of adherent foci in the monolayer.
Soft agar.
Mock- and HHV8-infected DMVEC were trypsinized,
resuspended at a concentration of 104 cells/ml in 2×
Dulbecco modified Eagle medium additionally supplemented with 5% HS,
heparin, and endothelial cell growth supplement in a final amount of
0.36% melted agar and added to an underlay of 0.6% agar in 2×
Dulbecco modified Eagle medium with 5% HS. Infected DMVEC cultures
used in soft-agar experiments were not exposed to lytic-cycle induction
stimuli. Parallel immunostained cultures contained approximately 20%
latently infected ORF 73-positive cells and no more than 0.5% of cells
expressing the lytic-cycle ORF 59 protein. Cells were fed every 5 days
and routinely observed by microscopy for colony formation.
 |
RESULTS |
DMVEC are permissive for HHV8 infection.
Dermal endothelial
cells were obtained from a commercial source and immortalized with the
E6 and E7 genes of HPV type 16 (20). DMVEC were infected
with HHV8 by exposure to cell-free supernatants derived from phorbol
ester-treated BCBL cells. For mock infections, viral inoculum was
exposed to UV light to inactivate virus. To initially verify infection,
PCR was performed with primers that amplify the KS330233
BamHI region of HHV8 DNA originally associated with KS
lesions (11). Figure 1a
illustrates product amplified from DNA obtained from as few as 200 HHV8-exposed DMVEC at day 7 postinfection (PI) and at day 14 PI
following one tissue culture passage. The intensity of the PCR signal
from equivalent cell numbers was enhanced at later times PI. DNA from
mock-infected cells was similarly tested but failed to yield detectable
amplification products. An RT-PCR assay targeting the ORF 29 gene was
used to confirm the presence of de novo viral gene expression in these cells (Fig. 1b). As ORF 29 contains a 4-kb intron, the spliced RT-PCR
product is smaller than any product amplified from contaminating input
viral DNA or genomic DNA (40). To illustrate this
difference, ORF 29 was also amplified from BCBL-1 cell genomic DNA and
reverse-transcribed cDNA. HHV8-infected DMVEC expressed transcripts
that corresponded to ORF 29 amplified from spliced mRNA, thus
indicating de novo viral gene expression in infected cells.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 1.
DNA and RT-PCR analyses of HHV8-infected DMVEC. (a) DNA
PCR amplification of the HHV8-specific KS330233 sequence
from serial dilutions of HHV8-exposed DMVEC (+HHV8). DNA was amplified
from 2 × 103, 4 × 102, and 2 × 102 and cell equivalents at 7 and 14 days PI (d7 PI and
d14 PI, respectively). For positive and negative controls, PCR was
performed on genomic DNA prepared from 2 × 103 BCBL-1
cells and mock-infected DMVEC. (b) RT-PCR detection of ORF 29 mRNA
using cDNA from 2 × 103 HHV8-exposed DMVEC (+HHV8) at
7 and 14 days PI (d7 PI and d14 PI, respectively) to verify the
authenticity of HHV8 infection. cDNA prepared from BCBL-1 cells was
used as a positive control. No signal was obtained from mock-infected
cells or samples prepared in the absence of RT ( RT). Cellular HPRT
was simultaneously amplified from all +RT samples as a control for cDNA
synthesis (data not shown). Amplification products from
reverse-transcribed BCBL-1 cell cDNA and genomic DNA (BCBL-1 gDNA)
demonstrate that the RT-PCR product from spliced mRNA is smaller than
the product from genomic DNA. Products amplified from HHV8-infected
DMVEC show only the smaller band, indicating lack of contamination from
the viral inoculum or replicated virus.
|
|
HHV8-infected DMVEC express ORF 73 (LANA).
In situ
hybridization and immunohistochemical studies illustrate that the
majority of endothelial and spindle cells in KS lesions harbor the HHV8
genome in a latent state (36, 51, 52, 57). Such studies
demonstrate expression of the latency-associated 0.7-kb transcript
(T0.7) which encodes the ORF K12 protein, kaposin, and the
latency-associated nuclear antigen (LANA) encoded by ORF 73. To
characterize latent infection in DMVEC infected with HHV8 in vitro,
we examined expression of ORF K12 by RT-PCR and ORF 73 by IFA. As
illustrated in Fig. 2a, ORF K12
transcripts were readily amplified from HHV8-infected DMVEC but
not mock-infected DMVEC at day 14 PI. The ability to amplify
kaposin from as few as 200 virus-exposed cells indicates the
maintenance of latent virus in a significant proportion of cells.
IFA using a rabbit polyclonal antiserum against ORF 73 demonstrated
typical punctate LANA reactivity in infected DMVEC nuclei. ORF 73 expression was detected as early as 12 h PI but initially never in
more than 10% of HHV8-exposed cells. The percentage of ORF 73-positive
cells increased with time PI until as many as 80% of cells in a
monolayer were latently infected. Figure 2b illustrates ORF 73 expression in approximately 50% of cells at day 7 PI.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 2.
Expression of latency-associated genes in HHV8-infected
DMVEC. (a) RT-PCR detection of HHV8 kaposin (ORF K12) mRNA by RT-PCR
from HHV8-infected (+HHV8) but not mock-infected DMVEC. cDNA from
uninduced BCBL-1 cells was included as a positive control. Products
amplified from cDNA prepared from 2 × 103, 4 × 102, and 2 × 102 and cell equivalents at
day 14 PI are shown. No signal was detected in samples prepared in the
absence of RT ( RT). Cellular HPRT was simultaneously amplified from
all +RT samples as a control for cDNA synthesis (data not shown). (b)
Nuclear expression of latent antigen ORF 73 in HHV8-infected DMVEC at
day 7 PI visualized with a polyclonal antibody against ORF 73 and a
goat anti-rabbit FITC conjugate.
|
|
Stimulation of latently infected DMVEC induces lytic replication of
HHV8.
In our previous experiments, the expansion of ORF
73-positive cells and the increased intensity of DNA and RT-PCR signals observed with time PI suggested spread of infection through
virus-exposed DMVEC cultures. This spread of infection may reflect the
division of latently infected cells or the entry of a percentage of
infected cells into the lytic replication cycle with release of viral
progeny and reinfection within the culture. Detection of ORF 29 mRNA
expression (Fig. 1b) also suggested the capacity for DMVEC to support
lytic replication, since in other herpesviruses this gene product
functions in DNA packaging during capsid assembly (4). In
vivo, only a fraction of spindle cells (2 to 5%) in KS lesions support
productive infection as shown by expression of lytic-cycle genes
(51, 57) and detection of intranuclear herpesvirus particles
(33, 55). To characterize lytic infection in DMVEC in vitro,
we evaluated expression of two lytic-cycle-associated proteins encoded
by ORF 59 and ORF K8.1A/B in HHV8-infected DMVEC by IFA. ORF 59 encodes a DNA replication accessory protein (9), and ORF
K8.1A/B encodes a glycoprotein expressed as a late gene product
(10). Nuclear reactivity for ORF 59 was reproducibly
detected by 48 h PI and persisted with time and even after
multiple tissue culture passages, indicating the maintenance of
lytically infected cells within the cell population. The number of
cells expressing ORF 59 was initially low (<1%) but increased with
time PI, and spontaneous ORF 59 expression was detected in as many as
5% of cells in HHV8-exposed monolayers by 8 weeks PI (Fig.
3a).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 3.
Expression of lytic-cycle-associated proteins in
HHV8-infected DMVEC. (a) Nuclear expression of ORF 59 visualized with
MAb 11D1 and a goat anti-mouse FITC conjugate at 1, 4, and 8 weeks PI
in HHV8-infected DMVEC cultures that were not induced (No TPA). Cells
were subcultured at weekly intervals. The increase in ORF 59-positive
cells indicates maintenance of the HHV8 genome and a complete viral
replication cycle allowing infection spread. (b) ORF 59 expression in
duplicate DMVEC cultures at 1, 4, and 8 weeks PI that had been
pretreated with TPA for 48 h (+TPA). (c) ORF 59 expression in
HHV8-infected DMVEC at 4 weeks PI without (No Dex) or with (+Dex)
pretreatment with dexamethasone for 5 days. Treatment with exogenous
induction stimuli (TPA or dexamethasone) increased the percentage of
ORF 59-positive cells approximately 10-fold. (d) Expression of
glycoprotein ORF K8.1A/B, a late gene product, on the surface of
HHV8-infected DMVEC visualized with a MAb against K8.1A/B and a goat
anti-mouse FITC conjugate.
|
|
In the BCBL-1 cell line in which the majority of cells are latently
infected by HHV8, treatment of these cells with chemical
stimuli such
as TPA or
n-butyrate induces lytic replication in
up to 40%
of cells (
10,
26,
49). In order to assess whether
latently
infected DMVEC were similarly responsive to lytic-cycle
induction,
DMVEC were treated with TPA,
n-butyrate, or the
glucocorticoid
dexamethasone. A 48-h exposure to TPA (Fig.
3b) or
n-butyrate
(data not shown) or a 5-day exposure to
dexamethasone (Fig.
3c)
resulted in a 5- to 10-fold increase in the
number of ORF 59-positive
cells compared to that in parallel uninduced
cultures. However,
the percentage of ORF 59-positive cells never
exceeded 40% of
the induced culture, even when parallel uninduced
cultures contained
as many as 5% spontaneously ORF 59-positive cells.
Thus, similar
to PEL cell lines, latently infected DMVEC have the
potential
to enter the lytic cycle following exposure to the
appropriate
stimuli, but not every infected cell is responsive to
induction.
