Previous Article | Next Article 
Journal of Virology, July 1999, p. 5887-5893, Vol. 73, No. 7
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The Human Papillomavirus Type 16 E6 Gene Alone Is
Sufficient To Induce Carcinomas in Transgenic Animals
Shiyu
Song,
Henry C.
Pitot, and
Paul F.
Lambert*
McArdle Laboratory for Cancer Research,
University of Wisconsin Medical School, Madison, Wisconsin 53706
Received 30 December 1998/Accepted 18 March 1999
 |
ABSTRACT |
High-risk human papillomaviruses (HPVs) are the causative agents of
certain human cancers. HPV type 16 (HPV16) is the papillomavirus most
frequently associated with cervical cancer in women. The E6 and E7
genes of HPV are expressed in cells derived from these cancers and can
transform cells in tissue culture. Animal experiments have demonstrated
that E6 and E7 together cause tumors. We showed previously that E6 and
E7 together or E7 alone could induce skin tumors in mice when these
genes were expressed in the basal epithelia of the skin. In this study,
we investigated the role that the E6 gene plays in carcinogenesis. We
generated K14E6 transgenic mice, in which the HPV16 E6 gene was
directed in its expression by the human keratin 14 promoter (hK14) to
the basal layer of the epidermis. We found that E6 induced cellular
hyperproliferation and epidermal hyperplasia and caused skin tumors in
adult mice. Interestingly, the tumors derived from E6 were mostly
malignant, as opposed to the tumors from E7 mice, which were mostly
benign. This result leads us to hypothesize that E6 may contribute
differently than E7 to HPV-associated carcinogenesis; whereas E7
primarily contributes to the early stages of carcinogenesis that lead
to the formation of benign tumors, E6 primarily contributes to the late
stages of carcinogenesis that lead to malignancy.
 |
INTRODUCTION |
Human papillomaviruses (HPVs) are
small DNA tumor viruses that cause papillomas in human skin, genitalia,
and upper respiratory tract. Certain types of HPVs, referred to as
high-risk HPVs, are associated with malignant tumors (55).
More than 90% of cervical carcinomas, for example, are related to HPV
infections (11). In these cancer cells, HPV genomes commonly
are found integrated into the cellular genome (11, 41). The
integration events leave intact the early region of the HPV genome
containing the E6 and E7 genes (41, 53). Transcripts of the
E6 and E7 genes are detected in the cervical cancer-derived cell lines
(47, 52), indicating these two genes potentially play a role
in HPV-associated carcinogenesis. Cell culture experiments have
demonstrated that E6 and E7 possess transforming activities; E6 or E7
each can transform established cells; E6 is also found to immortalize
primary human mammary epithelial cells (3), whereas E7 is
sufficient to immortalize primary human keratinocytes (22).
The discovery of cellular targets of E6 and E7 provided insight into
the potential molecular mechanisms by which E6 and E7 cause cellular
transformation. E6 can associate with p53 through the E6 associate
protein, leading to degradation of p53 by the ubiquitin proteasome
pathway (39, 40, 49). Recently, other cellular factors, such
as E6 binding protein (9), paxillin (46), the
human homologue of Drosophila large disc tumor suppressor gene (29, 31), and E6TP1 (18), have been reported
to associate with E6. Whether and how these interactions contribute to
carcinogenesis is not yet clear. E7 can also associate with multiple
cellular factors, one of which is the retinoblastoma tumor
susceptibility gene product, pRb (8, 16). Binding of E7 to
pRb promotes degradation of pRb and leads to the inhibition of pRb
functions (5, 26). Other proteins that associate with E7 are
prominently related to the regulation of the cell cycle, such as
cyclins/cyclin-dependent kinase inhibitors (17, 25, 54) and
other members of the Rb gene family (12, 15). As many of the
cellular factors that E6 and E7 interact with are either tumor
suppressors or cell cycle regulators, it is not surprising that E6 and
E7 can cause fundamental changes in cell growth behavior.
Cells transformed by E6 or E7 rarely grow into tumors when transplanted
into nude mice, indicating that other molecular events must be required
for the transformed cells to become tumorigenic (27, 35,
51). This observation is consistent with the epidemiological data
from human cancers in that high-risk HPV infections require long
latency periods before their associated cervical cancers develop. To
test whether E6 and E7 are oncogenic in vivo, experiments using
transgenic mice have been conducted. E6 and E7 together cause tumors in
mice (2, 10, 20). To dissect the roles of E6 and E7 in HPV
carcinogenesis, we generated transgenic mice in which the HPV type 16 (HPV16) E7 gene was expressed in the epidermis by the human keratin 14 (hK14) promoter. These mice had multiple phenotypes, including
epidermal hyperplasia and skin tumors (23). Thus, HPV16 E7
alone causes tumorigenesis in animals. In the present study, we have
addressed the role of E6 in HPV-induced carcinogenesis. We generated
K14E6 transgenic mice in which the HPV16 E6 gene was expressed in the
basal layer of epithelia, using the hK14 promoter. Expression of E6
increased cell proliferation and induced epidermal hyperplasia. Skin
tumors developed in adult K14E6 mice with an incidence of about 7% at
1 year of age. In contrast to the tumors derived from K14E7 transgenic
mice, which were primarily benign, tumors derived from K14E6 transgenic
mice were mostly malignant, indicating that E6 alone not only is
sufficient to induce tumors but may contribute to the development of
malignancy in animals.
 |
MATERIALS AND METHODS |
Construction of transgene and generation of transgenic
mouse.
