![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Journal of Virology, July 1999, p. 5887-5893, Vol. 73, No. 7
McArdle Laboratory for Cancer Research,
University of Wisconsin Medical School, Madison, Wisconsin 53706
Received 30 December 1998/Accepted 18 March 1999
High-risk human papillomaviruses (HPVs) are the causative agents of
certain human cancers. HPV type 16 (HPV16) is the papillomavirus most
frequently associated with cervical cancer in women. The E6 and E7
genes of HPV are expressed in cells derived from these cancers and can
transform cells in tissue culture. Animal experiments have demonstrated
that E6 and E7 together cause tumors. We showed previously that E6 and
E7 together or E7 alone could induce skin tumors in mice when these
genes were expressed in the basal epithelia of the skin. In this study,
we investigated the role that the E6 gene plays in carcinogenesis. We
generated K14E6 transgenic mice, in which the HPV16 E6 gene was
directed in its expression by the human keratin 14 promoter (hK14) to
the basal layer of the epidermis. We found that E6 induced cellular
hyperproliferation and epidermal hyperplasia and caused skin tumors in
adult mice. Interestingly, the tumors derived from E6 were mostly
malignant, as opposed to the tumors from E7 mice, which were mostly
benign. This result leads us to hypothesize that E6 may contribute
differently than E7 to HPV-associated carcinogenesis; whereas E7
primarily contributes to the early stages of carcinogenesis that lead
to the formation of benign tumors, E6 primarily contributes to the late
stages of carcinogenesis that lead to malignancy.
Human papillomaviruses (HPVs) are
small DNA tumor viruses that cause papillomas in human skin, genitalia,
and upper respiratory tract. Certain types of HPVs, referred to as
high-risk HPVs, are associated with malignant tumors (55).
More than 90% of cervical carcinomas, for example, are related to HPV
infections (11). In these cancer cells, HPV genomes commonly
are found integrated into the cellular genome (11, 41). The
integration events leave intact the early region of the HPV genome
containing the E6 and E7 genes (41, 53). Transcripts of the
E6 and E7 genes are detected in the cervical cancer-derived cell lines
(47, 52), indicating these two genes potentially play a role
in HPV-associated carcinogenesis. Cell culture experiments have
demonstrated that E6 and E7 possess transforming activities; E6 or E7
each can transform established cells; E6 is also found to immortalize
primary human mammary epithelial cells (3), whereas E7 is
sufficient to immortalize primary human keratinocytes (22).
The discovery of cellular targets of E6 and E7 provided insight into
the potential molecular mechanisms by which E6 and E7 cause cellular
transformation. E6 can associate with p53 through the E6 associate
protein, leading to degradation of p53 by the ubiquitin proteasome
pathway (39, 40, 49). Recently, other cellular factors, such
as E6 binding protein (9), paxillin (46), the
human homologue of Drosophila large disc tumor suppressor gene (29, 31), and E6TP1 (18), have been reported
to associate with E6. Whether and how these interactions contribute to
carcinogenesis is not yet clear. E7 can also associate with multiple
cellular factors, one of which is the retinoblastoma tumor
susceptibility gene product, pRb (8, 16). Binding of E7 to
pRb promotes degradation of pRb and leads to the inhibition of pRb
functions (5, 26). Other proteins that associate with E7 are
prominently related to the regulation of the cell cycle, such as
cyclins/cyclin-dependent kinase inhibitors (17, 25, 54) and
other members of the Rb gene family (12, 15). As many of the
cellular factors that E6 and E7 interact with are either tumor
suppressors or cell cycle regulators, it is not surprising that E6 and
E7 can cause fundamental changes in cell growth behavior.
Cells transformed by E6 or E7 rarely grow into tumors when transplanted
into nude mice, indicating that other molecular events must be required
for the transformed cells to become tumorigenic (27, 35,
51). This observation is consistent with the epidemiological data
from human cancers in that high-risk HPV infections require long
latency periods before their associated cervical cancers develop. To
test whether E6 and E7 are oncogenic in vivo, experiments using
transgenic mice have been conducted. E6 and E7 together cause tumors in
mice (2, 10, 20). To dissect the roles of E6 and E7 in HPV
carcinogenesis, we generated transgenic mice in which the HPV type 16 (HPV16) E7 gene was expressed in the epidermis by the human keratin 14 (hK14) promoter. These mice had multiple phenotypes, including
epidermal hyperplasia and skin tumors (23). Thus, HPV16 E7
alone causes tumorigenesis in animals. In the present study, we have
addressed the role of E6 in HPV-induced carcinogenesis. We generated
K14E6 transgenic mice in which the HPV16 E6 gene was expressed in the
basal layer of epithelia, using the hK14 promoter. Expression of E6
increased cell proliferation and induced epidermal hyperplasia. Skin
tumors developed in adult K14E6 mice with an incidence of about 7% at
1 year of age. In contrast to the tumors derived from K14E7 transgenic
mice, which were primarily benign, tumors derived from K14E6 transgenic
mice were mostly malignant, indicating that E6 alone not only is
sufficient to induce tumors but may contribute to the development of
malignancy in animals.