Simultaneous evaluation of ORF 59 and ORF 73 expression
demonstrated
that, in the absence of exogenous stimuli, lytically
infected
cells generally represented 0.5 to 5% of the latently
infected
cell
population.
When HHV8-infected DMVEC were evaluated for the presence of the late
gene product ORF K8.1A/B following TPA induction, membrane
reactivity
was readily observed (Fig.
3d), but expression of this
glycoprotein was
always 5- to 10-fold lower than expression of
ORF 59 in parallel
cultures. If every ORF 59-positive cell ultimately
expresses ORF
K8.1A/B, then these results reflect the asynchronous
temporal sequence
of lytic gene expression within individual cells.
Alternately, these
observations may indicate that only a fraction
of cells expressing
early lytic-cycle genes progress to a complete
replication
cycle.
To confirm that DMVEC were permissive for HHV8 replication,
transmission electron microscopy was used to detect viral progeny
within HHV8-infected DMVEC. Herpesvirus-like structures with diameters
of 80 to 100 nm were observed within infected-cell nuclei (Fig.
4a), and particles with diameters of 100 to 120 nm were localized
to subcellular compartments that
resembled cytoplasmic cisternae
(Fig.
4b). Visualization of
intracellular virus particles exclusively
in HHV8-infected DMVEC
confirmed the ability of HHV8 to productively
infect these cells.

View larger version (93K):
[in this window]
[in a new window]
|
FIG. 4.
Detection of HHV8 particles in infected DMVEC by
electron microscopy. (a) View of a DMVEC nucleus showing
herpesvirus-like capsid structures. The insert shows an enlarged view
of a single virion (bar = 100 nm). (b) View of a cytoplasmic
vesicle containing mature virions sectioned within the nuclear plane
(bar = 120 nm).
|
|
To determine the ability of infected DMVEC to release infectious
virions, cell-free supernatants from infected DMVEC were
transferred to uninfected DMVEC and reinfection was evaluated
by PCR
and IFA. Cells exposed to HHV8-infected DMVEC supernatants
expressed
HHV8-specific DNA and mRNA transcripts and viral proteins
(data not
shown), confirming the ability of infected DMVEC to
release infectious
virus. ORF 73 was expressed in <1% of cells
24 h postexposure to
supernatants from uninduced DMVEC, indicating
spontaneous production of
infectious virus but at a low frequency.
In contrast, as many as 10%
of cells expressed ORF 73 cells 24
h postexposure to supernatants
from TPA-induced DMVEC, reflecting
the increased entry of cells into
the permissive viral replication
cycle. Infection has been successfully
transferred over six serial
passages to successive naive cultures,
suggesting that such transfer
could occur
indefinitely.
The results presented above indicate that, similar to infection of
endothelial and spindle cells in vivo, infection of DMVEC
in vitro
is primarily latent with only a small fraction of cells
expressing
lytic-cycle genes and producing infectious viral
progeny.
HHV8 infection of DMVEC induces a KS-like cellular phenotype.
Early KS lesions are characterized by atypical endothelial cells, with
spindle cells developing as the disease progresses. The existence of
HHV8-infected endothelial cells prior to extensive spindle cell
formation strongly supports the hypothesis that endothelial cells are
the precursors of spindle cells and that HHV8 infection drives
tumorigenesis. Under normal tissue culture conditions, DMVEC display
the typical endothelial cobblestone appearance (Fig. 5a). However, following infection with
HHV8, cells displaying a spindle shape were observed within DMVEC
cultures (Fig. 5b and c). Spindle phenotypes included elongated cells
that retained oval cell bodies, elongated cells that were uniformly
narrow, and extremely narrow light-refractile cells that displayed
scattering. In addition to spindle cells, a percentage of DMVEC
exhibiting cell rounding were observed. The extent of phenotypic change
within infected-cell monolayers increased with time PI and correlated well with the percentage of HHV8-infected cells. To evaluate the role
of direct virus infection on DMVEC morphology, cultures exhibiting foci
of phenotypic change were examined by IFA for expression of
latent-cycle (ORF 73) and lytic-cycle (ORF 59 and ORF K8.1) HHV8
proteins. Uninfected DMVEC adjacent to infected cells retained cobblestone appearance or were only mildly elongated, implying that
while soluble factors produced by infected cells may induce a degree of
morphologic change, the marked spindling is a consequence of direct
virus infection. While almost all spindle cells were latently infected,
as shown by ORF 73 reactivity, not all spindle cells expressed
lytic-cycle ORF 59. Expression in spindle cells of a latent gene
product but not a gene product essential for viral DNA replication
suggested that expression of the latent gene program alone was
sufficient to induce morphologic change. However, ORF 59-positive cells
demonstrated more-extensive spindling than ORF 73-positive cells and
the intensity of ORF 59 expression correlated with the severity of
spindling observed. Mildly spindled, ORF 59-positive cells displayed
only punctate nuclear reactivity with minimal reactivity throughout the
rest of the nucleus, while with enhanced spindling and scattering, the
intensity of background nuclear staining increased (Fig. 5d). Cells
exhibiting rounding were always strongly ORF 59 positive and
importantly, expressed the K8.1A/B glycoprotein (Fig. 5e). The robust
expression of this late gene product in rounding cells suggested that
cells were rounding as a consequence of a complete viral replication
cycle. Electron microscopy studies of KS lesions indicate that a small percentage of infected cells undergo lysis and release of mature virions (33, 55). In DMVEC cultures, cell rounding may
represent the stage immediately prior to lysis and release of viral
progeny. Every lytically infected cell may progress through stages of
spindling and ultimately to rounding and lysis. Alternately, these
phenotypes may not represent a predestined sequence but may instead
reflect expression of different lytic gene programs.

View larger version (80K):
[in this window]
[in a new window]
|
FIG. 5.
Induction of spindle morphology in DMVEC cultures
following HHV8 infection. (a) Phase-contrast microscopy of
mock-infected DMVEC, demonstrating the typical cobblestone appearance.
(b) Phase-contrast microscopy of HHV8-infected DMVEC at 1 week PI,
demonstrating the appearance of cells with a spindle shape within the
monolayer. (c) Phase-contrast microscopy of HHV8-infected DMVEC at 4 weeks PI, demonstrating the increase in morphologic change with time
PI. (d) Fluorescence (left) and phase-contrast (right) microscopy
fields of HHV8-infected DMVEC, demonstrating a correlation between ORF
59 expression and severity of phenotypic change. (e) Fluorescence
(left) and phase-contrast (right) microscopy fields, demonstrating
strong expression of ORF K8.1A/B in DMVEC exhibiting cell rounding.
|
|
In accordance with an endothelial origin, KS spindle cells express a
variety of endothelial cell markers including CD34, VE-cadherin,
and
CD31 (
43,
54). However, spindle cell expression of vWF,
a
classical marker of endothelial phenotype, is variable or absent
(
37). In our study, mock-infected DMVEC expressed CD31 (data
not shown) and VE-cadherin (Fig.
6a) at
cell borders and vWF in
Weibel-Palade bodies and perinuclear
compartments (Fig.
6b). In
HHV8-infected cultures, expression of CD31
(data not shown) and
VE-cadherin was maintained at intercellular
junctions (Fig.
6c),
but vWF was progressively lost from HHV8-infected
cultures (Fig.
6d). Expression of ORF 73, but not necessarily ORF 59, in vWF-negative
cells indicated that latent infection was sufficient to
induce
vWF loss (data not shown). These results indicate that following
HHV8 infection in vitro, DMVEC develop characteristics such as
morphologic change and selective loss of endothelial markers that
resemble properties of spindle cells in KS lesions.

View larger version (70K):
[in this window]
[in a new window]
|
FIG. 6.
Expression of endothelial cell phenotypic markers by
HHV8-infected DMVEC. (a) IFA demonstrating maintenance of VE-cadherin
at cell junctions in spindle-shaped, HHV8-infected DMVEC (+HHV8) and
mock-infected, cobblestone DMVEC. CD31 expression was similarly
retained following HHV8 infection (data not shown). (b) IFA
demonstrating loss of vWF expression in DMVEC cultures following HHV8
infection (+HHV8). In contrast, mock-infected cultures express high
levels of vWF in characteristic rod-shaped Weibel-Palade bodies.
Cultures were uninduced and were stained at 4 weeks PI when
approximately 80% of cells expressed ORF 73 (data not shown).
|
|
HHV8 induces growth of DMVEC in soft agar.
The spindle cell is
the distinguishing tumor cell of the KS lesion. A number of HHV8 genes
with homology to cellular growth factors and oncogenes have been
identified (reviewed in reference 32). These factors
and genes include viral interleukin-6 (ORF K2), viral MIP-I (ORF 6) and
viral MIP-II (ORF 4), a bcl-2 homolog (ORF 16), an
interferon regulatory factor homolog (ORF K9), a viral type D cyclin
(ORF 72), and a homolog of a G-protein-coupled receptor (ORF 74). In
addition, expression of kaposin from the ORF K12 gene leads to cellular
transformation of RAT-3 cells and development of vascular sarcomas in
athymic nu/nu mice (31), while the nuclear
location and acidic amino acid-rich sequence of ORF 73 suggest that it
may function as a regulator of transcription (13). Thus,
expression of HHV8 genes may induce cellular transformation. Characteristics of transformed cells in vitro include loss of contact
inhibition, as demonstrated by focus formation in monolayer culture,
and acquisition of anchorage-independent growth, as demonstrated by the
ability to form colonies in soft agar. We thus evaluated HHV8-infected
cultures for evidence of a transformed phenotype using these two
criteria. Mock-infected cells always maintained a discrete monolayer,
even when cultured postconfluency and were unable to grow in soft agar
(data not shown). Thus, immortalization by HPV proteins does not confer
characteristics of a fully transformed cell. In contrast, when
HHV8-infected DMVEC were incubated at postconfluency to allow efficient
spread of infection throughout the culture, foci of cells that showed
strong expression of HHV8 proteins and displayed loss of contact
inhibition were observed (Fig. 7a). In
addition, when HHV8-infected DMVEC were plated in soft agar and
observed for colony growth, large colonies were observed after 2 weeks
(Fig. 7b). In wells where 2 × 103 latently infected
cells and no more than 5 × 101 lytically infected
cells were seeded, as many as 100 colonies were scored. Since the
number of colonies exceeded the number of lytically infected cells
seeded, these results suggest that latent infection is sufficient to
confer the transformed phenotype.

