Previous Article | Next Article 
Journal of Virology, August 1999, p. 6573-6581, Vol. 73, No. 8
Department of Biochemistry, University of
Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical
School, Piscataway, New Jersey 08854
Received 15 September 1998/Accepted 3 May 1999
Retroviral reverse transcriptase (RT) enzymes are responsible for
transcribing viral RNA into double-stranded DNA. An in vitro assay to
analyze the second strand transfer event during human immunodeficiency
virus type 1 (HIV-1) reverse transcription has been developed. Model
substrates were constructed which mimic the viral intermediate found
during plus-strand strong-stop synthesis. Utilizing wild-type HIV-1 RT
and a mutant E478Q RT, the requirement for RNase H activity in this
strand transfer event was analyzed. In the presence of
Mg2+, HIV-1 RT was able to fully support the second strand
transfer reaction in vitro. However, in the presence of
Mg2+, the E478Q RT mutant had no detectable RNase H
activity and was unable to support strand transfer. In the presence of
Mn2+, the E478Q RT yields the initial endoribonucleolytic
cleavage at the penultimate C residue of the tRNA primer yet does not
support strand transfer. This suggests that subsequent degradation of the RNA primer by the RNase H domain was required for strand transfer. In reactions in which the E478Q RT was complemented with exogenous RNase H enzymes, strand transfer was supported. Additionally, we have
shown that HIV-1 RT is capable of supporting strand transfer with
substrates that mimic tRNAHis as well as the authentic
tRNA3Lys.
Reverse transcription is a multistep
process which converts the retroviral RNA genome into double-stranded
DNA. Reverse transcription is carried out by the multifunctional enzyme
reverse transcriptase (RT), possessing RNA- and DNA-dependent DNA
polymerase and RNase H activities. For human immunodeficiency virus
type 1 (HIV-1), RT consists of an asymmetric heterodimer of two
subunits, p66 and p51. The p66 subunit contains the subdomains named
finger, palm, thumb, connection, and RNase H, based on the structural similarity to a hand (2, 16, 22). The p51 subunit lacks the
RNase H domain at the C terminus and results from a protease cleavage
between phenylalanine 440 and tyrosine 441 of p66 (23).
A great deal of research has focused on characterization of the domains
of HIV-1 RT and their interrelations. The three-dimensional structure
of the p66-p51 heterodimer reveals a template-primer cleft which
connects the polymerase and RNase H active sites. Mutations outside of
the RNase H catalytic domain can affect RNase H activity indirectly if
they alter the positioning of the RNA or DNA substrate. For example,
mutations within the palm (primer grip region within the p66 subunit;
residues 227 to 235) (12, 32), finger, and thumb subdomains
(14) have been identified with decreased RNase H activity.
Deletion of amino acids from the p51 subunit have also been shown to
alter RNase H cleavage (5). Interestingly, a mutation in the
finger subdomain has been identified which stimulates minus-strand
transfer in vitro (14).
The catalytic triad of the RNase H domain consists of Asp 443, Glu 478, and Asp 498 (10, 11, 37). These residues are important for
metal binding, and mutation of a single residue of the triad renders
the RNase H subunit inactive. Studies of an E478Q mutant RT have shown
that RNase H activity can be modulated by different divalent metal
cations (7). In the presence of manganese, the mutant enzyme
is capable of a single endoribonucleolytic cleavage by RNase H but is
incapable of subsequent degradation of the RNA template (7).
Reverse transcription first requires initiation by a tRNA primer, which
binds to the primer binding site (PBS) on the viral RNA
(24). The tRNAs utilized are characteristic of the
particular retrovirus; HIV-1 utilizes tRNA3Lys
(21), avian myeloblastosis virus utilizes
tRNATrp, and Moloney murine leukemia virus (M-MuLV)
utilizes tRNAPro. HIV-1 RT can utilize primers other than
tRNA3Lys with decreased kinetics of infection (43,
44), which require mutations within the viral genome and within
the first 18 nucleotides of the tRNA primer and upstream in the A-rich
loop (17). Minus-strand DNA synthesis then proceeds to the
5' end of the viral RNA; the reverse-transcribed viral RNA is degraded
by RNase H, and the first strand transfer occurs. Plus-strand synthesis
is initiated from the polypurine tract and terminates after reverse
transcribing the first 18 nucleotides of the tRNA primer. The tRNA
primer is specifically removed by RNase H (33, 39, 41), and
the second strand transfer occurs through the duplication of the PBS region.
In addition to the strand transfer reactions involving strong-stop
DNAs, internal strand transfers also occur during DNA synthesis steps.
Investigation of internal strand transfer during RNA-directed DNA
synthesis revealed a requirement for RNase H activity and was favorable
during RT pausing (9). However, strand transfer reactions
between DNA templates and primers do not require RNase H activity
(13, 30).
We have developed an in vitro assay to analyze the second strand
transfer reaction during HIV-1 reverse transcription. Model substrates
were constructed which mimic the intermediate resulting from
plus-strand strong-stop DNA synthesis. This system allows for analysis
of intermediate steps required for strand transfer, such as DNA
polymerization, pause sites, RNase H activity, and transfer to an
acceptor DNA molecule. We have shown with an RNase H-defective mutant,
E478Q, that RNase H activity is required for the second strand transfer
reaction. More specifically, we have determined that directional
processing or polymerase-independent cleavages by RNase H are required
for this strand transfer reaction. The E478Q RT can support strand
transfer when it is complemented with Escherichia coli RNase
H in trans. Additionally, we have shown that HIV-1 RT is
capable of supporting strand transfer with a model substrate which
mimics tRNAHis and an authentic tRNA3Lys substrate.
Enzymes and nucleotides.
T4 polynucleotide kinase was
purchased from New England Biolabs; recombinant RNasin was purchased
from Promega. Exonuclease( Oligonucleotides.