Construction of transgene and generation of transgenic
mouse.
The K14E6 transgene was constructed similarly to the K14E7
transgene (23). Briefly, a DNA fragment from the HPV genome
spanning nucleotides 79 to 883 and encompassing the E6 and E7 open
reading frames (ORFs) was PCR amplified with primers containing
BamHI sites. In this amplified DNA fragment, a translational
termination linker (TTL) is present in the early region of the E7 ORF,
precluding expression of E7. The BamHI fragment was inserted
into the unique BamHI site between the hK14 promoter and
hK14 polyadenylation sequences in plasmid pG1Z-K14 to generate plasmid
pK14HPV16E6. The construct was sequenced to verify the intact state of
the E6 ORF. The presence of TTL in the E7 ORF was verified by presence of an engineered HpaI site in the linker. This recombinant
plasmid was digested with HindIII and EcoRI
to release a 3.2-kbp fragment that contains hK14 promoter, HPV16
sequences, and the K14 polyadenylation sequences. The fragment was
purified by gel electrophoresis and microinjected into fertilized mouse
FVB/N eggs as described previously (20, 24). Mice born from
these eggs were screened for the presence of transgene in their genome
by Southern analysis of genomic DNA prepared from tail biopsies. The
hybridization probe was the approximately 800-bp HPV16-specific DNA
fragment released from plasmid pK14HPV16E6 by digestion with
BamHI; it was 32P labeled by random primer
extension. To estimate the copy number of each of the transgenic
lineages, standard DNA of plasmid pK14HPV16E6 equal in amount to 1, 10, or 20 copies per mouse genome was included in the Southern analysis.
The blot was quantified with a Molecular Dynamics PhosphorImager.
Multiple lineages of K14E6 mice were bred in the Association for
Assessment and Accreditation of Laboratory Animal Care-approved
animal facilities in the McArdle Laboratory for Cancer Research. All
offspring were screened by Southern analysis or PCR.
Analysis of transgene expression by in situ hybridization.
Eight-day-old and six-week-old mice were sacrificed, and skin and ear
samples were collected. The samples were fixed in buffered formalin,
embedded in paraffin, and cut into 5-µm-thick sections. In situ
hybridization was performed as described previously (21). Sense and antisense E6 cRNA probes were transcribed in vitro from a
plasmid containing the HPV16 E6 and E7 ORFs downstream of SP6, and both
[35S]UTP and [35S]CTP were incorporated.
Photographic emulsion-coated slides were kept at Immunohistochemistry for BrdU, PCNA, and K14.
Skin sections
from torso skin of 8-day-old mice or from the ears of 6-week-old mice
were deparaffinized in xylenes and rehydrated in graded alcohol and
phosphate-buffered saline (PBS). Endogenous peroxidase was quenched by
treatment of skin sections with 3% hydrogen peroxide for 15 min. For
detection of 5'-bromo-2'-deoxyuridine (BrdU), the mice were
pulse-labeled with BrdU (100 µg/g of body weight; Sigma catalog no.
B-5002) 1 h before sacrifice, and tissue sections were stained by
the protocol provided with the BrdU staining kit (catalog no. HCS24;
Oncogene Research Products, Calbiochem). Briefly, tissue sections were
digested with trypsin and treated with a denaturing solution. After
incubation with biotinylated mouse anti-BrdU antibody and then
streptavidin-peroxidase, the slides were exposed to the peroxidase
substrate (diaminobenzidine) mixture for 5 min and counterstained with
hematoxylin. To compare the proliferation index of 8-day-old skin among
lineages, the total numbers of cells and the number of BrdU-positive
cells in the epidermis were counted in 30 randomly selected microscopic fields (magnification of ×400) of skin sections from three mice.
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The Human Papillomavirus Type 16 E6 Gene Alone Is
Sufficient To Induce Carcinomas in Transgenic Animals
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
20°C for 2 weeks
before development. The hybridization signals were examined by dark- or
bright-field microscopy.
Monitoring and statistical analysis of skin tumors.
Mice
were checked every 2 weeks for 15 months to monitor the development of
skin tumors. At time of animal sacrifice, part of tumor tissue was
fixed in buffered formalin for histological analysis; another part was
frozen and kept in 20°C for preparation of genomic DNA. Fixed
tissue was embedded in paraffin and cut into 5-µm sections for
staining with hematoxylin and eosin. Tumor type was determined by
histological analysis. The incidence of tumors from different lineages
was analyzed for statistical difference by the chi square test.