View larger version (158K):
[in this window]
[in a new window]
|
FIG. 7.
Loss of contact inhibition and growth in soft agar by
HHV8-infected DMVEC. (a) Phase-contrast microscopy of an HHV8-infected
DMVEC monolayer demonstrating loss of contact inhibition and piling up
of cells into foci following culture postconfluency for 5 and 10 days.
(b) Phase-contrast microscopy of cultures grown on soft agar 2 weeks
after seeding of cells from mock-infected and HHV8-infected (+HHV8)
DMVEC. Colonies were formed exclusively by HHV8-infected cells.
|
|
 |
DISCUSSION |
In this report we describe the extensive, long-term infection of
DMVEC with HHV8. This model represents a significant advance over
currently available tissue culture systems in which less than 10% of
HHV8-challenged cells are infected and infection is not well maintained
(15, 16, 34, 40). In KS lesions in vivo, the majority of
spindle cells are latently infected with a subpopulation supporting
lytic replication (33, 36, 51, 52, 57). Our model accurately
represents this viral strategy, as the majority of DMVEC maintained the
viral genome in a latent state with only a small number (±5%) of
latently infected cells spontaneously entering the lytic cycle. In PEL
cell lines, treatment with TPA or n-butyrate induces lytic
replication of HHV8 in latently infected cells (10, 26, 49).
DMVEC were similarly responsive to these induction stimuli with
expression of lytic-cycle proteins in up to 40% of induced cells.
Interestingly, the synthetic glucocorticoid dexamethasone was as
effective as TPA and n-butyrate for induction of lytic
replication in DMVEC. A direct effect of glucocorticoids on the HHV8
replication cycle may contribute to the immunosuppression-related appearance or exacerbation of KS that is documented in patients treated
with corticosteroids (19, 53).
The DMVEC used in this study were preimmortalized by HPV E6 and E7
genes to facilitate an extended in vitro life span. While we (data not
shown) and others (34) have been able to infect primary
DMVEC with HHV8, the number of cells initially infected is low and
infection does not spread throughout the culture to yield a high
percentage of infected cells. The inability to establish significant
productive infection of primary DMVEC may be attributed to their
naturally limited life span in culture. Even if infection with HHV8
could confer a growth advantage on primary DMVEC, as described by
Flores and colleagues for infection of primary bone marrow endothelial
cells (15), the low initial infection rate and limited in
vitro passage appear to preclude any growth advantage conferred from
the infected cells in the culture. Immortalized DMVEC retain the
essential in vitro features of primary cells, but the extended life
span facilitates the establishment of infection and also enables the
long-term maintenance of age- and passage-matched mock-infected control
cells in parallel with HHV8-infected cultures for comparison of
HHV8-related phenotypic changes. Following HHV8 infection, DMVEC shape
changed from a classical cobblestone to a spindle. In addition, while
expression of the endothelial markers CD31 and VE-cadherin was
maintained at spindle cell junctions, expression of vWF was lost from
infected cells. Importantly, infected DMVEC also acquired features
characteristic of a transformed phenotype, including loss of contact
inhibition and acquisition of anchorage-independent growth. In these
respects, the altered phenotype of DMVEC infected in vitro resembles
the phenotype of infected endothelial and spindle cells in vivo and
supports the hypothesis that HHV8-infected endothelial cells are the
precursors of KS spindle cells.
HHV8 may alter the phenotype of endothelial cells as a direct
consequence of infection or as a result of induction of paracrine mechanisms that influence adjacent uninfected cells (14, 15, 45,
46). In our study, mildly spindled uninfected DMVEC were observed in virus-exposed cultures, particularly when culture medium
was infrequently changed to allow autologous medium conditioning. Thus,
paracrine influences are likely to operate in HHV8-exposed DMVEC
cultures, as has been described for HHV8-exposed bone marrow-derived endothelial cell cultures, and similar influences may indeed play an
important role in spindle cell formation in vivo. However, the frequent
observance of uninfected cobblestone-shaped DMVEC in close proximity to
infected spindle-shaped cells strongly suggests a direct influence of
HHV8 on the infected cell that cannot be explained by paracrine stimuli
alone. Similarly, Flore and colleagues (15) found that
direct infection of bone marrow endothelial cells was a prerequisite
for HHV8-induced transformation. Viral proteins may induce changes
unique to HHV8-infected cells. In addition, cellular proteins may be
preferentially upregulated on infected cells, making them more
responsive to autocrine and/or paracrine stimuli than adjacent
uninfected cells in the identical microenvironment.
In this study, detection in the majority of spindle-shaped DMVEC of
latent-cycle, but not lytic-cycle, gene products suggests that latent
infection is sufficient to induce phenotypic change. The significance
of lytic replication for KS pathogenesis remains to be fully
established. Lytic replication would promote expansion of virus
infection, but the extent to which lytic gene expression is compatible
with cellular proliferation or transformation is unclear. The
mechanisms that determine the progression of the HHV8 life cycle from
latency to lytic replication in vivo remain to be determined, but
presumably there are naturally occurring immunologic stimuli with the
capacity to activate lytic replication, as has been shown for
chemically induced lytic-cycle induction in PEL lines in vitro
(39, 57). Such stimuli likely account for the dynamic nature
of the disease in AIDS patients with KS and KS patients undergoing
iatrogenic immunosuppression (19, 27, 53). As the HHV8
genome in our DMVEC model is responsive to induction stimuli, this
model should assist in the identification of viral and cellular genes
that control switching from latent to lytic replication as well as
elucidation of immunologic or drug-induced stimuli that could induce or
exacerbate this process.
In conclusion, we have developed a tissue culture model for the study
of HHV8 and KS which represents a significant advance over current
systems for a number of reasons. First, as KS manifests primarily as a
skin disease, dermis-derived endothelial cells represent a relevant
cell type for evaluation of HHV8 pathogenesis. Second, viral infection
accurately reflects the pattern seen in vivo with the majority of cells
within the culture being latently infected and a small percentage
spontaneously entering the lytic cycle. Third, infected cultures
undergo phenotypic changes including spindle cell morphology and
characteristics of a transformed phenotype that resemble stages of KS
tumorigenesis. We have been able to maintain infected cultures for over
a year with multiple tissue culture passages. The ability to routinely
passage infected cultures and maintain HHV8 suggests that infected
cultures should be indefinitely maintained. Thus, these cells should
prove invaluable for the study of the virus life cycle and gene
expression patterns inside endothelial cells as well as allowing
elucidation of cellular and viral mechanisms involved in tumorigenesis.
 |
ACKNOWLEDGMENTS |
We thank Michael Jarvis and Randy Taplitz for helpful discussions
on the manuscript and Andrew Townsend for assistance with graphics.
This work was supported in part by a grant from Viral Partners L.L.C.
(J.A.N.), Public Health Service grant CA-75911 (B.C.), grant KUMC
RI-8906 (B.C.), and a grant from the KUEA-Ernst F. Lied Fund (B.C.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Microbiology and Immunology, L220, Oregon Health Sciences
University, 3181 SW Sam Jackson Park Rd., Portland, OR 97201. Phone:
(503) 494-2438. Fax: (503) 494-6862. E-mail:
mosesa{at}ohsu.edu.
 |
REFERENCES |
| 1.
|
Aluigi, M. G.,
A. Albini,
S. Carlone,
L. Repetto,
R. De Marchi,
A. Icardi,
M. Moro,
D. Noonan, and R. Benelli.
1996.
KSHV sequences in biopsies and cultured spindle cells of epidemic, iatrogenic and Mediterranean forms of Kaposi's sarcoma.
Res. Virol.
147:267-275[Medline].
|
| 2.
|
Ambroziak, J. A.,
D. J. Blackbourn,
B. G. Herndier,
R. G. Glougau,
J. H. Gullet,
A. R. McDonald,
E. T. Lennette, and J. A. Levy.
1995.
Herpes-like sequences in HIV-infected and uninfected Kaposi's sarcoma patients.
Science
268:582-583[Free Full Text].
|
| 3.
|
Arvanitakis, L.,
E. A. Mesri,
R. G. Nador,
J. W. Said,
A. S. Asch,
D. M. Knowles, and E. Cesarman.
1996.
Establishment and characterization of a primary effusion (body cavity-based) lymphoma cell line (BC-3) harboring Kaposi's sarcoma-associated herpesvirus (KSHV/HHV-8) in the absence of Epstein-Barr virus.
Blood
88:2648-2654[Abstract/Free Full Text].
|
| 4.
|
Baines, J. D.,
A. D. Poon,
J. Rovnak, and B. Roizman.
1994.
The herpes simplex virus 1 UL15 gene encodes two proteins and is required for cleavage of genomic viral DNA.
J. Virol.
68:8118-8124[Abstract/Free Full Text].
|
| 5.
|
Becksted, J. H.,
G. S. Woods, and V. Fletcher.
1985.