The RNA oligonucleotide HPR-1, 5'
GUCCCUGUUCGGGCGCCA 3' was
synthesized by Integrated DNA Technologies. The RNA oligonucleotide mimicking tRNAHis, 5' AUCCGAGUCACGGCACCA 3', was
purchased from CyberSyn. The DNA oligonucleotides 5785, 5'
CCCTCAGACCCTTTTAGTCAGTGTGG 3'; 5786, 5'
CCCTTTTAGTCAGTGTGGAAAATCTCAGCAGTGGCGCCCGAACAGGGAC 3'; 5580, 5' TTTCGCTTTCAGGTCCCTGTTCGGGCGCCA 3'; 9142, 5'
CTGCTAGAGATTTTCCACACTGACTAAAAGGG 3'; 9243, 5'
TTTCGCTTTCAGATCCGAGTCACGGCACCA 3'; and 9245, 5'
CCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGTGCCGTGACTCGGAT 3' were
synthesized by the University of Medicine and Dentistry of New Jersey.
Strand transfer substrate preparation.
The 50-mer input
RNA-DNA hybrid substrate was prepared as follows. Twenty picomoles of
the 18-mer RNA (HPR-1), was 5' labeled with T4 polynucleotide kinase
and [
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
RNase H Requirements for the Second Strand Transfer
Reaction of Human Immunodeficiency Virus Type 1 Reverse
Transcription
and
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
) Klenow polymerase was purchased from
United States Biochemical. HIV-1 RT was obtained from Jeffrey Culp and
Christine Debouch, Department of Protein Biochemistry, SmithKline
Beecham Pharmaceuticals. HIV-1 RT (E478Q mutant) was obtained from
Stuart F. Le Grice and the AIDS repository (contributor, Stuart F. Le
Grice). M-MuLV was purified from E. coli containing the
plasmid pB6B15.23 (36). Isolate HIV-1 RNase H (NY427) was
purified from E. coli containing the plasmid pET-NY427
(40). E. coli RNase H was purchased from Gibco
BRL. [
-32P]ATP was purchased from ICN. Authentic
tRNA3Lys purified from human placenta was purchased
from Bio S & T Inc.
-32P]ATP. The radiolabeled RNA was isolated with
G-25 spin columns (Boehringer Mannheim). The labeled substrate was
annealed to 40 pmol of oligonucleotide 5786 in a 25-µl reaction
mixture containing 50 mM Tris-HCl (pH 8.0), 50 mM KCl, 8 mM
MgCl2, and 2 mM dithiothreitol. The substrate was extended
with Klenow Exonuclease(), gel isolated, and eluted overnight as
previously described (38). The substrate was then annealed
to oligonucleotide 5785 (referred to as 26-mer). This oligonucleotide
was also 5' labeled, in the same manner as described for HPR-1. The RNA
oligonucleotide which mimics tRNAHis was prepared in the
manner described above, utilizing oligonucleotide 9245 as an extension
template to construct the RNA-DNA oligonucleotide.
-32P]ATP. The radiolabeled
DNA was isolated with G-25 spin columns (Boehringer Mannheim). The DNA
oligonucleotide (9142) and authentic tRNA3Lys were
annealed to oligonucleotide 5786 in a reaction containing 200 mM KCl
and 50 mM Tris-HCl, pH 7.5. After annealing, the authentic tRNA3Lys and DNA oligonucleotide were ligated with T4
DNA ligase in a reaction containing 50 mM Tris-HCl, pH 7.5, 10 mM
MgCl2, 10 mM dithiothreitol, 1 mM ATP, and 25 µg of
bovine serum albumin/ml. The tRNA3Lys-DNA
oligonucleotide was gel isolated and eluted overnight as previously
described (38). The tRNA3Lys-DNA
oligonucleotide was annealed to oligonucleotide 5785, which was also 5'
labeled as described above. Control experiments which contain 18-mer
RNA-DNA (9142) oligonucleotide substrates were prepared in the same manner.
Strand transfer reactions. The annealed RNA-DNA hybrid substrate was incubated with either HIV-1 RT or E478Q RT. The strand transfer reactions were performed in a 20-µl reaction mixture containing approximately 4 pmol of substrate (substrate refers to the 50-mer RNA-DNA hybrid annealed to primer 5785); 4 pmol of acceptor (oligonucleotide 5580); 2 pmol of either HIV-1 RT or E478Q RT in a reaction buffer containing 20 mM Tris-HCl (pH 7.5), 50 mM KCl, 8 mM MgCl2, or 8 mM MnCl2; and 0.25 mM each deoxynucleotide (dATP, dCTP, dGTP, and TTP). The reactions were initiated upon the addition of enzyme and incubated at 37°C. Aliquots (2.5 µl) were removed at the indicated time points. Reaction products were separated on a 15% denaturing gel and detected by autoradiography.
For experiments in which two divalent cations were utilized (Mg2+ and Mn2+), the reaction mixture contained 8 mM MgCl2; MnCl2 was added to a final concentration of 8 mM after the 10-min time point. In reactions in which multiple enzymes were used, such as E. coli RNase H, HIV-1 RT, and NY 427, 2 pmol of the additional enzyme was added after the 10-min time point. For experiments in which authentic tRNA3Lys was utilized, reactions were performed in the presence of 1 mM deoxynucleoside triphosphates (dNTPs) and 8.5 pmol of HIV-1 RT was utilized. For experiments utilizing tRNAHis, oligonucleotide 9243 was used as the acceptor molecule.| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Second strand transfer assay.
We have developed an in vitro
assay for analyzing the second strand transfer reaction with model
RNA-DNA hybrid substrates which mimic the intermediate found during
plus-strand strong-stop synthesis. The model assay is represented in
Fig. 1. The 50-mer RNA-DNA hybrid was
constructed by 5' labeling an 18-mer RNA oligonucleotide with
[-32P]ATP. The RNA primer was gel purified after being
labeled and was annealed to a 50-mer DNA oligonucleotide which was
complementary with the 18 nucleotides of the RNA primer. Once annealed,
the RNA primer was extended with Klenow [Exonuclease()] polymerase. The extended 50-mer RNA-DNA oligonucleotide was then annealed to the
26-mer DNA primer (5785), which was also 5' labeled. This substrate
mimics an intermediate formed during plus-strand strong-stop synthesis
(Fig. 1, step 1). This substrate was incubated with either HIV-1 RT or
a mutant E478Q RT (Fig. 1, step 2). In the presence of wild-type HIV-1
RT, nucleotides, and magnesium, DNA polymerization occurs and the
primer 5785 was extended to a 58-mer, utilizing the 50-mer RNA-DNA
oligonucleotide as a template. Termination of synthesis in this assay
occurs at the 5' end of the RNA. This site mimics the product formed in
vivo, where termination on the tRNA template occurs at the modified
base, methyl-adenosine 58 (25, 35). DNA polymerization with
the tRNA as a template generates an RNA-DNA hybrid which is a substrate
for RNase H. HIV-1 RNase H removed the RNA primer, with the initial
cleavage occurring between the terminal A ribonucleotide and C
ribonucleotide (41), yielding a 17-mer product (Fig. 1, step
3) and was followed by subsequent degradation of the RNA. The 50-mer
RNA-DNA oligonucleotide may also be extended at its 3' OH to produce a
58-mer. Since the 5' terminus from the RNA was labeled, identical RNase
H cleavage products would be detected from either the 50-mer or 58-mer.