Analysis of H-ras mutations with PCR and RFLP. H-ras mutations were analyzed by PCR and restriction fragment length polymorphism RFLP. The DNA fragments encompassing codons 12 and 13 (collectively referred to as codon 12/13) (GGAGGC) or codon 61 (CAA) were amplified via PCR from tumor genomic DNA with two pairs of primers. The primers for codon 12/13 were 5'-GGGTCAGGCATCTATTAGCCG and 5'-CCAGCCTACACCCTTGCACCTC; primers for codon 61 were CTCCTACCGGAAACAGGTGGTC and 5'-GCTAGCCATAGGTGGCTCACC. Activated H-ras mutations commonly are G-to-A transitions or G-to-T transversions at the second position of codon 12 or 13 (6, 33). Transition mutations at codon 61, from CAA to CTA or CAT or GAA, are also frequently involved in H-ras activation, especially in some chemically induced tumors (7). These mutations create new restriction sites. At codon 12, GGA-to-GTA and GGA-to-GAA changes can be detected by digestion with SfcI and Eco57I, respectively; at codon 13, GGC-to-GTA and GGC-to-GAC changes can be detected by digestion with MaeII and HinfI, respectively; at codon 61, CAA-to-CTA and CAT-or-GAA changes can be detected by digestion with XbaI, BspHI or TaqI. PCR products digested with these enzymes were run on 3% Metaphor agarose gels and examined visually by ethidium bromide staining.
Analysis of DNA damage responses.
Eight-day-old mice from
line 5718 and line 5737 were irradiated with 
rays from a
(137Cs) source at a dose rate of 3.1 Gy/min. A total dose
of 5 Gy was delivered to the whole body of each mouse individually.
Three mice from each lineage were sacrificed at each time point of 4, 24, or 48 h following irradiation. Unirradiated mice were used as
controls. Mice were injected with BrdU 1 h before sacrifice, similarly as described above. Skin samples were obtained from the
dorsal area, fixed in 10% buffered formalin. Paraffin-embedded tissue
sections were stained for BrdU. Total epidermal cells and BrdU-positive
epidermal cells in 10 microscopic fields of skin section from each
mouse were counted. The average percentage of BrdU-positive cells and
standard deviation were calculated from the data generated from three
mice for each time point.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Generation of K14E6 transgenic mice.
To direct expression of
HPV-16 E6 to the basal layer of squamous epithelia, we cloned a
fragment of HPV16 DNA sequence from HPV16 nucleotides 79 to 883 that
contains both the E6 and E7 ORFs behind the hK14 promoter. A TTL was
inserted into the 5' region of E7 gene so that translation of E7 is
disrupted. The 3.2-kbp recombinant DNA fragment containing the intact
HPV16 E6 gene flanked by hK14 promoter and hK14 polyadenylation
sequences was injected into fertilized eggs from inbred FVB mice. Of
the 18 mice born, 5 were positive for the K14E6 transgene, based on
Southern analysis. The F0 mice were bred to establish five
lines of E6 transgenic mice (Table 1).
|
|
Phenotypes of K14E6 transgenic mice and hyperproliferation of E6-expressing cells. All founder mice and their offspring were carefully examined for overt and microscopic phenotypes. Of the five K14E6 transgenic lineages, lines 5737 and 5743, which have high copy numbers of the transgene per cells, developed overt phenotypes, including thickened ears and cataracts in the eye (Table 1). All mice in these lines, including founders, developed these overt phenotypes.
Histologically, the thickening of the ear was due to the thickening of epidermis (Fig. 2A and B). The epidermis of the normal (i.e., nontransgenic) adult mouse contains no more than two layers of nucleated cells beneath a keratinized layer. The basal cells in the stratum basale are normally well organized and are the only cells positively stained for keratin 14 (Fig. 2M). In the K14E6 transgenic mice, there was an expansion in the number of layers positively stained for K14 (Fig. 2N). To determine whether E6 induces hyperproliferation in the epidermis, we monitored nuclear staining for PCNA, a marker for cell proliferation. Compared with nontransgenic mice, the number of PCNA-positive cells in the epidermis from the ear of the K14E6 transgenic mice was significantly increased, and PCNA-positive cells were not restricted to the basal layer but included suprabasal cells (Fig. 2E and F). To test whether the suprabasal cells were actively synthesizing DNA, we pulse-labeled the mice with BrdU before sacrifice and measured BrdU incorporation immunohistochemically. As expected, BrdU-positive cells were seen only in the stratum basale of the epidermis in the nontransgenic mice. In the K14E6 transgenic epidermis of the ear, however, many BrdU-positive cells were also seen in the suprabasal compartment. All nucleated cell layers in the K14E6 epidermis had BrdU-positive cells, indicating that these cells were aberrantly passing through S phase (Fig. 2I and J). The proliferation index of the epidermis from skin taken from the torso was also measured by using the same BrdU incorporation assay. The percentage of BrdU-positive cells in the torso epidermis was significantly higher in K14E6 transgenic mice than in the nontransgenic mice (Table 2). An increase in the proliferation index was observed in the skin from both low-copy-number (line 5718) and high-copy-number (line 5737) mice, but it was statistically significant only in the latter mice. The ability of E6 to promote cell proliferation seemed to be p53 independent, as the epidermis from p53-knockout mice did not display an increase in the BrdU labeling index in body skin (Table 2).