Evidence for the origin of Kaposi's sarcoma from lymphatic endothelium.
Am. J. Pathol.
119:294-300[Abstract].
|
| 6.
|
Boshoff, C.,
T. F. Schulz,
M. M. Kennedy,
A. K. Graham,
C. Fisher,
A. Thomas,
J. O. McGee,
R. A. Weiss, and J. J. O'Leary.
1995.
Kaposi's sarcoma-associated herpesvirus infects endothelial and spindle cells.
Nat. Med.
1:1274-1278[Medline].
|
| 7.
|
Cesarman, E.,
Y. Chang,
P. S. Moore,
J. W. Said, and D. M. Knowles.
1995.
Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas.
N. Engl. J. Med.
332:1186-1191[Abstract/Free Full Text].
|
| 8.
|
Cesarman, E.,
P. S. Moore,
P. H. Rao,
G. Inghirami,
D. M. Knowles, and Y. Chang.
1995.
In vitro establishment and characterization of two acquired immunodeficiency syndrome-related lymphoma cell lines (BC-1 and BC-2) containing Kaposi's sarcoma-associated herpesvirus-like (KSHV) DNA sequences.
Blood
86:2708-2714[Abstract/Free Full Text].
|
| 9.
|
Chan, S. R.,
C. Bloomer, and B. Chandran.
1998.
Identification and characterization of human herpesvirus-8 lytic cycle-associated ORF 59 protein and the encoding cDNA by monoclonal antibody.
Virology
240:118-126[Medline].
|
| 10.
|
Chandran, B.,
C. Bloomer,
S. R. Chan,
L. Zhu,
E. Goldstein, and R. Horvat.
1998.
Human herpesvirus-8 ORF K8.1 gene encodes immunogenic glycoproteins generated by spliced transcripts.
Virology
249:140-149[Medline].
|
| 11.
|
Chang, Y.,
E. Cesarman,
M. S. Pessin,
F. Lee,
J. Culpepper,
D. M. Knowles, and P. S. Moore.
1994.
Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma.
Science
266:1865-1869[Abstract/Free Full Text].
|
| 12.
|
Corbeil, J.,
L. A. Evans,
E. Vasak,
D. A. Cooper, and R. Penney.
1991.
Culture and properties of cells derived from Kaposi's sarcoma.
J. Immunol.
146:2972-2976[Abstract].
|
| 13.
|
Dittmer, D.,
M. Lagunoff,
R. Renne,
K. Staskus,
A. Haase, and D. Ganem.
1998.
A cluster of latency expressed genes in Kaposi's sarcoma-associated herpesvirus.
J. Virol.
72:8309-8315[Abstract/Free Full Text].
|
| 14.
|
Ensoli, B.,
S. Nakamura,
S. Z. Salahuddin,
P. Biberfeld,
L. Larsson,
B. Beaver,
F. Wong-Staal, and R. C. Gallo.
1989.
AIDS-Kaposi's sarcoma-derived cells express cytokines with autocrine and paracrine growth effects.
Science
243:223-226[Abstract/Free Full Text].
|
| 15.
|
Flore, O.,
S. Rafii,
S. Ely,
J. J. O'Leary,
E. M. Hyjek, and E. Cesarman.
1998.
Transformation of primary human endothelial cells by Kaposi's sarcoma-associated herpesvirus.
Nature
394:588-592[Medline].
|
| 16.
|
Foreman, K. E.,
J. Friborg, Jr.,
W. P. Wong,
C. Woffendin,
P. J. Polverini,
B. J. Nickloff, and G. J. Nabel.
1997.
Propagation of a human herpesvirus from AIDS-associated Kaposi's sarcoma.
N. Engl. J. Med.
336:163-171[Abstract/Free Full Text].
|
| 17.
|
Gao, S.-J.,
L. Kingsley,
M. Li,
W. Zheng,
C. Parravicini,
J. Ziegler,
R. Newton,
C. R. Rinaldo,
A. Saah,
J. Phair,
R. Detels,
Y. Chang, and P. S. Moore.
1996.
KSHV antibodies among Americans, Italians and Ugandans with and without Kaposi's sarcoma.
Nat. Med.
2:925-928[Medline].
|
| 18.
|
Gao, S.-J.,
L. Kingsley,
D. R. Hoover,
T. J. Spira,
C. R. Rinaldo,
A. Saah,
J. Phair,
R. Detels,
P. Parry,
Y. Chang, and P. S. Moore.
1996.
Seroconversion to antibodies against Kaposi's sarcoma-associated herpesvirus-related latent nuclear antigens before the development of Kaposi's sarcoma.
N. Engl. J. Med.
335:233-241[Abstract/Free Full Text].
|
| 19.
|
Gill, P. S.,
C. Loureiro,
M. Bernstein-Singer,
M. U. Rarick,
F. Sattler, and A. M. Levine.
1989.
Clinical effect of glucocorticoids on Kaposi's sarcoma related to the acquired immunodeficiency syndrome (AIDS).
Ann. Intern. Med.
110:937-940.
|
| 20.
|
Halbert, C. L.,
G. W. Demers, and D. A. Galloway.
1991.
The E7 gene of human papillomavirus type 16 is sufficient for immortalization of human epithelial cells.
J. Virol.
65:473-478[Abstract/Free Full Text].
|
| 21.
|
Huang, Y. Q.,
J. J. Li,
M. H. Kaplan,
B. Poiesz,
E. Katabira,
W. C. Zhang,
D. Feiner, and A. E. Freidman-Kein.
1995.
Human herpesvirus-like nucleic acid in various forms of Kaposi's sarcoma.
Lancet
345:759-761[Medline].
|
| 22.
|
Jussila, L.,
R. Valtola,
T. A. Partanen,
P. Salven,
P. Heikkila,
M. T. Matikainen,
R. Renkonen,
A. Kalpainen,
M. Detmar,
E. Tschachler,
R. Alitalo, and K. Alitalo.
1998.
Lymphatic endothelium and Kaposi's sarcoma spindle cells detected by antibodies against the vascular endothelial growth factor receptor-3.
Cancer Res.
58:1599-1604[Abstract/Free Full Text].
|
| 23.
|
Kedes, D. H.,
E. Oberskalski,
M. Busch,
R. Kohn,
J. Flood, and D. Ganem.
1996.
The seroepidemiology of human herpesvirus 8 (Kaposi's sarcoma-associated herpesvirus): Distribution of infection in KS risk groups and evidence for sexual transmission.
Nat. Med.
2:918-924[Medline].
|
| 24.
|
Kennedy, M. M.,
K. Cooper,
D. D. Howells,
S. Picton,
S. Biddolph,
S. B. Lucas,
J. O. McGee, and J. J. O'Leary.
1997.
Identification of HHV8 in early Kaposi's sarcoma: implications for Kaposi's sarcoma pathogenesis.
Mol. Pathol.
51:14-20[Abstract].
|
| 25.
|
Lebbe, C.,
P. de Cremoux,
M. Rybojad,
C. Costa da Cunha,
P. Morel, and F. Calvo.
1995.
Kaposi's sarcoma and new herpesvirus.
Lancet
345:1180.
|
| 26.
|
Lennette, E. T.,
D. J. Blackbourne, and J. A. Levy.
1996.
Antibodies to human herpesvirus type 8 in the general population and in Kaposi's sarcoma patients.
Lancet
348:858-861[Medline].
|
| 27.
|
Levy, J. A., and J. L. Ziegler.
1983.
Acquired immunodeficiency syndrome is an opportunistic infection and Kaposi's sarcoma results from secondary immune stimulation.
Lancet
2:78-81[Medline].
|
| 28.
|
Li, J. J.,
Y. Q. Huang,
C. J. Cockerell, and A. E. Friedman-Klein.
1996.
Localization of human herpes-like virus type 8 in vascular endothelial cells and perivascular spindle-shaped cells of Kaposi's sarcoma lesions by in situ hybridization.
Am. J. Pathol.
148:1741-1748[Abstract].
|
| 29.
|
Miller, G.,
L. Heston,
E. Grogan,
L. Gradoville,
M. Rigsby,
R. Sun,
D. Shedd,
V. M. Kushnaryov,
S. Grossberg, and Y. Chang.
1997.
Selective switch between latency and lytic replication of Kaposi's sarcoma herpesvirus and Epstein-Barr virus in dually infected body cavity lymphoma cells.
J. Virol.
71:314-324[Abstract].
|
| 30.
|
Moore, P. S., and Y. Chang.
1995.
Detection of herpesvirus-like DNA sequences in Kaposi's sarcoma in patients with and without HIV infection.
N. Engl. J. Med.
332:1181-1185[Abstract/Free Full Text].
|
| 31.
|
Muralidhar, S.,
A. M. Pumfery,
M. Hassani,
M. R. Sadaie,
N. Azumi,
M. Kishishita,
J. N. Brady,
J. Doniger,
P. Medveczky, and L. J. Rosenthal.
1998.
Identification of kaposin (open reading frame K12) as a human herpesvirus 8 (Kaposi's sarcoma-associated herpesvirus) transforming gene.
J. Virol.
72:4980-4988[Abstract/Free Full Text].
|
| 32.
|
Neipel, F.,
J.-C. Albrecht, and B. Fleckenstein.
1997.
Cell-homologous genes in the Kaposi's sarcoma-associated rhadinovirus human herpesvirus 8: determinants of its pathogenicity.
J. Virol.
71:4187-4192[Medline].
|
| 33.
|
Orenstein, J. M.,
S. Alkan,
A. Blauvelt,
K. T. Jeang,
M. D. Weinstein,
D. Ganem, and B. Herndier.
1997.