For strand transfer to occur, the acceptor molecule must enter and serve as a template for elongation (Fig. 1, step 4). The acceptor molecule (5580) was complementary to the plus-strand strong-stop DNA.
This strand transfer event would result in the production of a 70-mer
product. The acceptor molecule can serve as a primer for reverse
transcription; however these products are not radiolabeled and would
not be detected in the assay.
|
The second strand transfer reaction with HIV-1 RT. Studies were initiated which analyzed the second strand transfer reaction with HIV-1 RT. The reaction conditions for HIV-1 RT-catalyzed strand transfer were established as shown in Fig. 2. Each panel represents a time course reaction between 30 s and 30 min. Figure 2A represents the reaction in the absence of enzyme, where the input 50-mer RNA-DNA strand and the 26-mer, DNA primer (5785) for DNA synthesis, are detected. Minor breakdown products at approximately 16 and 7 nucleotides were detected in the starting substrates; however, no additional products were detected throughout the incubation period. Reactions in the presence of enzyme and the absence of dNTPs yielded similar species (Fig. 2D). In the presence of dNTPs, DNA synthesis occurred, yielding a 32P-labeled 58-mer product which was an RNA-DNA hybrid (Fig. 2B). Simultaneous with the production of the extension product (58-mer) was the degradation of the 58-mer by RNase H, yielding 5'-end-labeled RNA products, the largest of which was the 17-mer. The 17-mer was produced after cleavage between the C and A at the 3' end of the RNA. Within 30 s, a 58-mer extension product and the 17-mer RNase H cleavage product were detectable (Fig. 2B, lane 6). Figure 2C shows the complete reaction in the presence of dNTPs, Mg2+, and acceptor. The second strand transfer product (70-mer) was observed at 5 min (Fig. 2C, lane 13). This correlated with the production of smaller RNase H products of approximately 8 or 9 bases (Fig. 2C, lane 13).
|
Second strand transfer reactions with E478Q RT. E478Q RT is an endoribonuclease in the presence of manganese and lacks all RNase H activity in the presence of magnesium. This mutant is also unable to perform directional processing of the RNA primer (7). Utilizing this mutant RT in the assay allows for the manipulation of the RNase H cleavages that are required to support strand transfer. Figure 3 represents the time course reactions between 0 and 30 min for strand transfer performed with E478Q RT. Figure 3A illustrates a strand transfer reaction performed in the presence of Mg2+ with the RNase H mutant RT E478Q. In the presence of Mg2+, as previously characterized for the wild-type enzyme, the input 50-mer and 26-mer substrates were detected. In addition, the 58-mer extension product was observed but no RNase H cleavage and strand transfer products were detected.
|
2 cleavage products was detected with the E478Q RT over the
time course of the reaction (Fig. 3D and E).
Strand transfer reaction performed in the presence of two divalent cations. The initial experiments described above showed that the DNA polymerization event for E478Q RT was more efficient in the presence of magnesium than in the presence of manganese, but manganese was required for RNase H activity. To test the possibility that strand transfer requires full synthesis of the plus-strand strong stop, reactions were performed in the presence of both divalent cations. In Fig. 4A, the synthesis in the presence of Mg2+ alone was compared to synthesis with both Mg2+ and Mn2+ combined. This was analyzed with the wild-type HIV-1 RT (Fig. 4A, lanes 1 to 14) and the E478Q HIV-1 RT (lanes 15 to 28). The reactions were initially incubated in the presence of magnesium. After 10 min (lanes 2, 9, 16, and 23), manganese was added to the indicated reactions, and they were allowed to proceed for up to 40 min. For wild-type HIV-1 RT (Fig. 4A, lanes 1 to 7), an extension product (58-mer), RNase H cleavage products, and a strand transfer product (70-mer) were observed. However, for E478Q RT, only a 58-mer extension product was observed. In the presence of both divalent cations (Fig. 4A, lanes 8 to 14), HIV-1 RT's strand transfer ability was unaffected. For E478Q RT (Fig. 4A, lanes 22 to 28), at the 10-min time point prior to Mn2+ addition, an extension product was observed (Fig. 4A, lane 23), but no RNase H activity was observed. Once manganese was added (Fig. 4A, lane 24) the single endoribonucleolytic RNase H cleavage event occurred, producing the 17-mer RNA. However, strand transfer did not occur throughout the remainder of the time course (Fig. 4A, lanes 22 to 28). Separate time courses have been performed up to 1 h, and no strand transfer was observed for the E478Q HIV-1 RT. This result indicates that synthesis of plus-strand strong-stop DNA followed by a single endoribonucleolytic cleavage was not sufficient by itself to induce strand transfer.
|
Complementation of E478Q RT with exogenous RNase H enzymes. The single endoribonucleolytic cleavage was not sufficient to support the second strand transfer reaction for the E478Q RT. Additional studies were therefore performed to investigate whether the lack of strand transfer resulted from an RNase H defect or from a secondary effect on the polymerase domain. The E478Q RT was complemented with various exogenous RNase H enzymes to determine whether directional processing or additional cleavages of the RNA primer by RNase H would support strand transfer (Fig. 4B).