The K14E6 transgene was constructed similarly to the K14E7
transgene (23). Briefly, a DNA fragment from the HPV genome
spanning nucleotides 79 to 883 and encompassing the E6 and E7 open
reading frames (ORFs) was PCR amplified with primers containing
BamHI sites. In this amplified DNA fragment, a translational
termination linker (TTL) is present in the early region of the E7 ORF,
precluding expression of E7. The BamHI fragment was inserted
into the unique BamHI site between the hK14 promoter and
hK14 polyadenylation sequences in plasmid pG1Z-K14 to generate plasmid
pK14HPV16E6. The construct was sequenced to verify the intact state of
the E6 ORF. The presence of TTL in the E7 ORF was verified by presence of an engineered HpaI site in the linker. This recombinant
plasmid was digested with HindIII and EcoRI
to release a 3.2-kbp fragment that contains hK14 promoter, HPV16
sequences, and the K14 polyadenylation sequences. The fragment was
purified by gel electrophoresis and microinjected into fertilized mouse
FVB/N eggs as described previously (20, 24). Mice born from
these eggs were screened for the presence of transgene in their genome
by Southern analysis of genomic DNA prepared from tail biopsies. The
hybridization probe was the approximately 800-bp HPV16-specific DNA
fragment released from plasmid pK14HPV16E6 by digestion with
BamHI; it was 32P labeled by random primer
extension. To estimate the copy number of each of the transgenic
lineages, standard DNA of plasmid pK14HPV16E6 equal in amount to 1, 10, or 20 copies per mouse genome was included in the Southern analysis.
The blot was quantified with a Molecular Dynamics PhosphorImager.
Multiple lineages of K14E6 mice were bred in the Association for
Assessment and Accreditation of Laboratory Animal Care-approved
animal facilities in the McArdle Laboratory for Cancer Research. All
offspring were screened by Southern analysis or PCR.
Analysis of transgene expression by in situ hybridization.
Eight-day-old and six-week-old mice were sacrificed, and skin and ear
samples were collected. The samples were fixed in buffered formalin,
embedded in paraffin, and cut into 5-µm-thick sections. In situ
hybridization was performed as described previously (21). Sense and antisense E6 cRNA probes were transcribed in vitro from a
plasmid containing the HPV16 E6 and E7 ORFs downstream of SP6, and both
[35S]UTP and [35S]CTP were incorporated.
Photographic emulsion-coated slides were kept at
20°C for 2 weeks
before development. The hybridization signals were examined by dark- or
bright-field microscopy.
Immunohistochemistry for BrdU, PCNA, and K14.
Skin sections
from torso skin of 8-day-old mice or from the ears of 6-week-old mice
were deparaffinized in xylenes and rehydrated in graded alcohol and
phosphate-buffered saline (PBS). Endogenous peroxidase was quenched by
treatment of skin sections with 3% hydrogen peroxide for 15 min. For
detection of 5'-bromo-2'-deoxyuridine (BrdU), the mice were
pulse-labeled with BrdU (100 µg/g of body weight; Sigma catalog no.
B-5002) 1 h before sacrifice, and tissue sections were stained by
the protocol provided with the BrdU staining kit (catalog no. HCS24;
Oncogene Research Products, Calbiochem). Briefly, tissue sections were
digested with trypsin and treated with a denaturing solution. After
incubation with biotinylated mouse anti-BrdU antibody and then
streptavidin-peroxidase, the slides were exposed to the peroxidase
substrate (diaminobenzidine) mixture for 5 min and counterstained with
hematoxylin. To compare the proliferation index of 8-day-old skin among
lineages, the total numbers of cells and the number of BrdU-positive
cells in the epidermis were counted in 30 randomly selected microscopic fields (magnification of ×400) of skin sections from three mice.
For proliferating cell nuclear antigen (PCNA) detection, tissue
sections were blocked with 5% nonfat dry milk-PBS and/or 5% normal
goat serum for 30 min, mouse monoclonal anti-mouse PCNA antibody
(Boehringer Mannheim), diluted 1:200 in 5% milk-PBS, was added, and
the the mixture was incubated for 3 h at room temperature. After
incubation with peroxidase-labeled anti-mouse secondary antibody (30 min) and then with Vectastain ABC reagents (30 min), the slides were
exposed to diaminobenzidine substrate. The slides were counterstained
with fast green and examined for nuclear staining of PCNA. Mouse K14
staining was performed similarly except that the slides were incubated
with 1:500-diluted rabbit polyclonal antibody against mouse K14
(catalog no. PRB-155P-100; BAbco, Richmond, Calif.) for 1 h, and
the slides were counterstained with hematoxylin.
Monitoring and statistical analysis of skin tumors.
Mice
were checked every 2 weeks for 15 months to monitor the development of
skin tumors. At time of animal sacrifice, part of tumor tissue was
fixed in buffered formalin for histological analysis; another part was
frozen and kept in
20°C for preparation of genomic DNA. Fixed
tissue was embedded in paraffin and cut into 5-µm sections for
staining with hematoxylin and eosin. Tumor type was determined by
histological analysis. The incidence of tumors from different lineages
was analyzed for statistical difference by the chi square test.
Analysis of H-ras mutations with PCR and RFLP.
H-ras mutations were analyzed by PCR and restriction
fragment length polymorphism RFLP. The DNA fragments encompassing
codons 12 and 13 (collectively referred to as codon 12/13)
(GGAGGC) or codon 61 (CAA) were amplified via PCR from tumor
genomic DNA with two pairs of primers. The primers for codon 12/13 were
5'-GGGTCAGGCATCTATTAGCCG and 5'-CCAGCCTACACCCTTGCACCTC;
primers for codon 61 were CTCCTACCGGAAACAGGTGGTC and
5'-GCTAGCCATAGGTGGCTCACC. Activated H-ras
mutations commonly are G-to-A transitions or G-to-T transversions at
the second position of codon 12 or 13 (6, 33). Transition
mutations at codon 61, from CAA to CTA or CAT or GAA, are also
frequently involved in H-ras activation, especially in some
chemically induced tumors (7). These mutations create new
restriction sites. At codon 12, GGA-to-GTA and GGA-to-GAA changes can
be detected by digestion with SfcI and Eco57I,
respectively; at codon 13, GGC-to-GTA and GGC-to-GAC changes can be
detected by digestion with MaeII and HinfI,
respectively; at codon 61, CAA-to-CTA and CAT-or-GAA changes can be
detected by digestion with XbaI, BspHI or
TaqI. PCR products digested with these enzymes were run on
3% Metaphor agarose gels and examined visually by ethidium bromide staining.
Analysis of DNA damage responses.
Eight-day-old mice from
line 5718 and line 5737 were irradiated with
rays from a
(137Cs) source at a dose rate of 3.1 Gy/min. A total dose
of 5 Gy was delivered to the whole body of each mouse individually.