Visualization of human herpesvirus type 8 in Kaposi's sarcoma by light and transmission electron microscopy.
AIDS
11:F35-F45[Medline].
|
| 34.
|
Panyutich, E. A.,
J. W. Said, and S. A. Miles.
1998.
Infection of primary dermal microvascular endothelial cells by Kaposi's sarcoma-associated herpesvirus.
AIDS
12:467-472[Medline].
|
| 35.
|
Prudhomme, J. G.,
I. W. Sherman,
K. M. Land,
A. V. Moses,
S. Stenglein, and J. A. Nelson.
1996.
Studies of Plasmodium falciparum cytoadherence using immortalized human brain capillary endothelial cells.
Int. J. Parasitol.
26:647-655[Medline].
|
| 36.
|
Rainbow, L.,
G. M. Platt,
G. R. Simpson,
R. Sarid,
S.-J. Gao,
H. Stoiber,
C. S. Herrington,
P. S. Moore, and T. F. Schulz.
1997.
The 222- to 234-kilodalton latent nuclear protein (LNA) of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) is encoded by orf73 and is a component of the latency-associated nuclear antigen.
J. Virol.
71:5915-5921[Abstract].
|
| 37.
|
Rappersberger, K.,
E. Tschachler,
E. Zonzits,
R. Gillitzer,
A. Hatzakis,
A. Kaloterakis,
D. L. Mann,
T. Popow-Kraupp,
R. J. Biggar,
R. Berger,
J. Stratigos,
K. Wolff, and G. Stingl.
1990.
Endemic Kaposi's sarcoma in human immunodeficiency virus type 1-seronegative persons: demonstration of retrovirus-like particles in cutaneous lesions.
J. Investig. Dermatol.
95:371-381[Medline].
|
| 38.
|
Regezi, J. A.,
L. A. MacPhail,
T. E. Daniels,
J. S. Greenspan,
C. L. Dodd,
F. Lozada-Nur,
G. S. Heinic,
H. Chinn,
S. Silverman, and L. S. Hansen.
1993.
Oral Kaposi's sarcoma: a 10-year retrospective histopathological study.
J. Oral Pathol. Med.
22:292-297[Medline].
|
| 39.
|
Renne, R.,
W. Zhong,
B. Herndier,
M. McGrath,
N. Abbey,
D. Kedes, and D. Ganem.
1996.
Lytic growth of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in culture.
Nat. Med.
2:342-346[Medline].
|
| 40.
|
Renne, R.,
D. Blackbourn,
D. Whitby,
J. Levy, and D. Ganem.
1998.
Limited transmission of Kaposi's sarcoma-associated herpesvirus in cultured cells.
J. Virol.
72:5182-5188[Abstract/Free Full Text].
|
| 41.
|
Roth, W. K.,
S. Werner,
W. Risau,
K. Remberger, and P. H. Hofschneider.
1988.
Cultured, AIDS-related Kaposi's sarcoma cells express endothelial cell markers and are weakly malignant in vitro.
Int. J. Cancer
42:767-773[Medline].
|
| 42.
|
Roth, W. K.,
H. Brandsetter, and M. Sturzl.
1992.
Cellular and molecular features of HIV-associated Kaposi's sarcoma.
AIDS
6:895-913[Medline].
|
| 43.
|
Russell Jones, R.,
G. Orchard,
B. Zelger, and E. Wilson Jones.
1995.
Immunostaining for CD31 and CD34 in Kaposi's sarcoma.
J. Clin. Pathol.
48:1011-1016[Abstract/Free Full Text].
|
| 44.
|
Rutgers, J. L.,
R. Wieczorek,
F. Bonetti,
K. L. Kaplan,
D. N. Posnett,
A. E. Friedman-Klein, and D. M. Knowles.
1986.
The expression of endothelial cell surface antigens by AIDS-associated Kaposi's sarcoma. Evidence for a vascular endothelial cell origin.
Am. J. Pathol.
122:493-499[Abstract].
|
| 45.
|
Salahuddin, S. Z.,
S. Nakamura,
P. Biberfeld,
M. H. Kaplan,
P. D. Markham,
L. Larsson, and R. C. Gallo.
1988.
Angiogenic properties of Kaposi's sarcoma-derived cells after long-term culture in vitro.
Science
242:430-433[Abstract/Free Full Text].
|
| 46.
|
Samaniego, F.,
P. D. Markham,
R. Gendleman,
Y. Watanabe,
V. Kao,
K. Kowalski,
J. A. Sonnabend,
A. Pintus,
R. C. Gallo, and B. Ensoli.
1998.
Vascular endothelial growth factor and basic fibroblast growth factor present in Kaposi's sarcoma (KS) are induced by inflammatory cytokines and synergize to promote vascular permeability and KS lesion development.
Am. J. Pathol.
152:1433-1443[Abstract].
|
| 47.
|
Schalling, M.,
M. Ekman,
E. E. Kaaya,
A. Linde, and P. Biberfeld.
1995.
A role for a new herpes virus (KSHV) in different forms of Kaposi's sarcoma.
Nat. Med.
1:707-708[Medline].
|
| 48.
|
Scully, P. A.,
H. K. Steinman,
C. Kennedy,
K. Trueblood,
D. M. Frisman, and J. R. Voland.
1988.
AIDS-related Kaposi's sarcoma displays differential expression of endothelial surface antigens.
Am. J. Pathol.
130:244-251[Abstract].
|
| 49.
|
Smith, M. S.,
C. Bloomer,
R. Horvat,
E. Goldstein,
J. M. Casparian, and B. Chandran.
1997.
Detection of human herpesvirus 8 DNA in Kaposi's sarcoma lesions and peripheral blood of human immunodeficiency virus-positive patients and correlation with serologic measurements.
J. Infect. Dis.
176:84-93[Medline].
|
| 50.
|
Soulier, J.,
L. Grollet,
E. Oksenhendler,
P. Cacoub,
D. Cazals-Hatem,
P. Babinet,
M.-F. d'Agay,
J.-P. Clauvel,
M. Raphael,
L. Degos, and F. Sigaux.
1995.
Kaposi's sarcoma-associated herpesvirus-like DNA sequences in multicentric Castleman's disease.
Blood
86:1276-1280[Abstract/Free Full Text].
|
| 51.
|
Staskus, K. A.,
W. Zhong,
K. Gebhard,
B. Herndier,
H. Wang,
R. Renne,
J. Beneke,
J. Pudney,
D. J. Anderson,
D. Ganem, and A. T. Haase.
1997.
Kaposi's sarcoma-associated herpesvirus gene expression in endothelial (spindle) tumor cells.
J. Virol.
71:715-719[Abstract].
|
| 52.
|
Sturzl, M.,
C. Blasig,
A. Schreier,
F. Neipel,
C. Hohenadl,
E. Cornali,
G. Ascherl,
S. Esser,
N. H. Brockmeyer,
M. Ekman,
E. E. Kaaya,
E. Tschachler, and P. Biberfeld.
1997.
Expression of HHV-8 latency-associated T0.7 RNA in spindle cells and endothelial cells of AIDS-associated, classical and African Kaposi's sarcoma.
Int. J. Cancer
72:68-71[Medline].
|
| 53.
|
Trattner, A.,
E. Hodak,
M. David, and M. Sandbeck.
1993.
The appearance of Kaposi's sarcoma during corticosteroid therapy.
Cancer
72:1779-1783[Medline].
|
| 54.
|
Uccini, S.,
L. P. Ruco,
F. Monardo,
A. Stoppacciaro,
E. Dejana,
I. L. La Parola,
D. Cerimele, and C. D. Baroni.
1994.
Co-expression of endothelial cell and macrophage antigens in Kaposi's sarcoma cells.
J. Pathol.
173:23-31[Medline].
|
| 55.
|
Walter, P. R.,
E. Philippe,
C. Nguemby-Mbina, and A. Chamlian.
1984.
Kaposi's sarcoma: presence of herpes-type virus particles in a tumor specimen.
Hum. Pathol.
15:1145-1146[Medline].
|
| 56.
|
Whitby, D.,
M. R. Howard,
M. Tenant-Flowers,
N. S. Brink,
A. Copas,
C. Boshoff,
T. Hatzioannou,
F. E. A. Sugget,
D. M. Aldam,
A. S. Denton,
R. F. Miller,
I. V. D. Weller,
R. A. Weiss,
R. S. Tedder, and T. F. Schulz.
1995.
Detection of Kaposi's sarcoma associated herpesvirus in peripheral blood of HIV-infected individuals and progression to Kaposi's sarcoma.
Lancet
346:799-800[Medline].
|
| 57.
|
Zhong, W.,
H. Wang,
B. Herndier, and D. Ganem.
1996.
Restricted expression of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) genes in Kaposi's sarcoma.
Proc. Natl. Acad. Sci. USA
93:6641-6646[Abstract/Free Full Text].
|
Journal of Virology, August 1999, p. 6892-6902, Vol. 73, No. 8
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Mansouri, M., Viswanathan, K., Douglas, J. L., Hines, J., Gustin, J., Moses, A. V., Fruh, K.
(2009). Molecular Mechanism of BST2/Tetherin Downregulation by K5/MIR2 of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
83: 9672-9681
[Abstract]
[Full Text]
-
Douglas, J. L., Viswanathan, K., McCarroll, M. N., Gustin, J. K., Fruh, K., Moses, A. V.
(2009). Vpu Directs the Degradation of the Human Immunodeficiency Virus Restriction Factor BST-2/Tetherin via a {beta}TrCP-Dependent Mechanism. J. Virol.
83: 7931-7947
[Abstract]
[Full Text]
-
Punj, V., Matta, H., Schamus, S., Yang, T., Chang, Y., Chaudhary, P. M.