The substrate was initially incubated for 10 min in the presence of E478Q RT, nucleotides, acceptor, and magnesium. After this time point, an exogenous RNase H enzyme was added. The reaction was performed in the presence of magnesium so that all RNase H activity would be a result of the exogenous RNase H. Figure 4B illustrates that E. coli RNase H complemented the strand transfer defect of E478Q RT. Upon addition of E. coli RNase H, RNase H cleavage products quickly accumulated (Fig. 4B, lane 3), followed by the production of a strand transfer product after 15 min (Fig. 4B, lane 5). The E. coli complementation also degrades the RNA much more extensively than HIV-1 RT (Fig. 4A, lanes 1 to 7, and data not shown), indicating a correlation with RNase H and strand transfer activities. Complementation of E478Q RT with an isolated RNase H domain, NY427, was also examined. This isolated RNase H domain similarly yields a single endoribonucleolytic cleavage at the same position as E478Q RT and was Mn2+ dependent (40). Complementation of E478Q RT with NY427 did not result in any strand transfer, indicating that subsequent degradation of the primer was required for strand transfer (data not shown). Furthermore, these results indicate that complete removal of the tRNA by RNase H activity was critical for plus-strand transfer.Analysis of plus-strand transfer with authentic tRNA3Lys substrate. Since HIV-1 RT was capable of supporting strand transfer with a substrate mimicking tRNA3Lys, it was of interest to determine whether the additional secondary structure associated with the authentic tRNA3Lys affected strand transfer. The substrates utilized are shown in Fig. 5A, step A. The 108-mer tRNA3Lys-DNA oligonucleotide was constructed by 5' labeling the 32-mer minus-strand DNA oligonucleotide (9142) and ligating it to the authentic tRNA3Lys (76 nucleotides), utilizing the bridging method as described in Materials and Methods (26). The substrate differs from those used in the previous assays in that the radiolabel was internal. In the presence of nucleotides, the extension product from the 5'-labeled 26-mer plus-strand primer should terminate at the first methylated A of the tRNA (Fig. 5A, step B), yielding a 58-nucleotide product, also produced with the tRNA mimic oligonucleotide. Polymerization from the 3' OH of the 108-mer tRNA-DNA molecule would also result in the production of a 116-mer product. RNase H cleavage (Fig. 5B, step C) would release a radiolabeled DNA product and an unlabeled tRNA. RNase H cleavage between the terminal C ribonucleotide and A ribonucleotide of the 108-mer tRNA-DNA strand would produce a 33-mer labeled DNA product; cleavage of the alternative 116-mer extended product would release a 41-mer product (Fig. 5A, step C). The strand transfer product was a 70-mer, as in the previous assay with the oligoribonucleotide mimic (Fig. 5A, step D).
|
Analysis of strand transfer activity of tRNAHis with
HIV-1 RT.
Recent studies have characterized the ability of HIV-1
RT to utilize tRNA primers other than tRNA3Lys to
initiate reverse transcription (17, 18, 43, 44). Modified viruses with alterations in the PBS and U5 regions have been generated which can support utilization of an alternative tRNA as the
minus-strand primer, particularly tRNAHis and
tRNAMet. The consequences of using these alternative tRNAs
for primer removal has not been examined. Since an A at position 4 was
tolerated in tRNA3Lys mimic substrate, it was predicted
that HIV-1 RNase H should also direct the efficient removal and
subsequent strand transfer of a tRNAHis substrate
(39). Substrates were therefore constructed which substituted the tRNA3Lys mimic sequences with those of
tRNAHis (Fig. 6A). Acceptor
molecules were complementary to the novel tRNA used, paralleling the
mutations in the PBS within the viral genome required in vivo. The
strand transfer assay is shown in Fig. 6B. In the absence of acceptor
molecules, the tRNAHis model substrate produces an
extension product (58-mer) and an initial 1 RNase H cleavage product
(17-mer), followed by subsequent RNase H degradation (Fig. 6B, lanes 1 to 5). Upon the addition of an acceptor molecule, a strand transfer
product was observed for the tRNAHis model substrate (Fig.
6B, lanes 6 to 10). These results indicate that alternative tRNA
primers will be tolerated as long as the RNase H cleavage sites are
maintained.
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
A model system to analyze the second strand transfer event during HIV-1 reverse transcription has been developed. The manipulation of various components of the assay allows for determination of the requirements for DNA polymerization, RNase H activity, and strand transfer. The data shows that HIV-1 RT was capable of supporting plus-strand transfer in the presence of either Mg2+ or Mn2+ (data not shown) as a divalent cation. The E478Q RT RNase H-defective mutant was unable to support strand transfer in the presence of either or both divalent cations. However, in the presence of an exogenous RNase H enzyme, such as E. coli RNase H, strand transfer was supported. This indicates that the specific endoribonucleolytic cleavage catalyzed by E478Q was not sufficient to support plus-strand transfer.
The model in Fig. 7 represents the events which may be occurring and shows the difference between the mechanisms of strand transfer reactions catalyzed by HIV-1 RT and E478Q RT. For both enzymes, the polymerization events are identical (Fig. 7). The differences occur once RNase H activity is required for removal of the tRNA primer. With HIV-1 RT, polymerase-dependent and -independent cleavages and directional processing can occur, which will allow for quick dissociation of the tRNA primer (Fig. 7A). However, the E478Q RT mutant was only capable of producing the endoribonucleolytic cleavage detected by the release of a 17-mer on a denaturing gel. The melting temperature (Tm) of the 17-mer is 60°C, which is greater than the reaction temperature, which would allow it to remain associated with the DNA strand after cleavage (Fig. 7B). Product analysis of the E478Q RNase H cleavage on native gels has shown that a portion of the RNA primer remains annealed to the newly synthesized DNA strand (data not shown). The native product remains susceptible to cleavage by E. coli RNase H, and the RNA primer is therefore not displaced by RT. Mutant RTs with mutations in the pol domain which decrease RNase H activity have also been postulated to be defective in strand transfer because of incomplete removal of the primer (14).
|
Present research is aimed at understanding the requirements for
initiation of reverse transcription with various tRNA primers. Alterations have been made within the PBSs of many retroviral genomes
to allow for initiation to occur with the use of alternative primers
(17, 18, 28, 43, 44). Little research has focused on the
effects these alterations have on RNase H activity or strand transfer.