|
|
|
HPV16 E6 induces primarily malignant skin tumors. To determine whether E6 alone is sufficient to induce tumors in vivo, mice from each K14E6 transgenic lineage were monitored closely for tumorigenesis over their life span. The two lines with high copy numbers of the E6 transgene, line 5737 and 5743, developed skin tumors with incidences about 14 and 10% at 15 months of age, respectively (Table 1). All tumors arose on the torso and limbs of the mice. We did not observe any skin tumors in the nontransgenic mice in the same period of time. The first onset of tumor was at 6 months of age; most tumors, however, developed in late adult life, indicating that a long latency is required. Interestingly, majority of these tumors showed signs of being malignant, as evidenced by their open and invasive characteristics. Upon histopathological examination, these malignant tumors were diagnosed as grade I, II, or III epidermoid carcinomas (Fig. 4). Among 24 tumors examined, 6 were papillomas and 5 were grade I, 11 were grade II, and 2 were grade III epidermoid carcinomas.
|
|
Abrogation of DNA damage response is not sufficient for tumor induction. We have reported earlier that E6 can abrogate responses to DNA damage in vivo (45). Abrogation of DNA damage responses may contribute to carcinogenesis. Because tumors developed in the K14E6 mice with high copy numbers of transgene but not in low-copy-number mice, we tested whether there was a similar difference in the abrogation of responses to DNA damage in these different transgenic lineages. Growth arrest was abrogated in the mice of the line with low copy number as efficiently as in the mice with high copy numbers (Fig. 6). Furthermore, induction of levels of p53 protein by ionizing radiation was not detectable in either line (reference 45 and unpublished data). This observation indicated that the responses to DNA damage in the skin must be sensitive to the presence of E6 and therefore were equally abrogated in both lines with high and low copy numbers of the transgene.
|
H-ras gene mutation does not play a role in E6-induced tumorigenesis. H-ras mutations are considered to be an initiation event in development of skin tumor, especially in chemically induced tumorigenesis (13, 32). H-ras mutations at codon 61 are predominant events in the dimethylbenzanthracene-induced tumors; most papillomas induced by chemical carcinogens contain A-to-T transversions at this codon (7, 38). Mutations at codon 12/13, especially G-to-T or G-to-A mutations at the second nucleotide of codon 12 or 13, also can activate H-ras and are found in murine experimental skin tumors (33). Earlier investigations have implicated the involvement of ras mutations in the carcinogenesis by HPV in humans (1) or in mice (19); in vitro experiments demonstrated that activated ras cooperates with E6 in cell transformation (4, 34). To learn whether activation of H-ras plays a role in the E6-induced tumor development, we amplified portions of the H-ras gene encompassing either codon 12/13 or codon 61 by PCR. The PCR product was digested with different restriction enzymes to identify activating mutations at these codons which generate new restriction sites. Twenty-four tumors derived from E6 transgenic mice were screened. No mutations at either codon 12/13 or codon 61 were detected.
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
E6 induces cellular hyperproliferation and epidermal hyperplasia. In the K14E6 mice, the epidermis was thickened. There was an increase in the number of PCNA-positive and BrdU-positive cells in the K14E6 epidermis, and these cells were found not only in the basal layer but also in the suprabasal compartment. A similar observation was made in the lens from these mice, in which the transgene was also found to be expressed. Nucleated cells were present in the center of the lens from these mice, whereas nontransgenic lens lack nucleated cells. PCNA and BrdU staining experiments indicated that some of these lens cells were supporting DNA synthesis (data not shown). The observations made in the skin and lens of K14E6 mice demonstrate that E6 induces cell proliferation. This induction of cell proliferation also was associated with an expansion in the K14-positive compartment in the K14E6 epidermis, indicating that the normal differentiation program is delayed. This delay may explain why other investigations have observed E6-positive human foreskin keratinocytes in tissue culture to be at least partially resistant to signals that normally induce their differentiation (42, 43).
E6 appears to induce hyperproliferation independently of p53 inactivation, because the cellular proliferation index was not increased in the epidermis of p53-null mice. Furthermore, the epidermis of p53-null mice appeared macroscopically and microscopically normal. That the p53-null epidermis is normal conforms with the observation made previously that p53 does not interfere with cell division and differentiation under normal conditions (48). Therefore, the hyperproliferation and the related delay in differentiation in the epidermis of K14E6 mice must be caused, at least in part, by activities of E6 other than its inactivation of p53. This prediction was supported by the data obtained with K14E6/p53-null mice (Fig. 2) in which E6 retained its capacity to induce epithelial hyperplasia. A requirement for p53-independent activities of E6 also has been posited to contribute to E6's ability to bestow on human foreskin keratinocytes resistance to differentiation in tissue culture.E6 primarily induces malignant tumors. Our animal studies demonstrate that E6 performs a different role than E7 in carcinogenesis. Earlier, we found that E7 alone usually induces benign tumors in adult K14E7 mice (23). By contrast, we found E6 alone usually induces malignant tumors in the K14E6 mice (this study). Carcinogenesis is a multistaged process, with multiple genetic events being required for induction of benign tumors and additional genetic events being required for progression of these benign tumors to malignancies. The simplest interpretation of our tumor data is that E7 contributes primarily to the early stages in carcinogenesis required for formation of benign tumors whereas E6 contributes to late stages in carcinogenesis involved in the evolution to malignancy. Interestingly, the activation of telomerase is preferentially detected in cervical carcinomas and a subset of cervical intraepithelial neoplasia grade III lesions (44). E6, but not E7, can activate telomerase (30). Thus, E6's activation of telomerase may account at least in part for its capacity to induce malignant tumors.