Three mice from each lineage were sacrificed at each time point of 4, 24, or 48 h following irradiation. Unirradiated mice were used as
controls. Mice were injected with BrdU 1 h before sacrifice, similarly as described above. Skin samples were obtained from the
dorsal area, fixed in 10% buffered formalin. Paraffin-embedded tissue
sections were stained for BrdU. Total epidermal cells and BrdU-positive
epidermal cells in 10 microscopic fields of skin section from each
mouse were counted. The average percentage of BrdU-positive cells and
standard deviation were calculated from the data generated from three
mice for each time point.
 |
RESULTS |
Generation of K14E6 transgenic mice.
To direct expression of
HPV-16 E6 to the basal layer of squamous epithelia, we cloned a
fragment of HPV16 DNA sequence from HPV16 nucleotides 79 to 883 that
contains both the E6 and E7 ORFs behind the hK14 promoter. A TTL was
inserted into the 5' region of E7 gene so that translation of E7 is
disrupted. The 3.2-kbp recombinant DNA fragment containing the intact
HPV16 E6 gene flanked by hK14 promoter and hK14 polyadenylation
sequences was injected into fertilized eggs from inbred FVB mice. Of
the 18 mice born, 5 were positive for the K14E6 transgene, based on
Southern analysis. The F0 mice were bred to establish five
lines of E6 transgenic mice (Table 1).
To determine whether E6 was expressed specifically in the epidermis, we
examined the pattern of E6 mRNA expression by in situ
hybridization
with a probe specific for E6 mRNA. E6 mRNA was detected
in the
epidermis in both low- and high-copy-number transgenic
mice (Fig.
1B
and C). Lower levels of E6 expression
were also
detected in the underlying dermis, but restricted primarily
to
the hair follicles. Epidermis from the ear demonstrated high levels
of mRNA of E6. There was an absence of signal in the dermis, which
in
the ear has a paucity of hair follicles (Fig.
1D).

View larger version (126K):
[in this window]
[in a new window]
|
FIG. 1.
Examples of skin sections analyzed for E6 mRNA by in
situ hybridization with a specific antisense RNA probe. (A to C)
Dark-field images (magnification, ×400) of skin sections from
nontransgenic (A), K14E6 transgenic line 5718 (B) and K14E6 transgenic
line 5737 (C) mice. Bright areas indicate strong hybridization to an
E6-specific probe. Note that signal is brightest in the epidermis (ep)
but also present in underlying epithelial structures (hair follicles)
in the dermis (dm). (D) Bright-field image (×100) of an ear section
from K14E6 line 5737. Dark areas in the epidermis of both sides of the
ear indicate strong hybridization to the E6-specific probe. Note
absence of signal in the underlying dermis and cartilage (ct).
|
|
Phenotypes of K14E6 transgenic mice and hyperproliferation of
E6-expressing cells.
All founder mice and their offspring were
carefully examined for overt and microscopic phenotypes. Of the five
K14E6 transgenic lineages, lines 5737 and 5743, which have high copy
numbers of the transgene per cells, developed overt phenotypes,
including thickened ears and cataracts in the eye (Table 1). All mice
in these lines, including founders, developed these overt phenotypes.
Histologically, the thickening of the ear was due to the thickening of
epidermis (Fig.
2A and B). The epidermis
of the normal
(i.e., nontransgenic) adult mouse contains no more than
two layers
of nucleated cells beneath a keratinized layer. The basal
cells
in the stratum basale are normally well organized and are the
only cells positively stained for keratin 14 (Fig.
2M). In the
K14E6
transgenic mice, there was an expansion in the number of
layers
positively stained for K14 (Fig.
2N). To determine whether
E6 induces
hyperproliferation in the epidermis, we monitored nuclear
staining for
PCNA, a marker for cell proliferation. Compared with
nontransgenic
mice, the number of PCNA-positive cells in the epidermis
from the ear
of the K14E6 transgenic mice was significantly increased,
and
PCNA-positive cells were not restricted to the basal layer
but included
suprabasal cells (Fig.
2E and F). To test whether
the suprabasal cells
were actively synthesizing DNA, we pulse-labeled
the mice with BrdU
before sacrifice and measured BrdU incorporation
immunohistochemically.
As expected, BrdU-positive cells were seen
only in the stratum basale
of the epidermis in the nontransgenic
mice. In the K14E6 transgenic
epidermis of the ear, however, many
BrdU-positive cells were also seen
in the suprabasal compartment.
All nucleated cell layers in the K14E6
epidermis had BrdU-positive
cells, indicating that these cells were
aberrantly passing through
S phase (Fig.
2I and J). The proliferation
index of the epidermis
from skin taken from the torso was also
measured by using the
same BrdU incorporation assay. The percentage of
BrdU-positive
cells in the torso epidermis was significantly higher in
K14E6
transgenic mice than in the nontransgenic mice (Table
2). An
increase in the proliferation
index was observed in the skin from
both low-copy-number (line 5718)
and high-copy-number (line 5737)
mice, but it was statistically
significant only in the latter
mice. The ability of E6 to promote cell
proliferation seemed to
be p53 independent, as the epidermis from
p53-knockout mice did
not display an increase in the BrdU labeling
index in body skin
(Table
2).

View larger version (96K):
[in this window]
[in a new window]
|
FIG. 2.
Histological and immunohistochemical analysis of
epidermis from the ears of 6-week-old nontransgenic, K14E6 transgenic
line 5737, p53-null, and E6/p53-null mice. All tissue sections were
paraffin embedded. (A to D) Hematoxylin-and-eosin-stained sections of
the ear at high magnification (×200). The epidermis is indicated by
the arrow. Note thickening of the epidermis in the ears of K14E6 and
K14E6/p53-null mice. Ear sections were stained immunohistochemically
for PCNA (E to H) and BrdU (I to L). Positive cells are indicated by
arrows. Note increased numbers of PCNA-positive and BrdU-positive cells
and their appearance in the suprabasal portion of the epidermis in both
K14E6 mice and K14E6/p53-null mice. In panels M to P, ear sections were
stained for K14. Note thickening of the K14-positive portion of the
epidermis in the K14E6 and K14E6/p53-null ear sections.
|
|
To determine further whether E6-induced thickening of the epidermis is
due to E6's p53-independent activities, we generated
K14E6
transgenic/p53-null mice and compared their phenotypes with
that of
p53-null mice. The epidermis from p53-null mice was not
different from
that of nontransgenic mice (Fig.