Previous studies have shown that RT-associated RNase H and isolated
RNase H enzymes are capable of distinguishing between cognate and
noncognate tRNA primers during removal (38, 39). This study
investigated the effect of utilizing tRNAHis on strand
transfer. tRNAHis has been shown to be utilized on a
modified virus (48) and was postulated to function in primer
removal (39). The tRNAHis primer was capable of
producing a 1 RNase H cleavage product. Subsequent cleavages of the
primer were observed. Strand transfer products were produced with
kinetics similar to those of the wild-type tRNA3Lys
model substrate. Experiments extending these studies to alternative tRNAs which the virus has not been adapted to use are now in progress.
The role of RNase H activity in strand transfer has been investigated in various systems. Early in vitro studies by Peliska and Benkovic demonstrated that with an RNase H-deficient mutant a very limiting amount of minus-strand transfer product was detected (30). Those studies correlated polymerase-independent RNase H cleavage with the strand transfer reaction, when RNase H activity is required. These results are consistent with our findings, in which a plus-strand transfer product is observed to correlate with the production of an 8-mer RNase H cleavage product (Fig. 2D). The requirements for plus-strand transfer by E478Q RT were found to be similar to those defined for minus-strand transfer (7). In the case of the E478Q RT mutant, an 8-mer is never produced unless the enzyme is complemented with an exogenous RNase H. The reactions were performed under conditions such that the single RNase H cleavage product produced by E478Q RT would not be released due to its Tm of 60°C. In the avian system, it has been shown that tRNA is removed as an intact species (27). The primer utilized by the avian system is tRNATrp, which has a Tm of 56°C, only 4°C lower than the Tm of tRNA3Lys. This suggests that the avian RT may displace the primer once cleavage occurs. We have shifted the reaction temperatures to 42°C for both HIV-1 RT and E478Q RT, which yielded results identical to those of the 37°C reactions. This small shift in temperature was not sufficient to allow for release of the 17-mer (data not shown).
Nonviral RNase H's were able to complement strand transfer, although this is not likely to occur in vivo. Chimeras have been constructed between AKR MuLV RT and E. coli RNase H to observe the effects of an RT possessing a greater RNase H-specific activity. The enzyme which was produced was functionally active in vitro (31); the enzyme possessed a much higher RNase H activity than the wild-type enzyme. Virion particles containing E. coli RNase H have also been examined. A chimeric enzyme utilizing M-MuLV Gag and E. coli RNase H I has been analyzed for its effects in vivo. The presence of the E. coli RNase H, rather than assisting replication, produces an antiviral effect reducing viral titers when utilized in a prophylaxis assay (42).
Manipulation of E478Q RT required the use of both magnesium and manganese divalent cations. DNA polymerization was optimal in the presence of Mg2+; manganese alone resulted in incomplete synthesis. For RNase H activity, Mn2+ was required, suggesting that manganese and magnesium occupy different active sites within the mutant enzyme. Mn2+ is capable of alternative coordination, which stabilizes specific conformations of the active site. These can be supported by alternative interactions in the metal binding site of E. coli RNase H. Studies have been performed in which the metal binding sites of E. coli RNase H have been replaced with ionic-charge interactions between Asp 10/Arg and Glu 48/Arg, producing a metal-independent enzyme (6). This enzyme possesses activity similar or comparable to that of the wild type.
Catalysis of plus-strand transfer by HIV-1 RT with the authentic tRNA3Lys was similar to that obtained with an RNA oligonucleotide mimicking tRNA3Lys. Previous studies have shown that in vivo DNA synthesis stops at the first Am within the authentic tRNA (25, 35). However, analysis of strand transfer in vitro with methylated and unmethylated tRNA3Lys indicates that Am at position 19 is not the sole determinant of termination of synthesis (4). Current research suggests that there are interactions of viral RNA and the A-rich loop of tRNA3Lys during initiation (18). Alternative structural components may play a role in the termination of plus-strand synthesis.
In reactions utilizing HIV-1 RT and E478Q RT, a predominant polymerase pause site was observed. Pausing has been previously characterized and shown to occur as a result of the template sequence and structure (20). Other studies have also shown that pause sites promote strand transfer (46). Along with pausing, strand transfer has been shown to produce mutations (29, 30, 46, 47). Studies analyzing internal strand transfer have been shown to possess great fidelity (8). In the current study, mutations and misincorporations were unable to be detected by the analysis utilized. However, pause sites were observed after approximately 14 nucleotides had been synthesized off the 26-mer primer. This was the case for HIV-1 RT as well as E478Q RT in the presence of Mn+2, Mg2+, or both. For the assays performed in this study, polymerization pauses are not substrates for strand transfer, since the acceptor molecule does not overlap in that region.
Strand transfer assays have been established in which the DNA primer is transferred between two DNA templates. These strand transfers are efficiently catalyzed by the E478Q RNase H mutant RT (13). These results imply an alternative mechanism to those involving RNA templates, where RNase H activity is required (7). Our studies indicate that the E478Q RT is capable of supporting plus-strand transfer; however, the RNase H activity must be supplied by an exogenous enzyme. RNase H-minus MuLV RT can displace short RNA oligonucleotides during DNA synthesis, but the presence of the RNase H domain increases the rate of synthesis on these templates (13, 19, 45).
HIV-1 RT is capable of supporting plus-strand transfer under the in vitro-reaction conditions defined here. Studies analyzing various strand transfer reactions have indicated that nucleocapsid protein (NC) enhanced strand transfer (1, 3, 8, 15, 34). Our plus-strand transfer reactions with the model RNA substrates were also performed in the presence and absence of nucleocapsid, and an increase in strand transfer was not observed with the addition of NC (data not shown). This may reflect a variation in NC preparations. In the in vitro system utilized here, the model viral genomes may not be long enough to support these interactions. In the virus, NC may be necessary to disrupt the interactions of the loops of the tRNA with the viral genome (17).