(2009). Induction of CCL20 production by Kaposi sarcoma-associated herpesvirus: role of viral FLICE inhibitory protein K13-induced NF-{kappa}B activation. Blood
113: 5660-5668
[Abstract]
[Full Text]
-
Mansouri, M., Rose, P. P., Moses, A. V., Fruh, K.
(2008). Remodeling of Endothelial Adherens Junctions by Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
82: 9615-9628
[Abstract]
[Full Text]
-
Subramanian, R., D'Auvergne, O., Kong, H., Kousoulas, K. G.
(2008). The Cytoplasmic Terminus of Kaposi's Sarcoma-Associated Herpesvirus Glycoprotein B Is Not Essential for Virion Egress and Infectivity. J. Virol.
82: 7144-7154
[Abstract]
[Full Text]
-
Fonsato, V., Buttiglieri, S., Chiara Deregibus, M., Bussolati, B., Caselli, E., Di Luca, D., Camussi, G.
(2008). PAX2 expression by HHV-8-infected endothelial cells induced a proangiogenic and proinvasive phenotype. Blood
111: 2806-2815
[Abstract]
[Full Text]
-
Sivakumar, R., Sharma-Walia, N., Raghu, H., Veettil, M. V., Sadagopan, S., Bottero, V., Varga, L., Levine, R., Chandran, B.
(2008). Kaposi's Sarcoma-Associated Herpesvirus Induces Sustained Levels of Vascular Endothelial Growth Factors A and C Early during In Vitro Infection of Human Microvascular Dermal Endothelial Cells: Biological Implications. J. Virol.
82: 1759-1776
[Abstract]
[Full Text]
-
Sander, G., Konrad, A., Thurau, M., Wies, E., Leubert, R., Kremmer, E., Dinkel, H., Schulz, T., Neipel, F., Sturzl, M.
(2008). Intracellular Localization Map of Human Herpesvirus 8 Proteins. J. Virol.
82: 1908-1922
[Abstract]
[Full Text]
-
Smith, J R, Henderson, W W, Rosenbaum, J T, Neuwelt, E A, Moses, A V
(2008). Cultured human endothelial cells expressing HIV-1 Vpu and Tat support the expansion of malignant B cells from primary central nervous system lymphoma. Br J Ophthalmol
92: 297-299
[Full Text]
-
Rose, P. P., Bogyo, M., Moses, A. V., Fruh, K.
(2007). Insulin-Like Growth Factor II Receptor-Mediated Intracellular Retention of Cathepsin B Is Essential for Transformation of Endothelial Cells by Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
81: 8050-8062
[Abstract]
[Full Text]
-
Donofrio, G., Herath, S., Sartori, C., Cavirani, S., Flammini, C. F., Sheldon, I. M.
(2007). Bovine herpesvirus 4 is tropic for bovine endometrial cells and modulates endocrine function. Reproduction
134: 183-197
[Abstract]
[Full Text]
-
Punjabi, A. S., Carroll, P. A., Chen, L., Lagunoff, M.
(2007). Persistent Activation of STAT3 by Latent Kaposi's Sarcoma-Associated Herpesvirus Infection of Endothelial Cells. J. Virol.
81: 2449-2458
[Abstract]
[Full Text]
-
Brinkmann, M. M., Pietrek, M., Dittrich-Breiholz, O., Kracht, M., Schulz, T. F.
(2007). Modulation of Host Gene Expression by the K15 Protein of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
81: 42-58
[Abstract]
[Full Text]
-
Ancuta, P., Wang, J., Gabuzda, D.
(2006). CD16+ monocytes produce IL-6, CCL2, and matrix metalloproteinase-9 upon interaction with CX3CL1-expressing endothelial cells.. J. Leukoc. Biol.
80: 1156-1164
[Abstract]
[Full Text]
-
Donofrio, G., Cavirani, S., Vanderplasschen, A., Gillet, L., Flammini, C. F.
(2006). Recombinant Bovine Herpesvirus 4 (BoHV-4) Expressing Glycoprotein D of BoHV-1 Is Immunogenic and Elicits Serum-Neutralizing Antibodies against BoHV-1 in a Rabbit Model. CVI
13: 1246-1254
[Abstract]
[Full Text]
-
Yang, L., Kowalski, J. R., Yacono, P., Bajmoczi, M., Shaw, S. K., Froio, R. M., Golan, D. E., Thomas, S. M., Luscinskas, F. W.
(2006). Endothelial Cell Cortactin Coordinates Intercellular Adhesion Molecule-1 Clustering and Actin Cytoskeleton Remodeling during Polymorphonuclear Leukocyte Adhesion and Transmigration. J. Immunol.
177: 6440-6449
[Abstract]
[Full Text]
-
Mansouri, M., Douglas, J., Rose, P. P., Gouveia, K., Thomas, G., Means, R. E., Moses, A. V., Fruh, K.
(2006). Kaposi sarcoma herpesvirus K5 removes CD31/PECAM from endothelial cells. Blood
108: 1932-1940
[Abstract]
[Full Text]
-
Sharma-Walia, N., Raghu, H., Sadagopan, S., Sivakumar, R., Veettil, M. V., Naranatt, P. P., Smith, M. M., Chandran, B.
(2006). Cyclooxygenase 2 Induced by Kaposi's Sarcoma-Associated Herpesvirus Early during In Vitro Infection of Target Cells Plays a Role in the Maintenance of Latent Viral Gene Expression.. J. Virol.
80: 6534-6552
[Abstract]
[Full Text]
-
Speciale, L., Biffi, R., Mancuso, R., Borghi, E., Mazziotti, R., Ferrante, P.
(2006). Big endothelin-1 and interleukin-6 modulation in human microvascular endothelial cells after human herpesvirus 8 infection.. Exp. Biol. Med.
231: 1171-1175
[Abstract]
[Full Text]
-
An, F.-Q., Folarin, H. M., Compitello, N., Roth, J., Gerson, S. L., McCrae, K. R., Fakhari, F. D., Dittmer, D. P., Renne, R.
(2006). Long-Term-Infected Telomerase-Immortalized Endothelial Cells: a Model for Kaposi's Sarcoma-Associated Herpesvirus Latency In Vitro and In Vivo.. J. Virol.
80: 4833-4846
[Abstract]
[Full Text]
-
Spiller, O. B., Mark, L., Blue, C. E., Proctor, D. G., Aitken, J. A., Blom, A. M., Blackbourn, D. J.
(2006). Dissecting the Regions of Virion-Associated Kaposi's Sarcoma-Associated Herpesvirus Complement Control Protein Required for Complement Regulation and Cell Binding.. J. Virol.
80: 4068-4078
[Abstract]
[Full Text]
-
Chang, H., Dittmer, D. P., Chul, S.-Y., Hong, Y., Jung, J. U.
(2005). Role of Notch Signal Transduction in Kaposi's Sarcoma-Associated Herpesvirus Gene Expression. J. Virol.
79: 14371-14382
[Abstract]
[Full Text]
-
Chen, L., Lagunoff, M.
(2005). Establishment and Maintenance of Kaposi's Sarcoma-Associated Herpesvirus Latency in B Cells. J. Virol.
79: 14383-14391
[Abstract]
[Full Text]
-
Johnson, A. S., Maronian, N., Vieira, J.
(2005). Activation of Kaposi's Sarcoma-Associated Herpesvirus Lytic Gene Expression during Epithelial Differentiation. J. Virol.
79: 13769-13777
[Abstract]
[Full Text]
-
Hegde, N. R., Dunn, C., Lewinsohn, D. M., Jarvis, M. A., Nelson, J. A., Johnson, D. C.
(2005). Endogenous human cytomegalovirus gB is presented efficiently by MHC class II molecules to CD4+ CTL. JEM
202: 1109-1119
[Abstract]
[Full Text]
-
Lu, F., Day, L., Lieberman, P. M.
(2005). Kaposi's Sarcoma-Associated Herpesvirus Virion-Induced Transcription Activation of the ORF50 Immediate-Early Promoter. J. Virol.
79: 13180-13185
[Abstract]
[Full Text]
-
Caselli, E., Galvan, M., Cassai, E., Caruso, A., Sighinolfi, L., Di Luca, D.
(2005). Human herpesvirus 8 enhances human immunodeficiency virus replication in acutely infected cells and induces reactivation in latently infected cells. Blood
106: 2790-2797
[Abstract]
[Full Text]
-
Krishnan, H. H., Sharma-Walia, N., Zeng, L., Gao, S.-J., Chandran, B.
(2005). Envelope Glycoprotein gB of Kaposi's Sarcoma-Associated Herpesvirus Is Essential for Egress from Infected Cells. J. Virol.
79: 10952-10967
[Abstract]
[Full Text]
-
Bechtel, J., Grundhoff, A., Ganem, D.
(2005). RNAs in the Virion of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
79: 10138-10146
[Abstract]
[Full Text]
-
Zhang, X., Wang, J. F., Chandran, B., Persaud, K., Pytowski, B., Fingeroth, J., Groopman, J. E.
(2005). Kaposi's Sarcoma-associated Herpesvirus Activation of Vascular Endothelial Growth Factor Receptor 3 Alters Endothelial Function and Enhances Infection. J. Biol. Chem.
280: 26216-26224
[Abstract]
[Full Text]
-
Yang, L., Froio, R. M., Sciuto, T. E., Dvorak, A. M., Alon, R., Luscinskas, F. W.
(2005). ICAM-1 regulates neutrophil adhesion and transcellular migration of TNF-{alpha}-activated vascular endothelium under flow. Blood
106: 584-592
[Abstract]
[Full Text]
-
Raggo, C., Ruhl, R., McAllister, S., Koon, H., Dezube, B. J., Fruh, K., Moses, A. V.