Multiple factors may be involved in E6 carcinogenesis. A well-recognized cellular target of E6 is p53. Loss of p53 in mice leads to early spontaneous development of tumors (14) and enhances the malignant progression of chemically induced skin tumors (28). Therefore, inactivation of p53 by E6 likely also contributes to E6's capacity to induce malignant skin tumors.
Inactivation of p53, however, may not be the only mechanism for E6-induced carcinogenesis. The K14E6 mice that developed tumors also displayed hyperplastic changes in the epidermis, a property that, as discussed above, cannot be ascribed to E6's inactivation of p53. It is likely that the hyperproliferation induced by E6 is important for its carcinogenesis. Another activity that may contribute to E6-associated carcinogenesis is its apparent inhibition of cellular differentiation. Cancer cells usually lack the ability to terminally differentiate. In this study, we found that the suprabasal compartment of the K14E6 transgenic epidermis stained for K14, indicating that E6 may also perturb cellular differentiation; this perturbation was caused by p53-independent activities of E6. The fact that E6 needs such a long latency to induce tumors indicates that although E6 inhibits functions of p53 and causes hyperplasia, other genetic events must be required for it to cause cancer. Mutations of H-ras have been implicated casually in the development of spontaneous and chemically induced skin tumor. We therefore assayed for mutations at H-ras codons 12, 13, and 61. No mutations were detected, indicating that H-ras mutations are not involved in E6-induced carcinogenesis. Genomic instability is thought to be one of the important events in malignant progression of tumors. In cell culture studies, E6 was demonstrated to induce genomic instability, including aneuploidy and gene amplification, and this induction was ascribed to E6's ability to inactivate p53 (36, 50). E6's ability to induce malignant tumors may be related to its capacity to induce genomic instability. We now are in the process of investigating whether there are genomic changes in tumors derived from E6 transgenic mice.| |
ACKNOWLEDGMENTS |
|---|
We thank Renee Herber for providing plasmid RLH66.2 containing HPVE6E7ttl, Kathleen Helmuth for technical assistance with microinjection, Amy Liem for assistance with breeding and maintenance of the transgenic lineages, and Jane Weeks, Angie Buehl, and Harlene Edwards for processing tissue sections. We thank Anne Griep for communication of unpublished results and Bill Sugden for critical review of the manuscript.
This study was supported by a grant from the American Cancer Society (VM164) and by grants from the National Institutes of Health (CA22443 and CA07175).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: McArdle Laboratory for Cancer Research, University of Wisconsin Medical School, 1400 University Ave., Madison, WI 53706. Phone: (608) 262-8533. Fax: (608) 262-2824. E-mail: Lambert{at}oncology.wisc.edu.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. | Anwar, K., K. Nakakuki, H. Naiki, and M. Inuzuka. 1993. ras gene mutations and HPV infection are common in human laryngeal carcinoma. Int. J. Cancer 53:22-28[Medline]. |
| 2. | Arbeit, J. M., K. Munger, P. M. Howley, and D. Hanahan. 1993. Neuroepithelial carcinomas in mice transgenic with human papillomavirus type 16 E6/E7 ORFs. Am. J. Pathol. 142:1187-1197[Abstract]. |
| 3. |
Band, V.,
C. J. De,
L. Delmolino,
V. Kulesa, and R. Sager.
1991.
Loss of p53 protein in human papillomavirus type 16 E6-immortalized human mammary epithelial cells.
J. Virol.
65:6671-6676 |
| 4. |
Bedell, M. A.,
K. H. Jones,
S. R. Grossman, and L. A. Laimins.
1989.
Identification of human papillomavirus type 18 transforming genes in immortalized and primary cells.
J. Virol.
63:1247-1255 |
| 5. |
Boyer, S. N.,
D. E. Wazer, and V. Band.
1996.
E7 protein of human papilloma virus-16 induces degradation of retinoblastoma protein through the ubiquitin-proteasome pathway.
Cancer Res.
56:4620-4624 |
| 6. |
Brown, K.,
A. Buchmann, and A. Balmain.
1990.
Carcinogen-induced mutations in the mouse c-Ha-ras gene provide evidence of multiple pathways for tumor progression.