Our studies are consistent with other studies indicating a vital role for RNase H activity in the strand transfer process. More interesting is the defect which results from the mutation of glutamate 478 to glutamine. Perhaps utilizing this mutant with tRNAs which possess a lower Tm would result in efficient strand transfer without the need for exogenous RNase H enzymes to be present. Complementation of this mutant with E. coli RNase H allows strand transfer to be supported quite efficiently, indicating a requirement for either further degradation of the RNA primer or possibly a different mode of RNA cleavage which is defective in E478Q RT. The development of this assay system allows for further analysis of these questions.
| |
ACKNOWLEDGMENTS |
|---|
We thank Jeffrey Culp and Christine Debouch for the gift of recombinant HIV-1 RT. We also thank Stuart F. Le Grice for the gift of recombinant E478Q RT.
This work was supported by grant RO1-GM51151 from the NIH.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biochemistry, University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, 675 Hoes Lane, Piscataway, NJ 08854. Phone: (732) 235-5048. Fax: (732) 235-4783. E-mail: Roth{at}waksman.rutgers.edu.
Present address: Department of Molecular Biology and Genetics,
Johns Hopkins University School of Medicine, Baltimore, MD 21205-2185.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. | Allain, B., M. Lapadat-Tapolsky, C. Berlioz, and J. L. Darlix. 1994. Transactivation of the minus-strand DNA transfer by nucleocapsid protein during reverse transcription of the retroviral genome. EMBO J. 13:973-981[Medline]. |
| 2. | Arnold, E., A. Jacobo-Molina, R. G. Nanni, R. L. Williams, X. Lu, J. Ding, J. Arthur, D. Clark, A. Zhang, A. L. Ferris, P. Clark, A. Hizi, and S. H. Hughes. 1992. Structure of HIV-1 reverse transcriptase/DNA complex at 7 Å resolution showing active site locations. Nature 357:85-89[Medline]. |
| 3. | Auxilien, S., G. Keith, S. F. Le Grice, and J. L. Darlix. 1999. Role of post-transcriptional modifications of primer tRNALys,3 in the fidelity and efficacy of plus strand DNA transfer during HIV-1 reverse transcription. J. Biol. Chem. 27:44412-44420. |
| 4. | Ben-Artzi, H., J. Shemesh, E. Zeelon, B. Amit, L. Kleiman, M. Gorecki, and A. Panet. 1996. Molecular analysis of the second template switch during reverse transcription of the HIV RNA template. Biochemistry 35:10549-10557[Medline]. |
| 5. |
Cameron, C. E.,
M. A. Ghosh,
S. F. J. LeGrice, and S. J. Benkovic.
1997.
Mutations in HIV reverse transcriptase which alter RNase H activity and decrease strand transfer efficiency are suppressed by HIV nucleocapsid protein.
Proc. Natl. Acad. Sci. USA
94:6700-6705 |
| 6. | Casareno, R. L. B., D. Li, and J. A. Cowan. 1995. Rational redesign of a metal-dependent nuclease. Engineering the active site of magnesium-dependent ribonuclease H to form an active "metal-independent" enzyme. J. Am. Chem. Soc. 117:11011-11012. |
| 7. | Cirino, N. M., C. E. Cameron, J. S. Smith, J. W. Rausch, M. J. Roth, S. J. Benkovic, and S. F. J. Le Grice. 1995. Divalent cation modulation of ribonuclease functions of human immunodeficiency virus reverse transcriptase. Biochemistry 4:9936-9943. |
| 8. |
DeStefano, J.,
J. Ghosh,
B. Prasad, and A. Raja.
1998.
High fidelity of internal strand transfer catalyzed by human immunodeficiency virus reverse transcriptase.
J. Biol. Chem.
273:1483-1489 |
| 9. |
DeStefano, J. J.,
L. M. Mallaber,
L. Rodriguez-Rodriguez, and P. J. Fay.
1992.
Requirements for strand transfer between internal regions of heteropolymer templates by human immunodeficiency virus reverse transcriptase.
J. Virol.
66:6370-6378 |
| 10. | DeStefano, J. J., W. Wu, J. Seehra, J. McCoy, D. Laston, E. Albone, P. J. Fay, and R. A. Bambara. 1994. Characterization of an RNase H defective mutant of human immunodeficiency virus type-1 reverse transcriptase having an aspartate to asparagine change at position 498. Biochem. Biophys. Acta 1219:380-388[Medline]. |
| 11. | Dudding, L. R., N. C. Nkabinde, and V. Mizrahi. 1991. Analysis of the RNA- and DNA-dependent DNA polymerase activities of point mutants of HIV-1 reverse transcriptase lacking ribonuclease H activity. Biochemistry 30:10498-10506[Medline]. |
| 12. | Fan, N., K. B. Rank, D. E. Slade, S. M. Poppe, D. B. Evans, L. A. Kopta, R. A. Olmsted, R. C. Thomas, W. G. Tarpley, and S. K. Sharma. 1996. A drug resistance mutation in the inhibitor binding pocket of human immunodeficiency virus type 1 reverse transcriptase impairs DNA synthesis and RNA degradation. Biochemistry 35:9737-9745[Medline]. |
| 13. |
Fuentes, G. M.,
C. Palaniappan,
P. J. Fay, and R. A. Bambara.
1996.
Strand displacement synthesis in the central polypurine tract region of HIV-1 promotes DNA to DNA strand transfer.
J. Biol. Chem.
271:29605-29611 |
| 14. | Gao, H.-Q., P. L. Boyer, E. Arnold, and S. H. Hughes. 1998. Effects of mutations in the polymerase domain on the polymerase, RNase H, and strand transfer activities of human immunodeficiency virus type 1 reverse transcriptase. J. Mol. Biol. 277:559-572[Medline]. |
| 15. | Guo, J., L. E. Henderson, J. Bess, B. Kane, and J. G. Levin. 1997. Human immunodeficiency virus type 1 nucleocapsid protein promotes efficient strand transfer and specific viral DNA synthesis by inhibiting TAR-dependent self-priming from minus-strand strong stop DNA. J. Virol. 71:5178-5188[Abstract]. |
| 16. |
Jacobo-Molina, A.,
J. Arthur,
D. Clark,
R. L. Williams,
R. G. Nanni,
P. Clark,
A. L. Ferris,
S. H. Hughes, and E. Arnold.
1991.
Crystals of a ternary complex of human immunodeficiency virus type 1 reverse transcriptase with a monoclonal antibody Fab fragment and double-stranded DNA diffract x-rays to 3.5-A resolution.