2C, G, K, and
O). In contrast, the
epidermis from K14E6/p53-null mice was thickened,
the K14-positive
compartment was expanded, and there was an increase
in the number of
PCNA- and BrdU-positive cells, including their
abundance in the
suprabasal compartment (Fig.
2D, H, L, and P).
These data indicate that
E6 activities other than its inactivation
of p53 contribute to its
induction of epithelial
hyperplasia.
Histological analysis of the eyes from K14E6 mice indicated that the
cataracts in their eyes resulted from the existence of
nucleated cells
in the interior of the lens (data not shown).
Preliminary evidence
indicates that the K14E6 transgene was expressed
in the transitional
zone of the lens epithelium (
33a). BrdU incorporation
assays
demonstrated that some of the nucleated cells in the interior
of the
lens were able to synthesize DNA. Similar phenotypes were
also seen in
the lens of the K14E6/p53-null mice but not in the
lens of p53-null
mice.
One line of K14E6 mice (line 5743) showed a testicular degenerative
syndrome. Mice from this lineage were initially found
difficult to
breed. Their litter sizes were small, and only some
of the male mice
were fertile. We examined the tissue section
of testes from these mice
and found that the seminiferous tubules
in these sections were
structurally normal but lacked mature sperm
cells in the seminiferous
lumen. Instead, many giant cells with
dark nuclei were observed inside
the seminiferous tubules (Fig.
3). These
cells are hallmarks of a degenerative testicular syndrome.
Interestingly, this syndrome occurs in some p53-knockout mice
and mice
with reduced levels of p53 protein (
37). Loss of p53
function in the mice from the K14E6 lineage may be responsible,
therefore, for the development of this syndrome.

View larger version (171K):
[in this window]
[in a new window]
|
FIG. 3.
Histological analysis of mouse testes. Normal mature
sperm cells (sp), diploid spermatogonia stem cells (sg), and 4N
spermatocytes in the seminiferous tubules from nontransgenic mice are
indicated by arrows (A). Many giant cells (gc), not mature sperm cells,
are seen in seminiferous tubules from K14E6 transgenic line 5743 mice
(B).
|
|
HPV16 E6 induces primarily malignant skin tumors.
To determine
whether E6 alone is sufficient to induce tumors in vivo, mice from each
K14E6 transgenic lineage were monitored closely for tumorigenesis over
their life span. The two lines with high copy numbers of the E6
transgene, line 5737 and 5743, developed skin tumors with incidences
about 14 and 10% at 15 months of age, respectively (Table 1). All
tumors arose on the torso and limbs of the mice. We did not observe any
skin tumors in the nontransgenic mice in the same period of time. The
first onset of tumor was at 6 months of age; most tumors, however,
developed in late adult life, indicating that a long latency is
required. Interestingly, majority of these tumors showed signs of being malignant, as evidenced by their open and invasive characteristics. Upon histopathological examination, these malignant tumors were diagnosed as grade I, II, or III epidermoid carcinomas (Fig.
4). Among 24 tumors examined, 6 were
papillomas and 5 were grade I, 11 were grade II, and 2 were grade III
epidermoid carcinomas.

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 4.
Histology of skin tumors derived from K14E6 transgenic
mice. The K14E6 mice developed both benign and malignant skin tumors.
(A) Section of papilloma, a benign outgrowth of skin with epidermal
hyperplasia. The morphology of cells are relatively normal and the
basement membrane in this lesion is intact (arrow). The epidermis and
underlying dermis (arrowhead) are clearly demarcated. (B) Epidermoid
carcinoma grade I. The cells form a concentric pattern that is poorly
demarcated (arrowheads). In the center of these structures are
keratinized and differentiated cells. Note the presence of "pearls"
of keratin (arrow), characteristic of well-differentiated epidermoid
carcinoma. (C) Example of grade III epidermoid carcinoma. The cells are
more anaplastic than in panel B and do not form keratin pearls. These
cells are still able to be keratinized individually (arrow).
|
|
The overt phenotype and tumor incidence appeared to be dependent on
gene dosage of E6 transgene, because only the two lines
with higher
copy number spontaneously developed tumors. To examine
the gene dosage
effect further, transgenic mice homozygous for
the E6 transgene were
generated from line 5737 and monitored for
tumor development. The mice
homozygous for the K14E6 transgene
(5737-H) developed skin tumors
earlier and with a higher incidence
than did mice from the same line
hemizygous for the K14E6 transgene
(Fig.
5). Tumors in the homozygous line 5737 were seen as early
as 4 months of age, and the incidence of skin tumors
increased
to more than 20% by 1 year of age, compared to 7% in the
line
5737 mice hemizygous for the K14E6 transgene. The difference in
the incidence of skin tumors in line 5737 hemizygotes and homozygotes
was statistically significant (
P < 0.01). This result
demonstrated
that E6 gene dosage strongly influences tumor development
in these
animals.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 5.
Skin tumor development over 15 months of life in K14E6
line 5737 ( ), line 5743 ( ), and line 5737 homozygous ( ) mice.
The numbers of mice monitored up to at least 12 months in the three
groups were 181, 73, and 80, respectively.
|
|
Abrogation of DNA damage response is not sufficient for tumor
induction.
We have reported earlier that E6 can abrogate responses
to DNA damage in vivo (45). Abrogation of DNA damage
responses may contribute to carcinogenesis. Because tumors developed in
the K14E6 mice with high copy numbers of transgene but not in
low-copy-number mice, we tested whether there was a similar difference
in the abrogation of responses to DNA damage in these different
transgenic lineages. Growth arrest was abrogated in the mice of the
line with low copy number as efficiently as in the mice with high copy numbers (Fig. 6). Furthermore, induction
of levels of p53 protein by ionizing radiation was not detectable in
either line (reference 45 and unpublished data).
This observation indicated that the responses to DNA damage in the skin
must be sensitive to the presence of E6 and therefore were equally
abrogated in both lines with high and low copy numbers of the
transgene.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 6.