(2005). Novel Cellular Genes Essential for Transformation of Endothelial Cells by Kaposi's Sarcoma-Associated Herpesvirus. Cancer Res.
65: 5084-5095
[Abstract]
[Full Text]
-
Gasperini, P., Barbierato, M., Martinelli, C., Rigotti, P., Marchini, F., Masserizzi, G., Leoncini, F., Chieco-Bianchi, L., Schulz, T. F., Calabro, M. L.
(2005). Use of a BJAB-Derived Cell Line for Isolation of Human Herpesvirus 8. J. Clin. Microbiol.
43: 2866-2875
[Abstract]
[Full Text]
-
Bechtel, J. T., Winant, R. C., Ganem, D.
(2005). Host and Viral Proteins in the Virion of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
79: 4952-4964
[Abstract]
[Full Text]
-
Jia, Q., Chernishof, V., Bortz, E., Mchardy, I., Wu, T.-T., Liao, H.-I, Sun, R.
(2005). Murine Gammaherpesvirus 68 Open Reading Frame 45 Plays an Essential Role during the Immediate-Early Phase of Viral Replication. J. Virol.
79: 5129-5141
[Abstract]
[Full Text]
-
Hamden, K. E., Ford, P. W., Whitman, A. G., Dyson, O. F., Cheng, S.-Y., McCubrey, J. A., Akula, S. M.
(2004). Raf-Induced Vascular Endothelial Growth Factor Augments Kaposi's Sarcoma-Associated Herpesvirus Infection. J. Virol.
78: 13381-13390
[Abstract]
[Full Text]
-
Krug, L. T., Pozharskaya, V. P., Yu, Y., Inoue, N., Offermann, M. K.
(2004). Inhibition of Infection and Replication of Human Herpesvirus 8 in Microvascular Endothelial Cells by Alpha Interferon and Phosphonoformic Acid. J. Virol.
78: 8359-8371
[Abstract]
[Full Text]
-
Staudt, M. R., Kanan, Y., Jeong, J. H., Papin, J. F., Hines-Boykin, R., Dittmer, D. P.
(2004). The Tumor Microenvironment Controls Primary Effusion Lymphoma Growth in Vivo. Cancer Res.
64: 4790-4799
[Abstract]
[Full Text]
-
Luna, R. E., Zhou, F., Baghian, A., Chouljenko, V., Forghani, B., Gao, S.-J., Kousoulas, K. G.
(2004). Kaposi's Sarcoma-Associated Herpesvirus Glycoprotein K8.1 Is Dispensable for Virus Entry. J. Virol.
78: 6389-6398
[Abstract]
[Full Text]
-
Henderson, W. W., Ruhl, R., Lewis, P., Bentley, M., Nelson, J. A., Moses, A. V.
(2004). Human Immunodeficiency Virus (HIV) Type 1 Vpu Induces the Expression of CD40 in Endothelial Cells and Regulates HIV-Induced Adhesion of B-Lymphoma Cells. J. Virol.
78: 4408-4420
[Abstract]
[Full Text]
-
McAllister, S. C., Hansen, S. G., Ruhl, R. A., Raggo, C. M., DeFilippis, V. R., Greenspan, D., Fruh, K., Moses, A. V.
(2004). Kaposi sarcoma-associated herpesvirus (KSHV) induces heme oxygenase-1 expression and activity in KSHV-infected endothelial cells. Blood
103: 3465-3473
[Abstract]
[Full Text]
-
Wang, L., Wakisaka, N., Tomlinson, C. C, DeWire, S. M, Krall, S., Pagano, J. S, Damania, B.
(2004). The Kaposi's Sarcoma-Associated Herpesvirus (KSHV/HHV-8) K1 Protein Induces Expression of Angiogenic and Invasion Factors. Cancer Res.
64: 2774-2781
[Abstract]
[Full Text]
-
Krishnan, H. H., Naranatt, P. P., Smith, M. S., Zeng, L., Bloomer, C., Chandran, B.
(2004). Concurrent Expression of Latent and a Limited Number of Lytic Genes with Immune Modulation and Antiapoptotic Function by Kaposi's Sarcoma-Associated Herpesvirus Early during Infection of Primary Endothelial and Fibroblast Cells and Subsequent Decline of Lytic Gene Expression. J. Virol.
78: 3601-3620
[Abstract]
[Full Text]
-
Milligan, S., Robinson, M., O'Donnell, E., Blackbourn, D. J.
(2004). Inflammatory Cytokines Inhibit Kaposi's Sarcoma-Associated Herpesvirus Lytic Gene Transcription in In Vitro-Infected Endothelial Cells. J. Virol.
78: 2591-2596
[Abstract]
[Full Text]
-
Buttiglieri, S., Deregibus, M. C., Bravo, S., Cassoni, P., Chiarle, R., Bussolati, B., Camussi, G.
(2004). Role of Pax2 in Apoptosis Resistance and Proinvasive Phenotype of Kaposi's Sarcoma Cells. J. Biol. Chem.
279: 4136-4143
[Abstract]
[Full Text]
-
Gao, S.-J., Deng, J.-H., Zhou, F.-C.
(2003). Productive Lytic Replication of a Recombinant Kaposi's Sarcoma-Associated Herpesvirus in Efficient Primary Infection of Primary Human Endothelial Cells. J. Virol.
77: 9738-9749
[Abstract]
[Full Text]
-
Tomescu, C., Law, W. K., Kedes, D. H.
(2003). Surface Downregulation of Major Histocompatibility Complex Class I, PE-CAM, and ICAM-1 following De Novo Infection of Endothelial Cells with Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
77: 9669-9684
[Abstract]
[Full Text]
-
Inoue, N., Winter, J., Lal, R. B., Offermann, M. K., Koyano, S.
(2003). Characterization of Entry Mechanisms of Human Herpesvirus 8 by Using an Rta-Dependent Reporter Cell Line. J. Virol.
77: 8147-8152
[Abstract]
[Full Text]
-
Ancuta, P., Rao, R., Moses, A., Mehle, A., Shaw, S. K., Luscinskas, F. W., Gabuzda, D.
(2003). Fractalkine Preferentially Mediates Arrest and Migration of CD16+ Monocytes. JEM
197: 1701-1707
[Abstract]
[Full Text]
-
Dourmishev, L. A., Dourmishev, A. L., Palmeri, D., Schwartz, R. A., Lukac, D. M.
(2003). Molecular Genetics of Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Epidemiology and Pathogenesis. Microbiol. Mol. Biol. Rev.
67: 175-212
[Abstract]
[Full Text]
-
Cunningham, C., Barnard, S., Blackbourn, D. J., Davison, A. J.
(2003). Transcription mapping of human herpesvirus 8 genes encoding viral interferon regulatory factors. J. Gen. Virol.
84: 1471-1483
[Abstract]
[Full Text]
-
Watanabe, T., Sugaya, M., Atkins, A. M., Aquilino, E. A., Yang, A., Borris, D. L., Brady, J., Blauvelt, A.
(2003). Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen Prolongs the Life Span of Primary Human Umbilical Vein Endothelial Cells. J. Virol.
77: 6188-6196
[Abstract]
[Full Text]
-
Bechtel, J. T., Liang, Y., Hvidding, J., Ganem, D.
(2003). Host Range of Kaposi's Sarcoma-Associated Herpesvirus in Cultured Cells. J. Virol.
77: 6474-6481
[Abstract]
[Full Text]
-
Nakamura, H., Lu, M., Gwack, Y., Souvlis, J., Zeichner, S. L., Jung, J. U.
(2003). Global Changes in Kaposi's Sarcoma-Associated Virus Gene Expression Patterns following Expression of a Tetracycline-Inducible Rta Transactivator. J. Virol.
77: 4205-4220
[Abstract]
[Full Text]
-
Guo, H.-G., Sadowska, M., Reid, W., Tschachler, E., Hayward, G., Reitz, M.
(2003). Kaposi's Sarcoma-Like Tumors in a Human Herpesvirus 8 ORF74 Transgenic Mouse. J. Virol.
77: 2631-2639
[Abstract]
[Full Text]
-
Lee, B.-S., Paulose-Murphy, M., Chung, Y.-H., Connlole, M., Zeichner, S., Jung, J. U.
(2002). Suppression of Tetradecanoyl Phorbol Acetate-Induced Lytic Reactivation of Kaposi's Sarcoma-Associated Herpesvirus by K1 Signal Transduction. J. Virol.
76: 12185-12199
[Abstract]
[Full Text]
-
Lane, B. R., Liu, J., Bock, P. J., Schols, D., Coffey, M. J., Strieter, R. M., Polverini, P. J., Markovitz, D. M.
(2002). Interleukin-8 and Growth-Regulated Oncogene Alpha Mediate Angiogenesis in Kaposi's Sarcoma. J. Virol.
76: 11570-11583
[Abstract]
[Full Text]
-
Jeong, J. H., Hines-Boykin, R., Ash, J. D., Dittmer, D. P.
(2002). Tissue Specificity of the Kaposi's Sarcoma-Associated Herpesvirus Latent Nuclear Antigen (LANA/orf73) Promoter in Transgenic Mice. J. Virol.
76: 11024-11032
[Abstract]
[Full Text]
-
Dezube, B. J., Zambela, M., Sage, D. R., Wang, J.-F., Fingeroth, J. D.