Proc. Natl. Acad. Sci. USA
87:538-542 |
| 7. |
Chakravarti, D.,
J. C. Pelling,
E. L. Cavalieri, and E. G. Rogan.
1995.
Relating aromatic hydrocarbon-induced DNA adducts and c-H-ras mutations in mouse skin papillomas: the role of apurinic sites.
Proc. Natl. Acad. Sci. USA
92:10422-10422 |
| 8. |
Chellappan, S.,
V. B. Kraus,
B. Kroger,
K. Munger,
P. M. Howley,
W. C. Phelps, and J. R. Nevins.
1992.
Adenovirus E1A, simian virus 40 tumor antigen, and human papillomavirus E7 protein share the capacity to disrupt the interaction between transcription factor E2F and the retinoblastoma gene product.
Proc. Natl. Acad. Sci. USA
89:4549-4553 |
| 9. |
Chen, J. J.,
C. E. Reid,
V. Band, and E. J. Androphy.
1995.
Interaction of papillomavirus E6 oncoproteins with a putative calcium-binding protein.
Science
269:529-531 |
| 10. | Comerford, S. A., S. D. Maika, L. A. Laimins, A. Messing, H. P. Elsasser, and R. E. Hammer. 1995. E6 and E7 expression from the HPV 18 LCR: development of genital hyperplasia and neoplasia in transgenic mice. Oncogene 10:587-597[Medline]. |
| 11. | Das, B. C., J. K. Sharma, V. Gopalkrishna, D. K. Das, V. Singh, L. Gissmann, H. zur Hausen, and U. K. Luthra. 1992. A high frequency of human papillomavirus DNA sequences in cervical carcinomas of Indian women as revealed by Southern blot hybridization and polymerase chain reaction. J. Med. Virol. 36:239-245[Medline]. |
| 12. |
Davies, R.,
R. Hicks,
T. Crook,
J. Morris, and K. Vousden.
1993.
Human papillomavirus type 16 E7 associates with a histone H1 kinase and with p107 through sequences necessary for transformation.
J. Virol.
67:2521-2528 |
| 13. | DiGiovanni, J. 1992. Multistage carcinogenesis in mouse skin. Pharmacol. Ther. 54:63-128[Medline]. |
| 14. | Donehower, L. A., M. Harvey, B. L. Slagle, M. J. McArthur, C. A. Montgomery, Jr., J. S. Butel, and A. Bradley. 1992. Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature 356:215-221[Medline]. |
| 15. |
Dyson, N.,
P. Guida,
K. Munger, and E. Harlow.
1992.
Homologous sequences in adenovirus E1A and human papillomavirus E7 proteins mediate interaction with the same set of cellular proteins.
J. Virol.
66:6893-6902 |
| 16. |
Dyson, N.,
P. M. Howley,
K. Munger, and E. Harlow.
1989.
The human papilloma virus-16 E7 oncoprotein is able to bind to the retinoblastoma gene product.
Science
243:934-937 |
| 17. |
Funk, J. O.,
S. Waga,
J. B. Harry,
E. Espling,
B. Stillman, and D. A. Galloway.
1997.
Inhibition of CDK activity and PCNA-dependent DNA replication by p21 is blocked by interaction with the HPV-16 E7 oncoprotein.
Genes Dev.
11:2090-2100 |
| 18. |
Gao, Q.,
S. Srinivasan,
S. N. Boyer,
D. E. Wazer, and V. Band.
1999.
The E6 oncoproteins of high-risk papillomaviruses bind to a novel putative GAP protein, E6TP1, and target it for degradation.
Mol. Cell. Biol.
19:733-744 |
| 19. | Greenhalgh, D. A., X. J. Wang, J. A. Rothnagel, J. N. Eckhardt, M. I. Quintanilla, J. L. Barber, D. S. Bundman, M. A. Longley, R. Schlegel, and D. R. Roop. 1994. Transgenic mice expressing targeted HPV-18 E6 and E7 oncogenes in the epidermis develop verrucous lesions and spontaneous, rasHa-activated papillomas. Cell Growth Differ. 5:667-675[Abstract]. |
| 20. |
Griep, A. E.,
R. Herber,
S. Jeon,
J. K. Lohse,
R. R. Dubielzig, and P. F. Lambert.
1993.
Tumorigenicity by human papillomavirus type 16 E6 and E7 in transgenic mice correlates with alterations in epithelial cell growth and differentiation.
J. Virol.
67:1373-1384 |
| 21. | Gulliver, G., R. Herber, A. Liem, and P. F. Lambert. 1997. Both the CR1 and CR2 domains of human papillomavirus type 16 E7 are required for the induction of epidermal hyperplasia and tumor formation in transgenic mice. J. Virol. 71:5905-5914[Abstract]. |
| 22. |
Halbert, C. L.,
G. W. Demers, and D. A. Galloway.
1991.
The E7 gene of human papillomavirus type 16 is sufficient for immortalization of human epithelial cells.