Abrogation of radiation-induced growth arrest in the
epidermis from K14E6 mice with low or high transgene copy number. Shown
are percentages of BrdU-positive cells in the epidermis of K14E6 line
5737 mice carrying a high copy number of the transgene, K14E6 line 5718 mice carrying a low copy number of the transgene, and nontransgenic
FVB/N mice that were treated or not treated with 5 Gy of ionizing
radiation. Provided are the average values for three mice in each
group ± 1 standard deviation. The 10-fold reduction in percentage
of BrdU-positive cells in nontransgenic FVB/N mice is an indicator of
the radiation-induced growth arrest. Note absence of reduction in the
percentage of BrdU-positive cells in the epidermis from mice of both
lines 5737 and 5718.
|
|
H-ras gene mutation does not play a role in E6-induced
tumorigenesis.
H-ras mutations are considered to be an
initiation event in development of skin tumor, especially in chemically
induced tumorigenesis (13, 32). H-ras mutations
at codon 61 are predominant events in the
dimethylbenzanthracene-induced tumors; most papillomas induced by
chemical carcinogens contain A-to-T transversions at this codon
(7, 38). Mutations at codon 12/13, especially G-to-T or
G-to-A mutations at the second nucleotide of codon 12 or 13, also can
activate H-ras and are found in murine experimental skin
tumors (33). Earlier investigations have implicated the involvement of ras mutations in the carcinogenesis by HPV in
humans (1) or in mice (19); in vitro experiments
demonstrated that activated ras cooperates with E6 in cell
transformation (4, 34). To learn whether activation of
H-ras plays a role in the E6-induced tumor development, we
amplified portions of the H-ras gene encompassing either
codon 12/13 or codon 61 by PCR. The PCR product was digested with
different restriction enzymes to identify activating mutations at these
codons which generate new restriction sites. Twenty-four tumors derived
from E6 transgenic mice were screened. No mutations at either codon
12/13 or codon 61 were detected.
 |
DISCUSSION |
E6 induces cellular hyperproliferation and epidermal
hyperplasia.
In the K14E6 mice, the epidermis was thickened. There
was an increase in the number of PCNA-positive and BrdU-positive cells in the K14E6 epidermis, and these cells were found not only in the
basal layer but also in the suprabasal compartment. A similar observation was made in the lens from these mice, in which the transgene was also found to be expressed. Nucleated cells were present
in the center of the lens from these mice, whereas nontransgenic lens
lack nucleated cells. PCNA and BrdU staining experiments indicated that
some of these lens cells were supporting DNA synthesis (data not
shown). The observations made in the skin and lens of K14E6 mice
demonstrate that E6 induces cell proliferation. This induction of cell
proliferation also was associated with an expansion in the K14-positive
compartment in the K14E6 epidermis, indicating that the normal
differentiation program is delayed. This delay may explain why other
investigations have observed E6-positive human foreskin keratinocytes
in tissue culture to be at least partially resistant to signals that
normally induce their differentiation (42, 43).
E6 appears to induce hyperproliferation independently of p53
inactivation, because the cellular proliferation index was not
increased in the epidermis of p53-null mice. Furthermore, the
epidermis
of p53-null mice appeared macroscopically and microscopically
normal.
That the p53-null epidermis is normal conforms with the
observation
made previously that p53 does not interfere with cell
division and
differentiation under normal conditions (
48). Therefore,
the
hyperproliferation and the related delay in differentiation
in the
epidermis of K14E6 mice must be caused, at least in part,
by activities
of E6 other than its inactivation of p53. This prediction
was supported
by the data obtained with K14E6/p53-null mice (Fig.
2) in which E6
retained its capacity to induce epithelial hyperplasia.
A requirement
for p53-independent activities of E6 also has been
posited to
contribute to E6's ability to bestow on human foreskin
keratinocytes
resistance to differentiation in tissue
culture.
E6 primarily induces malignant tumors.
Our animal studies
demonstrate that E6 performs a different role than E7 in
carcinogenesis. Earlier, we found that E7 alone usually induces benign
tumors in adult K14E7 mice (23). By contrast, we found E6
alone usually induces malignant tumors in the K14E6 mice (this study).
Carcinogenesis is a multistaged process, with multiple genetic events
being required for induction of benign tumors and additional genetic
events being required for progression of these benign tumors to
malignancies. The simplest interpretation of our tumor data is that E7
contributes primarily to the early stages in carcinogenesis required
for formation of benign tumors whereas E6 contributes to late stages in
carcinogenesis involved in the evolution to malignancy. Interestingly,
the activation of telomerase is preferentially detected in cervical
carcinomas and a subset of cervical intraepithelial neoplasia grade III
lesions (44). E6, but not E7, can activate telomerase
(30). Thus, E6's activation of telomerase may account at
least in part for its capacity to induce malignant tumors.
Multiple factors may be involved in E6 carcinogenesis.
A
well-recognized cellular target of E6 is p53. Loss of p53 in mice leads
to early spontaneous development of tumors (14) and enhances
the malignant progression of chemically induced skin tumors
(28). Therefore, inactivation of p53 by E6 likely also contributes to E6's capacity to induce malignant skin tumors.
Inactivation of p53, however, may not be the only mechanism for
E6-induced carcinogenesis. The K14E6 mice that developed tumors
also
displayed hyperplastic changes in the epidermis, a property
that, as
discussed above, cannot be ascribed to E6's inactivation
of p53. It is
likely that the hyperproliferation induced by E6
is important for its
carcinogenesis. Another activity that may
contribute to E6-associated
carcinogenesis is its apparent inhibition
of cellular differentiation.
Cancer cells usually lack the ability
to terminally differentiate. In
this study, we found that the
suprabasal compartment of the K14E6
transgenic epidermis stained
for K14, indicating that E6 may also
perturb cellular differentiation;
this perturbation was caused by
p53-independent activities of
E6.
The fact that E6 needs such a long latency to induce tumors indicates
that although E6 inhibits functions of p53 and causes
hyperplasia,
other genetic events must be required for it to cause
cancer. Mutations
of H-
ras have been implicated casually in the
development of
spontaneous and chemically induced skin tumor.