Proc. Natl. Acad. Sci. USA
88:10895-10899 |
| 17. | Kang, S., Z. Zhang, and C. D. Morrow. 1997. Identification of a sequence within U5 required for human immunodeficiency virus type 1 to stably maintain a primer binding site complementary to tRNAMet. J. Virol. 71:207-217[Abstract]. |
| 18. | Kang, S. M., J. K. Wakefield, and C. D. Morrow. 1996. Mutations in both the U5 region and the primer-binding site influence the selection of the tRNA used for the initiation of HIV-1 reverse transcription. Virology 222:401-404[Medline]. |
| 19. |
Kelleher, C. D., and J. J. Champoux.
1998.
Characterization of RNA strand displacement synthesis by Moloney murine leukemia virus reverse transcriptase.
J. Biol. Chem.
273:9976-9986 |
| 20. |
Klarmann, G. J.,
C. A. Schauber, and B. D. Preston.
1993.
Template-directed pausing of DNA synthesis by HIV-1 reverse transcriptase during polymerization of HIV-1 sequences in vitro.
J. Biol. Chem.
268:9793-9802 |
| 21. |
Kohlstaedt, L. A., and T. A. Steitz.
1992.
Reverse transcriptase of human immunodeficiency virus can use either tRNA(Lys,3) or Escherichia coli tRNA (Gln,2) as a primer in an in vitro utilization assay.
Proc. Natl. Acad. Sci. USA
89:9652-9656 |
| 22. |
Kohlstaedt, L. A.,
J. Wang,
J. M. Friedman,
P. A. Rice, and T. A. Steitz.
1992.
Crystal structure at 3.5 A resolution of HIV-1 reverse transcriptase complexed with an inhibitor.
Science
256:1783-1790 |
| 23. | LeGrice, S. F. J., and F. Gruninger-Leitch. 1990. Rapid purification of homodimer and heterodimer HIV-1 reverse transcriptase by metal chelate affinity chromatography. Eur. J. Biol. 187:307. |
| 24. | Leis, J., A. Aiyar, and D. Cobrinik. 1993. Regulation of initiation of reverse transcription of retroviruses, p. 33-47. In A. M. Skalka, and S. P. Goff (ed.), Reverse transcriptase. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 25. | Miller, M. D., C. M. Farnet, and F. D. Bushman. 1997. Human immunodeficiency virus type 1 preintegration complexes: studies of organization and composition. J. Virol. 71:5382-5390[Abstract]. |
| 26. |
Moore, M., and P. Sharp.
1992.
Site-specific modification of pre-mRNA: the 2'-hydroxyl groups at the splice sites.
Science
256:992-997 |
| 27. | Omer, C. A., and A. J. Faras. 1982. Mechanism of release of the avian retrovirus tRNA Trp primer molecule from viral DNA by ribonuclease H during reverse transcription. Cell 30:797-805[Medline]. |
| 28. | Oude-Essink, B. B., A. T. Das, and B. Berkhout. 1996. HIV-1 reverse transcriptase discriminates against non-self tRNA primers. J. Mol. Biol. 264:243-254[Medline]. |
| 29. | Peliska, J. A., S. Balasubramanian, D. P. Giedroc, and S. J. Benkovic. 1994. Recombinant HIV-1 nucleocapsid protein accelerates HIV-1 reverse transcriptase catalyzed DNA strand transfer reactions and modulates RNase H activity. Biochemistry 33:13817-13823[Medline]. |
| 30. |
Peliska, J. A., and S. J. Benkovic.
1992.
Mechanism of DNA strand transfer reactions catalyzed by HIV-1 reverse transcriptase.
Science
258:1112-1118 |
| 31. | Post, K., J. Guo, E. Kalman, T. Uchida, R. J. Crouch, and J. G. Levin. 1993. A large deletion in the connection subdomain of murine leukemia virus reverse transcriptase or replacement of the RNase H domain with Escherichia coli RNase H results in altered polymerase and RNase H activities. Biochemistry 32:5508-5517[Medline]. |
| 32. |
Powell, M. D.,
M. Ghosh,
P. S. Jacques,
K. J. Howard,
S. F. Le Grice, and J. G. Levin.
1997.
Alanine-scanning mutations in the "primer grip" of p66 HIV-1 reverse transcriptase result in selective loss of RNA priming activity.
J. Biol. Chem.
272:13262-13269 |
| 33. |
Pullen, K. A.,
L. K. Ishimoto, and J. J. Champoux.
1992.
Incomplete removal of the RNA primer for minus-strand DNA synthesis by human immunodeficiency virus type 1 reverse transcriptase.
J. Virol.
66:367-373 |
| 34. |
Rodriguez-Rodriguez, L.,
Z. Tsuchihashi,
G. M. Fuentes,
R. A. Bambara, and P. J. Fay.
1995.
Influence of human immunodeficiency virus nucleocapsid protein on synthesis and strand transfer by reverse transcriptase in vitro.
J. Biol. Chem.
270:15005-15011 |
| 35. | Roth, M. J., P. Schwartzberg, and S. P. Goff. 1989. Structure of the termini of DNA intermediates in the integration of retroviral DNA: dependence of IN function and terminal DNA sequence. Cell 58:47-54[Medline]. |
| 36. |
Roth, M. J.,
N. Tanese, and S. P. Goff.
1985.
Purification and characterization of murine retroviral reverse transcriptase expressed in Escherichia coli.
J. Biol. Chem.
260:9326-9335 |
| 37. | Schatz, O., F. V. Cromme, F. Gruninger-Leitch, and S. F. J. LeGrice. 1989. Point mutations in conserved amino acid residues within the C-terminal domain of HIV-1 reverse transcriptase specifically repress RNase H function. FEBS Lett. 237:311-314. |
| 38. | Smith, C. M., W. B. Potts III, J. S. Smith, and M. J. Roth. 1997. RNase H cleavage of tRNAPro mediated by M-MuLV and HIV-1 reverse transcriptases. Virology 229:437-446[Medline]. |
| 39. |
Smith, C. M.,
O. Leon,
J. S. Smith, and M. J. Roth.
1998.
Sequence requirements for removal of tRNA by an isolated human immunodeficiency virus type 1 RNase H domain.