J. Virol.
65:473-478 |
| 23. | Herber, R., A. Liem, H. Pitot, and P. F. Lambert. 1996. Squamous epithelial hyperplasia and carcinoma in mice transgenic for the human papillomavirus type 16 E7 oncogene. J. Virol. 70:1873-1881[Abstract]. |
| 24. | Hogan, B., F. Costantini, and E. Lacy. 1986. Manipulating the mouse embro: a laboratory manual. Cold Spring Harbor, Cold Spring Harbor, N.Y. |
| 25. |
Jones, D. L.,
R. M. Alani, and K. Munger.
1997.
The human papillomavirus E7 oncoprotein can uncouple cellular differentiation and proliferation in human keratinocytes by abrogating p21Cip1-mediated inhibition of cdk2.
Genes Dev.
11:2101-2111 |
| 26. | Jones, D. L., D. A. Thompson, and K. Munger. 1997. Destabilization of the RB tumor suppressor protein and stabilization of p53 contribute to HPV type 16 E7-induced apoptosis. Virology 239:97-107[Medline]. |
| 27. |
Kaur, P., and J. K. McDougall.
1988.
Characterization of primary human keratinocytes transformed by human papillomavirus type 18.
J. Virol.
62:1917-1924 |
| 28. | Kemp, C. J., L. A. Donehower, A. Bradley, and A. Balmain. 1993. Reduction of p53 gene dosage does not increase initiation or promotion but enhances malignant progression of chemically induced skin tumors. Cell 74:813-822[Medline]. |
| 29. |
Kiyono, T.,
A. Hiraiwa,
M. Fujita,
Y. Hayashi,
T. Akiyama, and M. Ishibashi.
1997.
Binding of high-risk human papillomavirus E6 oncoproteins to the human homologue of the Drosophila discs large tumor suppressor protein.
Proc. Natl. Acad. Sci. USA
94:11612-11616 |
| 30. | Klingelhutz, A. J., S. A. Foster, and J. K. McDougall. 1996. Telomerase activation by the E6 gene product of human papillomavirus type 16. Nature 380:79-82[Medline]. |
| 31. |
Lee, S. S.,
R. S. Weiss, and R. T. Javier.
1997.
Binding of human virus oncoproteins to hDlg/SAP97, a mammalian homolog of the Drosophila discs large tumor suppressor protein.
Proc. Natl. Acad. Sci. USA
94:6670-6675 |
| 32. | Mangues, R., and A. Pellicer. 1992. ras activation in experimental carcinogenesis. Semin. Cancer Biol. 3:229-239[Medline]. |
| 33. |
Munoz, E. F.,
B. A. Diwan,
R. J. Calvert,
C. M. Weghorst,
J. Anderson,
J. M. Rice, and G. S. Buzard.
1996.
Transplacental mutagenicity of cisplatin: H-ras codon 12 and 13 mutations in skin tumors of SENCAR mice.
Carcinogenesis
17:2741-2745 |
| 33a. | Nguyen, M., and A. Griep. Unpublished observations. |
| 34. | Phelps, W. C., C. L. Yee, K. Munger, and P. M. Howley. 1988. The human papillomavirus type 16 E7 gene encodes transactivation and transformation functions similar to those of adenovirus E1A. Cell 53:539-547[Medline]. |
| 35. |
Pirisi, L.,
K. E. Creek,
J. Doniger, and J. A. DiPaolo.
1988.
Continuous cell lines with altered growth and differentiation properties originate after transfection of human keratinocytes with human papillomavirus type 16 DNA.
Carcinogenesis
9:1573-1579 |
| 36. |
Reznikoff, C. A.,
C. Belair,
E. Savelieva,
Y. Zhai,
K. Pfeifer,
T. Yeager,
K. J. Thompson,
S. De Vries,
C. Bindley, and M. A. Newton.
1994.
Long-term genome stability and minimal genotypic and phenotypic alterations in HPV16 E7-, but not E6-, immortalized human uroepithelial cells.
Genes Dev.
8:2227-2240 |
| 37. |
Rotter, V.,
D. Schwartz,
E. Almon,
N. Goldfinger,
A. Kapon,
A. Meshorer,
L. A. Donehower, and A. J. Levine.
1993.
Mice with reduced levels of p53 protein exhibit the testicular giant-cell degenerative syndrome.
Proc. Natl. Acad. Sci. USA
90:9075-9079 |
| 38. |
Sasaki, K.,
O. Bertrand,
H. Nakazawa,
D. J. Fitzgerald,
N. Mironov, and H. Yamasaki.
1995.
Cell-type-specific ras mutations but no microsatellite instability in chemically induced mouse skin tumors and transformed 3T3 cells.
Cancer Res.