We therefore assayed for
mutations at H-
ras codons 12, 13, and
61. No mutations were
detected, indicating that H-
ras mutations
are not involved
in E6-induced carcinogenesis. Genomic instability
is thought to be one
of the important events in malignant progression
of tumors. In cell
culture studies, E6 was demonstrated to induce
genomic instability,
including aneuploidy and gene amplification,
and this induction was
ascribed to E6's ability to inactivate
p53 (
36,
50). E6's
ability to induce malignant tumors may
be related to its capacity to
induce genomic instability. We now
are in the process of investigating
whether there are genomic
changes in tumors derived from E6 transgenic
mice.
 |
ACKNOWLEDGMENTS |
We thank Renee Herber for providing plasmid RLH66.2 containing
HPVE6E7ttl, Kathleen Helmuth for technical assistance with microinjection, Amy Liem for assistance with breeding and maintenance of the transgenic lineages, and Jane Weeks, Angie Buehl, and Harlene Edwards for processing tissue sections. We thank Anne Griep for communication of unpublished results and Bill Sugden for critical review of the manuscript.
This study was supported by a grant from the American Cancer Society
(VM164) and by grants from the National Institutes of Health (CA22443
and CA07175).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: McArdle
Laboratory for Cancer Research, University of Wisconsin Medical School,
1400 University Ave., Madison, WI 53706. Phone: (608) 262-8533. Fax: (608) 262-2824. E-mail: Lambert{at}oncology.wisc.edu.
 |
REFERENCES |
| 1.
|
Anwar, K.,
K. Nakakuki,
H. Naiki, and M. Inuzuka.
1993.
ras gene mutations and HPV infection are common in human laryngeal carcinoma.
Int. J. Cancer
53:22-28[Medline].
|
| 2.
|
Arbeit, J. M.,
K. Munger,
P. M. Howley, and D. Hanahan.
1993.
Neuroepithelial carcinomas in mice transgenic with human papillomavirus type 16 E6/E7 ORFs.
Am. J. Pathol.
142:1187-1197[Abstract].
|
| 3.
|
Band, V.,
C. J. De,
L. Delmolino,
V. Kulesa, and R. Sager.
1991.
Loss of p53 protein in human papillomavirus type 16 E6-immortalized human mammary epithelial cells.
J. Virol.
65:6671-6676[Abstract/Free Full Text].
|
| 4.
|
Bedell, M. A.,
K. H. Jones,
S. R. Grossman, and L. A. Laimins.
1989.
Identification of human papillomavirus type 18 transforming genes in immortalized and primary cells.
J. Virol.
63:1247-1255[Abstract/Free Full Text].
|
| 5.
|
Boyer, S. N.,
D. E. Wazer, and V. Band.
1996.
E7 protein of human papilloma virus-16 induces degradation of retinoblastoma protein through the ubiquitin-proteasome pathway.
Cancer Res.
56:4620-4624[Abstract/Free Full Text].
|
| 6.
|
Brown, K.,
A. Buchmann, and A. Balmain.
1990.
Carcinogen-induced mutations in the mouse c-Ha-ras gene provide evidence of multiple pathways for tumor progression.
Proc. Natl. Acad. Sci. USA
87:538-542[Abstract/Free Full Text].
|
| 7.
|
Chakravarti, D.,
J. C. Pelling,
E. L. Cavalieri, and E. G. Rogan.
1995.
Relating aromatic hydrocarbon-induced DNA adducts and c-H-ras mutations in mouse skin papillomas: the role of apurinic sites.
Proc. Natl. Acad. Sci. USA
92:10422-10422[Abstract/Free Full Text].
|
| 8.
|
Chellappan, S.,
V. B. Kraus,
B. Kroger,
K. Munger,
P. M. Howley,
W. C. Phelps, and J. R. Nevins.
1992.
Adenovirus E1A, simian virus 40 tumor antigen, and human papillomavirus E7 protein share the capacity to disrupt the interaction between transcription factor E2F and the retinoblastoma gene product.
Proc. Natl. Acad. Sci. USA
89:4549-4553[Abstract/Free Full Text].
|
| 9.
|
Chen, J. J.,
C. E. Reid,
V. Band, and E. J. Androphy.
1995.
Interaction of papillomavirus E6 oncoproteins with a putative calcium-binding protein.
Science
269:529-531[Abstract/Free Full Text].
|
| 10.
|
Comerford, S. A.,
S. D. Maika,
L. A. Laimins,
A. Messing,
H. P. Elsasser, and R. E. Hammer.
1995.
E6 and E7 expression from the HPV 18 LCR: development of genital hyperplasia and neoplasia in transgenic mice.
Oncogene
10:587-597[Medline].
|
| 11.
|
Das, B. C.,
J. K. Sharma,
V. Gopalkrishna,
D. K. Das,
V. Singh,
L. Gissmann,
H. zur Hausen, and U. K. Luthra.
1992.
A high frequency of human papillomavirus DNA sequences in cervical carcinomas of Indian women as revealed by Southern blot hybridization and polymerase chain reaction.
J. Med. Virol.
36:239-245[Medline].
|
| 12.
|
Davies, R.,
R. Hicks,
T. Crook,
J. Morris, and K. Vousden.
1993.
Human papillomavirus type 16 E7 associates with a histone H1 kinase and with p107 through sequences necessary for transformation.
J. Virol.
67:2521-2528[Abstract/Free Full Text].
|
| 13.
|
DiGiovanni, J.
1992.
Multistage carcinogenesis in mouse skin.
Pharmacol. Ther.
54:63-128[Medline].
|
| 14.
|
Donehower, L. A.,
M. Harvey,
B. L. Slagle,
M. J. McArthur,
C. A. Montgomery, Jr.,
J. S. Butel, and A. Bradley.
1992.
Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours.
Nature
356:215-221[Medline].
|
| 15.
|
Dyson, N.,
P. Guida,
K. Munger, and E. Harlow.
1992.
Homologous sequences in adenovirus E1A and human papillomavirus E7 proteins mediate interaction with the same set of cellular proteins.
J. Virol.
66:6893-6902[Abstract/Free Full Text].
|
| 16.
|
Dyson, N.,
P. M. Howley,
K. Munger, and E. Harlow.
1989.