(2002). Characterization of Kaposi sarcoma-associated herpesvirus/human herpesvirus-8 infection of human vascular endothelial cells: early events. Blood
100: 888-896
[Abstract]
[Full Text]
-
Moses, A. V., Jarvis, M. A., Raggo, C., Bell, Y. C., Ruhl, R., Luukkonen, B. G. M., Griffith, D. J., Wait, C. L., Druker, B. J., Heinrich, M. C., Nelson, J. A., Fruh, K.
(2002). Kaposi's Sarcoma-Associated Herpesvirus-Induced Upregulation of the c-kit Proto-Oncogene, as Identified by Gene Expression Profiling, Is Essential for the Transformation of Endothelial Cells. J. Virol.
76: 8383-8399
[Abstract]
[Full Text]
-
Deregibus, M. C., Cantaluppi, V., Doublier, S., Brizzi, M. F., Deambrosis, I., Albini, A., Camussi, G.
(2002). HIV-1-Tat Protein Activates Phosphatidylinositol 3-Kinase/ AKT-dependent Survival Pathways in Kaposi's Sarcoma Cells. J. Biol. Chem.
277: 25195-25202
[Abstract]
[Full Text]
-
Ablashi, D. V., Chatlynne, L. G., Whitman, J. E. Jr., Cesarman, E.
(2002). Spectrum of Kaposi's Sarcoma-Associated Herpesvirus, or Human Herpesvirus 8, Diseases. Clin. Microbiol. Rev.
15: 439-464
[Abstract]
[Full Text]
-
Zhou, F.-C., Zhang, Y.-J., Deng, J.-H., Wang, X.-P., Pan, H.-Y., Hettler, E., Gao, S.-J.
(2002). Efficient Infection by a Recombinant Kaposi's Sarcoma-Associated Herpesvirus Cloned in a Bacterial Artificial Chromosome: Application for Genetic Analysis. J. Virol.
76: 6185-6196
[Abstract]
[Full Text]
-
Cassoni, P., Sapino, A., Deaglio, S., Bussolati, B., Volante, M., Munaron, L., Albini, A., Torrisi, A., Bussolati, G.
(2002). Oxytocin Is a Growth Factor for Kaposi's Sarcoma Cells: Evidence of Endocrine-Immunological Cross-Talk. Cancer Res.
62: 2406-2413
[Abstract]
[Full Text]
-
Pertel, P. E.
(2002). Human Herpesvirus 8 Glycoprotein B (gB), gH, and gL Can Mediate Cell Fusion. J. Virol.
76: 4390-4400
[Abstract]
[Full Text]
-
Poole, L. J., Yu, Y., Kim, P. S., Zheng, Q.-Z., Pevsner, J., Hayward, G. S.
(2002). Altered Patterns of Cellular Gene Expression in Dermal Microvascular Endothelial Cells Infected with Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
76: 3395-3420
[Abstract]
[Full Text]
-
Chiou, C.-J., Poole, L. J., Kim, P. S., Ciufo, D. M., Cannon, J. S., ap Rhys, C. M., Alcendor, D. J., Zong, J.-C., Ambinder, R. F., Hayward, G. S.
(2002). Patterns of Gene Expression and a Transactivation Function Exhibited by the vGCR (ORF74) Chemokine Receptor Protein of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
76: 3421-3439
[Abstract]
[Full Text]
-
Birkmann, A., Mahr, K., Ensser, A., Titgemeyer, F., Fleckenstein, B., Neipel, F.
(2001). Cell Surface Heparan Sulfate Is a Receptor for Human Herpesvirus 8 and Interacts with Envelope Glycoprotein K8.1. J. Virol.
75: 11583-11593
[Abstract]
[Full Text]
-
Wang, F.-Z., Akula, S. M., Pramod, N. P., Zeng, L., Chandran, B.
(2001). Human Herpesvirus 8 Envelope Glycoprotein K8.1A Interaction with the Target Cells Involves Heparan Sulfate. J. Virol.
75: 7517-7527
[Abstract]
[Full Text]
-
Sakurada, S., Katano, H., Sata, T., Ohkuni, H., Watanabe, T., Mori, S.
(2001). Effective Human Herpesvirus 8 Infection of Human Umbilical Vein Endothelial Cells by Cell-Mediated Transmission. J. Virol.
75: 7717-7722
[Abstract]
[Full Text]
-
Lukac, D. M., Garibyan, L., Kirshner, J. R., Palmeri, D., Ganem, D.
(2001). DNA Binding by Kaposi's Sarcoma-Associated Herpesvirus Lytic Switch Protein Is Necessary for Transcriptional Activation of Two Viral Delayed Early Promoters. J. Virol.
75: 6786-6799
[Abstract]
[Full Text]
-
Ciufo, D. M., Cannon, J. S., Poole, L. J., Wu, F. Y., Murray, P., Ambinder, R. F., Hayward, G. S.
(2001). Spindle Cell Conversion by Kaposi's Sarcoma-Associated Herpesvirus: Formation of Colonies and Plaques with Mixed Lytic and Latent Gene Expression in Infected Primary Dermal Microvascular Endothelial Cell Cultures. J. Virol.
75: 5614-5626
[Abstract]
[Full Text]
-
Donofrio, G., van Santen, V. L.
(2001). A bovine macrophage cell line supports bovine herpesvirus-4 persistent infection. J. Gen. Virol.
82: 1181-1185
[Abstract]
[Full Text]
-
Zoeteweij, J. P., Moses, A. V., Rinderknecht, A. S., Davis, D. A., Overwijk, W. W., Yarchoan, R., Orenstein, J. M., Blauvelt, A.
(2001). Targeted inhibition of calcineurin signaling blocks calcium-dependent reactivation of Kaposi sarcoma-associated herpesvirus. Blood
97: 2374-2380
[Abstract]
[Full Text]
-
Cerimele, F., Curreli, F., Ely, S., Friedman-Kien, A. E., Cesarman, E., Flore, O.
(2001). Kaposi's Sarcoma-Associated Herpesvirus Can Productively Infect Primary Human Keratinocytes and Alter Their Growth Properties. J. Virol.
75: 2435-2443
[Abstract]
[Full Text]
-
Jeong, J., Papin, J., Dittmer, D.
(2001). Differential Regulation of the Overlapping Kaposi's Sarcoma-Associated Herpesvirus vGCR (orf74) and LANA (orf73) Promoters. J. Virol.
75: 1798-1807
[Abstract]
[Full Text]
-
Vieira, J., O'Hearn, P., Kimball, L., Chandran, B., Corey, L.
(2001). Activation of Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Lytic Replication by Human Cytomegalovirus. J. Virol.
75: 1378-1386
[Abstract]
[Full Text]
-
Glykofrydes, D., Niphuis, H., Kuhn, E. M., Rosenwirth, B., Heeney, J. L., Bruder, J., Niedobitek, G., Müller-Fleckenstein, I., Fleckenstein, B., Ensser, A.
(2000). Herpesvirus Saimiri vFLIP Provides an Antiapoptotic Function but Is Not Essential for Viral Replication, Transformation, or Pathogenicity. J. Virol.
74: 11919-11927
[Abstract]
[Full Text]
-
Cannon, J. S., Ciufo, D., Hawkins, A. L., Griffin, C. A., Borowitz, M. J., Hayward, G. S., Ambinder, R. F.
(2000). A New Primary Effusion Lymphoma-Derived Cell Line Yields a Highly Infectious Kaposi's Sarcoma Herpesvirus-Containing Supernatant. J. Virol.
74: 10187-10193
[Abstract]
[Full Text]
-
Wu, L., Lo, P., Yu, X., Stoops, J. K., Forghani, B., Zhou, Z. H.
(2000). Three-Dimensional Structure of the Human Herpesvirus 8 Capsid. J. Virol.
74: 9646-9654
[Abstract]
[Full Text]
-
Donofrio, G., Cavirani, S., van Santen, V. L.
(2000). Establishment of a cell line persistently infected with bovine herpesvirus-4 by use of a recombinant virus. J. Gen. Virol.
81: 1807-1814
[Abstract]
[Full Text]
-
Spira, T. J., Lam, L., Dollard, S. C., Meng, Y.-X., Pau, C. P., Black, J. B., Burns, D., Cooper, B., Hamid, M., Huong, J., Kite-Powell, K., Pellett, P. E.
(2000). Comparison of Serologic Assays and PCR for Diagnosis of Human Herpesvirus 8 Infection. J. Clin. Microbiol.
38: 2174-2180
[Abstract]
[Full Text]
-
Judde, J.-G., Lacoste, V., Briere, J., Kassa-Kelembho, E., Clyti, E., Couppie, P., Buchrieser, C., Tulliez, M., Morvan, J., Gessain, A.
(2000). Monoclonality or Oligoclonality of Human Herpesvirus 8 Terminal Repeat Sequences in Kaposi's Sarcoma and Other Diseases. JNCI J Natl Cancer Inst
92: 729-736
[Abstract]
[Full Text]
-
Pica, F., Volpi, A., Serafino, A., Fraschetti, M., Franzese, O., Garaci, E.
(2000). Autocrine nerve growth factor is essential for cell survival and viral maturation in HHV-8-infected primary effusion lymphoma cells. Blood
95: 2905-2912
[Abstract]
[Full Text]
-
Hayward, G. S.
(1999). Human Herpesvirus 8 Latent-State Gene Expression and Apoptosis in Kaposi's Sarcoma Lesions. JNCI J Natl Cancer Inst
91: 1705-1707
[Full Text]
-
Knight, J. S., Cotter, M. A. II, Robertson, E. S.
(2001). The Latency-associated Nuclear Antigen of Kaposi's Sarcoma-associated Herpesvirus Transactivates the Telomerase Reverse Transcriptase Promoter. J. Biol. Chem.
276: 22971-22978
[Abstract]
[Full Text]