55:3513-3516 |
| 39. | Scheffner, M., J. M. Huibregtse, R. D. Vierstra, and P. M. Howley. 1993. The HPV-16 E6 and E6-AP complex functions as a ubiquitin-protein ligase in the ubiquitination of p53. Cell 75:495-505[Medline]. |
| 40. | Scheffner, M., B. A. Werness, J. M. Huibregtse, A. J. Levine, and P. M. Howley. 1990. The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53. Cell 63:1129-1136[Medline]. |
| 41. | Schwarz, E., U. K. Freese, L. Gissmann, W. Mayer, B. Roggenbuck, A. Stremlau, and H. zur Hausen. 1985. Structure and transcription of human papillomavirus sequences in cervical carcinoma cells. Nature 314:111-114[Medline]. |
| 42. | Sherman, L., A. Jackman, H. Itzhaki, M. C. Stoppler, D. Koval, and R. Schlegel. 1997. Inhibition of serum- and calcium-induced differentiation of human keratinocytes by HPV16 E6 oncoprotein: role of p53 inactivation. Virology 237:296-306[Medline]. |
| 43. | Sherman, L., and R. Schlegel. 1996. Serum- and calcium-induced differentiation of human keratinocytes is inhibited by the E6 oncoprotein of human papillomavirus type 16. J. Virol. 70:3269-3279[Abstract]. |
| 44. |
Snijders, P. J.,
M. van Duin,
J. M. Walboomers,
R. D. Steenbergen,
E. K. Risse,
T. J. Helmerhorst,
R. H. Verheijen, and C. J. Meijer.
1998.
Telomerase activity exclusively in cervical carcinomas and a subset of cervical intraepithelial neoplasia grade III lesions: strong association with elevated messenger RNA levels of its catalytic subunit and high-risk human papillomavirus DNA.
Cancer Res.
58:3812-3818 |
| 45. |
Song, S.,
G. A. Gulliver, and P. F. Lambert.
1998.
Human papillomavirus type 16 E6 and E7 oncogenes abrogate radiation-induced DNA damage responses in vivo through p53-dependent and p53-independent pathways.
Proc. Natl. Acad. Sci. USA
95:2290-2295 |
| 46. |
Tong, X., and P. M. Howley.
1997.
The bovine papillomavirus E6 oncoprotein interacts with paxillin and disrupts the actin cytoskeleton.
Proc. Natl. Acad. Sci. USA
94:4412-4417 |
| 47. | van den Brule, A. J., F. V. Cromme, P. J. Snijders, L. Smit, C. B. Oudejans, J. P. Baak, C. J. Meijer, and J. M. Walboomers. 1991. Nonradioactive RNA in situ hybridization detection of human papillomavirus 16-E7 transcripts in squamous cell carcinomas of the uterine cervix using confocal laser scan microscopy. Am. J. Pathol. 139:1037-1045[Abstract]. |
| 48. | Weinberg, W. C., C. G. Azzoli, K. Chapman, A. J. Levine, and S. H. Yuspa. 1995. p53-mediated transcriptional activity increases in differentiating epidermal keratinocytes in association with decreased p53 protein. Oncogene 10:2271-2279[Medline]. |
| 49. |
Werness, B. A.,
A. J. Levine, and P. M. Howley.
1990.
Association of human papillomavirus types 16 and 18 E6 proteins with p53.
Science
248:76-79 |
| 50. |
White, A. E.,
E. M. Livanos, and T. D. Tlsty.
1994.
Differential disruption of genomic integrity and cell cycle regulation in normal human fibroblasts by the HPV oncoproteins.
Genes Dev.
8:666-677 |
| 51. |
Woodworth, C. D.,
P. E. Bowden,
J. Doniger,
L. Pirisi,
W. Barnes,
W. D. Lancaster, and J. A. DiPaolo.
1988.
Characterization of normal human exocervical epithelial cells immortalized in vitro by papillomavirus types 16 and 18 DNA.
Cancer Res.
48:4620-4628 |
| 52. |
Woodworth, C. D.,
J. Doniger, and J. A. DiPaolo.
1989.
Immortalization of human foreskin keratinocytes by various human papillomavirus DNAs corresponds to their association with cervical carcinoma.
J. Virol.
63:159-164 |
| 53. | Yee, C., H. I. Krishnan, C. C. Baker, R. Schlegel, and P. M. Howley. 1985. Presence and expression of human papillomavirus sequences in human cervical carcinoma cell lines. Am. J. Pathol. 119:361-366[Abstract]. |
| 54. | Zerfass-Thome, K., W. Zwerschke, B. Mannhardt, R. Tindle, J. W. Botz, and P. Jansen-Durr. 1996. Inactivation of the cdk inhibitor p27KIP1 by the human papillomavirus type 16 E7 oncoprotein. Oncogene 13:2323-2330[Medline]. |
| 55. |
zur Hausen, H.
1996.
Papillomavirus infections a major cause of human cancers.
Biochim. Biophys. Acta
1288:F55-F78[Medline].
|
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
), line 5743 (
), and line 5737 homozygous (
) mice.
The numbers of mice monitored up to at least 12 months in the three
groups were 181, 73, and 80, respectively.