The human papilloma virus-16 E7 oncoprotein is able to bind to the retinoblastoma gene product.
Science
243:934-937[Abstract/Free Full Text].
|
| 17.
|
Funk, J. O.,
S. Waga,
J. B. Harry,
E. Espling,
B. Stillman, and D. A. Galloway.
1997.
Inhibition of CDK activity and PCNA-dependent DNA replication by p21 is blocked by interaction with the HPV-16 E7 oncoprotein.
Genes Dev.
11:2090-2100[Abstract/Free Full Text].
|
| 18.
|
Gao, Q.,
S. Srinivasan,
S. N. Boyer,
D. E. Wazer, and V. Band.
1999.
The E6 oncoproteins of high-risk papillomaviruses bind to a novel putative GAP protein, E6TP1, and target it for degradation.
Mol. Cell. Biol.
19:733-744[Abstract/Free Full Text].
|
| 19.
|
Greenhalgh, D. A.,
X. J. Wang,
J. A. Rothnagel,
J. N. Eckhardt,
M. I. Quintanilla,
J. L. Barber,
D. S. Bundman,
M. A. Longley,
R. Schlegel, and D. R. Roop.
1994.
Transgenic mice expressing targeted HPV-18 E6 and E7 oncogenes in the epidermis develop verrucous lesions and spontaneous, rasHa-activated papillomas.
Cell Growth Differ.
5:667-675[Abstract].
|
| 20.
|
Griep, A. E.,
R. Herber,
S. Jeon,
J. K. Lohse,
R. R. Dubielzig, and P. F. Lambert.
1993.
Tumorigenicity by human papillomavirus type 16 E6 and E7 in transgenic mice correlates with alterations in epithelial cell growth and differentiation.
J. Virol.
67:1373-1384[Abstract/Free Full Text].
|
| 21.
|
Gulliver, G.,
R. Herber,
A. Liem, and P. F. Lambert.
1997.
Both the CR1 and CR2 domains of human papillomavirus type 16 E7 are required for the induction of epidermal hyperplasia and tumor formation in transgenic mice.
J. Virol.
71:5905-5914[Abstract].
|
| 22.
|
Halbert, C. L.,
G. W. Demers, and D. A. Galloway.
1991.
The E7 gene of human papillomavirus type 16 is sufficient for immortalization of human epithelial cells.
J. Virol.
65:473-478[Abstract/Free Full Text].
|
| 23.
|
Herber, R.,
A. Liem,
H. Pitot, and P. F. Lambert.
1996.
Squamous epithelial hyperplasia and carcinoma in mice transgenic for the human papillomavirus type 16 E7 oncogene.
J. Virol.
70:1873-1881[Abstract].
|
| 24.
|
Hogan, B.,
F. Costantini, and E. Lacy.
1986.
Manipulating the mouse embro: a laboratory manual.
Cold Spring Harbor, Cold Spring Harbor, N.Y.
|
| 25.
|
Jones, D. L.,
R. M. Alani, and K. Munger.
1997.
The human papillomavirus E7 oncoprotein can uncouple cellular differentiation and proliferation in human keratinocytes by abrogating p21Cip1-mediated inhibition of cdk2.
Genes Dev.
11:2101-2111[Abstract/Free Full Text].
|
| 26.
|
Jones, D. L.,
D. A. Thompson, and K. Munger.
1997.
Destabilization of the RB tumor suppressor protein and stabilization of p53 contribute to HPV type 16 E7-induced apoptosis.
Virology
239:97-107[Medline].
|
| 27.
|
Kaur, P., and J. K. McDougall.
1988.
Characterization of primary human keratinocytes transformed by human papillomavirus type 18.
J. Virol.
62:1917-1924[Abstract/Free Full Text].
|
| 28.
|
Kemp, C. J.,
L. A. Donehower,
A. Bradley, and A. Balmain.
1993.
Reduction of p53 gene dosage does not increase initiation or promotion but enhances malignant progression of chemically induced skin tumors.
Cell
74:813-822[Medline].
|
| 29.
|
Kiyono, T.,
A. Hiraiwa,
M. Fujita,
Y. Hayashi,
T. Akiyama, and M. Ishibashi.
1997.
Binding of high-risk human papillomavirus E6 oncoproteins to the human homologue of the Drosophila discs large tumor suppressor protein.
Proc. Natl. Acad. Sci. USA
94:11612-11616[Abstract/Free Full Text].
|
| 30.
|
Klingelhutz, A. J.,
S. A. Foster, and J. K. McDougall.
1996.
Telomerase activation by the E6 gene product of human papillomavirus type 16.
Nature
380:79-82[Medline].
|
| 31.
|
Lee, S. S.,
R. S. Weiss, and R. T. Javier.
1997.
Binding of human virus oncoproteins to hDlg/SAP97, a mammalian homolog of the Drosophila discs large tumor suppressor protein.
Proc. Natl. Acad. Sci. USA
94:6670-6675[Abstract/Free Full Text].
|
| 32.
|
Mangues, R., and A. Pellicer.
1992.
ras activation in experimental carcinogenesis.
Semin. Cancer Biol.
3:229-239[Medline].
|
| 33.
|
Munoz, E. F.,
B. A. Diwan,
R. J. Calvert,
C. M. Weghorst,
J. Anderson,
J. M. Rice, and G. S. Buzard.
1996.
Transplacental mutagenicity of cisplatin: H-ras codon 12 and 13 mutations in skin tumors of SENCAR mice.
Carcinogenesis
17:2741-2745[Abstract/Free Full Text].
|
| 33a.
| Nguyen, M., and A. Griep. Unpublished observations.
|
| 34.
|
Phelps, W. C.,
C. L. Yee,
K. Munger, and P. M. Howley.
1988.
The human papillomavirus type 16 E7 gene encodes transactivation and transformation functions similar to those of adenovirus E1A.
Cell
53:539-547[Medline].
|
| 35.
|
Pirisi, L.,
K. E. Creek,
J. Doniger, and J. A. DiPaolo.
1988.
Continuous cell lines with altered growth and differentiation properties originate after transfection of human keratinocytes with human papillomavirus type 16 DNA.