J. Virol.
72:6805-6812 |
| 40. |
Smith, J. S., and M. J. Roth.
1993.
Purification and characterization of an active human immunodeficiency virus type 1 RNase H domain.
J. Virol.
67:4037-4049 |
| 41. |
Smith, J. S., and M. J. Roth.
1992.
Specificity of human immunodeficiency virus-1 reverse transcriptase-associated ribonuclease H in removal of the minus-strand primer, tRNALys3.
J. Biol. Chem.
267:15071-15079 |
| 42. | VanBrocklin, M., A. L. Ferris, S. H. Hughes, and M. J. Federspiel. 1997. Expression of a murine leukemia virus Gag-Escherichia coli RNase HI fusion polyprotein significantly inhibits viral spread. J. Virol. 71:3312-3318[Abstract]. |
| 43. | Wakefield, J. K., and C. D. Morrow. 1996. Mutations within the primer binding site of the human immunodeficiency virus type 1 define sequence requirements essential for reverse transcription. Virology 220:290-298[Medline]. |
| 44. |
Wakefield, J. K.,
H. Rhim, and C. D. Morrow.
1994.
Minimal sequence requirements of a functional human immunodeficiency virus type 1 primer binding site.
J. Virol.
68:1605-1614 |
| 45. | Whiting, S. H., and J. J. Champoux. 1998. Properties of strand displacement synthesis by Moloney murine leukemia virus reverse transcriptase: mechanistic implications. J. Mol. Biol. 278:559-577[Medline]. |
| 46. |
Wu, W.,
B. M. Blumberg,
P. J. Fay, and R. A. Bambara.
1995.
Strand transfer mediated by human immunodeficiency virus reverse transcriptase in vitro is promoted by pausing and results in misincorporations.
J. Biol. Chem.
270:325-332 |
| 47. | Wu, W., C. Palaniappan, R. A. Bambara, and P. J. Fay. 1996. Differences in mutagenesis during minus strand, plus strand and strand transfer (recombination) synthesis of the HIV-1 gene in vitro. Nucleic Acids Res. 9:1710-1718. |
| 48. | Zhang, Z., S. M. Kang, A. LeBlanc, S. L. Hajduk, and C. D. Morrow. 1996. Nucleotide sequences within the U5 region of the viral RNA genome are the major determinants for a human immunodeficiency virus type 1 to maintain a primer binding site complementary to tRNA(His). Virology 226:306-317[Medline]. |
Journal of Virology, August 1999, p. 6573-6581, Vol. 73, No. 8
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kissel, J. D., Held, D. M., Hardy, R. W., Burke, D. H.
(2007). Active site binding and sequence requirements for inhibition of HIV-1 reverse transcriptase by the RT1 family of single-stranded DNA aptamers. Nucleic Acids Res
35: 5039-5050
[Abstract] [Full Text] -
Purohit, V., Roques, B. P., Kim, B., Bambara, R. A.
(2007). Mechanisms That Prevent Template Inactivation by HIV-1 Reverse Transcriptase RNase H Cleavages. J. Biol. Chem.
282: 12598-12609
[Abstract] [Full Text] -
Purohit, V., Balakrishnan, M., Kim, B., Bambara, R. A.
(2005). Evidence That HIV-1 Reverse Transcriptase Employs the DNA 3' End-directed Primary/Secondary RNase H Cleavage Mechanism during Synthesis and Strand Transfer. J. Biol. Chem.
280: 40534-40543
[Abstract] [Full Text] -
Cases-Gonzalez, C. E., Menendez-Arias, L.
(2004). Increased G->A Transition Frequencies Displayed by Primer Grip Mutants of Human Immunodeficiency Virus Type 1 Reverse Transcriptase. J. Virol.
78: 1012-1019
[Abstract] [Full Text] -
Post, K., Guo, J., Howard, K. J., Powell, M. D., Miller, J. T., Hizi, A., Le Grice, S. F. J., Levin, J. G.
(2003). Human Immunodeficiency Virus Type 2 Reverse Transcriptase Activity in Model Systems That Mimic Steps in Reverse Transcription. J. Virol.
77: 7623-7634
[Abstract] [Full Text] -
Lener, D., Budihas, S. R., Le Grice, S. F. J.
(2002). Mutating Conserved Residues in the Ribonuclease H Domain of Ty3 Reverse Transcriptase Affects Specialized Cleavage Events. J. Biol. Chem.
277: 26486-26495
[Abstract] [Full Text] -
Guo, J., Wu, T., Kane, B. F., Johnson, D. G., Henderson, L. E., Gorelick, R. J., Levin, J. G.
(2002). Subtle Alterations of the Native Zinc Finger Structures Have Dramatic Effects on the Nucleic Acid Chaperone Activity of Human Immunodeficiency Virus Type 1 Nucleocapsid Protein. J. Virol.
76: 4370-4378
[Abstract] [Full Text] -
Snyder, C. S., Roth, M. J.
(2000). Comparison of Second-Strand Transfer Requirements and RNase H Cleavages Catalyzed by Human Immunodeficiency Virus Type 1 Reverse Transcriptase (RT) and E478Q RT. J. Virol.
74: 9668-9679
[Abstract] [Full Text] -
Guo, J., Wu, T., Anderson, J., Kane, B. F., Johnson, D. G., Gorelick, R. J., Henderson, L. E., Levin, J. G.
(2000). Zinc Finger Structures in the Human Immunodeficiency Virus Type 1 Nucleocapsid Protein Facilitate Efficient Minus- and Plus-Strand Transfer. J. Virol.
74: 8980-8988
[Abstract] [Full Text] -
Svarovskaia, E. S., Delviks, K. A., Hwang, C. K., Pathak, V. K.
(2000). Structural Determinants of Murine Leukemia Virus Reverse Transcriptase That Affect the Frequency of Template Switching. J. Virol.
74: 7171-7178
[Abstract] [Full Text] -
Shen, N., Jetté, L., Liang, C., Wainberg, M. A., Laughrea, M.
(2000). Impact of Human Immunodeficiency Virus Type 1 RNA Dimerization on Viral Infectivity and of Stem-Loop B on RNA Dimerization and Reverse Transcription and Dissociation of Dimerization from Packaging. J. Virol.
74: 5729-5735
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»