Carcinogenesis
9:1573-1579[Abstract/Free Full Text].
|
| 36.
|
Reznikoff, C. A.,
C. Belair,
E. Savelieva,
Y. Zhai,
K. Pfeifer,
T. Yeager,
K. J. Thompson,
S. De Vries,
C. Bindley, and M. A. Newton.
1994.
Long-term genome stability and minimal genotypic and phenotypic alterations in HPV16 E7-, but not E6-, immortalized human uroepithelial cells.
Genes Dev.
8:2227-2240[Abstract/Free Full Text].
|
| 37.
|
Rotter, V.,
D. Schwartz,
E. Almon,
N. Goldfinger,
A. Kapon,
A. Meshorer,
L. A. Donehower, and A. J. Levine.
1993.
Mice with reduced levels of p53 protein exhibit the testicular giant-cell degenerative syndrome.
Proc. Natl. Acad. Sci. USA
90:9075-9079[Abstract/Free Full Text].
|
| 38.
|
Sasaki, K.,
O. Bertrand,
H. Nakazawa,
D. J. Fitzgerald,
N. Mironov, and H. Yamasaki.
1995.
Cell-type-specific ras mutations but no microsatellite instability in chemically induced mouse skin tumors and transformed 3T3 cells.
Cancer Res.
55:3513-3516[Abstract/Free Full Text].
|
| 39.
|
Scheffner, M.,
J. M. Huibregtse,
R. D. Vierstra, and P. M. Howley.
1993.
The HPV-16 E6 and E6-AP complex functions as a ubiquitin-protein ligase in the ubiquitination of p53.
Cell
75:495-505[Medline].
|
| 40.
|
Scheffner, M.,
B. A. Werness,
J. M. Huibregtse,
A. J. Levine, and P. M. Howley.
1990.
The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53.
Cell
63:1129-1136[Medline].
|
| 41.
|
Schwarz, E.,
U. K. Freese,
L. Gissmann,
W. Mayer,
B. Roggenbuck,
A. Stremlau, and H. zur Hausen.
1985.
Structure and transcription of human papillomavirus sequences in cervical carcinoma cells.
Nature
314:111-114[Medline].
|
| 42.
|
Sherman, L.,
A. Jackman,
H. Itzhaki,
M. C. Stoppler,
D. Koval, and R. Schlegel.
1997.
Inhibition of serum- and calcium-induced differentiation of human keratinocytes by HPV16 E6 oncoprotein: role of p53 inactivation.
Virology
237:296-306[Medline].
|
| 43.
|
Sherman, L., and R. Schlegel.
1996.
Serum- and calcium-induced differentiation of human keratinocytes is inhibited by the E6 oncoprotein of human papillomavirus type 16.
J. Virol.
70:3269-3279[Abstract].
|
| 44.
|
Snijders, P. J.,
M. van Duin,
J. M. Walboomers,
R. D. Steenbergen,
E. K. Risse,
T. J. Helmerhorst,
R. H. Verheijen, and C. J. Meijer.
1998.
Telomerase activity exclusively in cervical carcinomas and a subset of cervical intraepithelial neoplasia grade III lesions: strong association with elevated messenger RNA levels of its catalytic subunit and high-risk human papillomavirus DNA.
Cancer Res.
58:3812-3818[Abstract/Free Full Text].
|
| 45.
|
Song, S.,
G. A. Gulliver, and P. F. Lambert.
1998.
Human papillomavirus type 16 E6 and E7 oncogenes abrogate radiation-induced DNA damage responses in vivo through p53-dependent and p53-independent pathways.
Proc. Natl. Acad. Sci. USA
95:2290-2295[Abstract/Free Full Text].
|
| 46.
|
Tong, X., and P. M. Howley.
1997.
The bovine papillomavirus E6 oncoprotein interacts with paxillin and disrupts the actin cytoskeleton.
Proc. Natl. Acad. Sci. USA
94:4412-4417[Abstract/Free Full Text].
|
| 47.
|
van den Brule, A. J.,
F. V. Cromme,
P. J. Snijders,
L. Smit,
C. B. Oudejans,
J. P. Baak,
C. J. Meijer, and J. M. Walboomers.
1991.
Nonradioactive RNA in situ hybridization detection of human papillomavirus 16-E7 transcripts in squamous cell carcinomas of the uterine cervix using confocal laser scan microscopy.
Am. J. Pathol.
139:1037-1045[Abstract].
|
| 48.
|
Weinberg, W. C.,
C. G. Azzoli,
K. Chapman,
A. J. Levine, and S. H. Yuspa.
1995.
p53-mediated transcriptional activity increases in differentiating epidermal keratinocytes in association with decreased p53 protein.
Oncogene
10:2271-2279[Medline].
|
| 49.
|
Werness, B. A.,
A. J. Levine, and P. M. Howley.
1990.
Association of human papillomavirus types 16 and 18 E6 proteins with p53.
Science
248:76-79[Abstract/Free Full Text].
|
| 50.
|
White, A. E.,
E. M. Livanos, and T. D. Tlsty.
1994.
Differential disruption of genomic integrity and cell cycle regulation in normal human fibroblasts by the HPV oncoproteins.
Genes Dev.
8:666-677[Abstract/Free Full Text].
|
| 51.
|
Woodworth, C. D.,
P. E. Bowden,
J. Doniger,
L. Pirisi,
W. Barnes,
W. D. Lancaster, and J. A. DiPaolo.
1988.
Characterization of normal human exocervical epithelial cells immortalized in vitro by papillomavirus types 16 and 18 DNA.
Cancer Res.
48:4620-4628[Abstract/Free Full Text].
|
| 52.
|
Woodworth, C. D.,
J. Doniger, and J. A. DiPaolo.
1989.
Immortalization of human foreskin keratinocytes by various human papillomavirus DNAs corresponds to their association with cervical carcinoma.
J. Virol.
63:159-164[Abstract/Free Full Text].
|
| 53.
|
Yee, C.,
H. I. Krishnan,
C. C. Baker,
R. Schlegel, and P. M. Howley.
1985.
Presence and expression of human papillomavirus sequences in human cervical carcinoma cell lines.
Am. J. Pathol.
119:361-366[Abstract].
|
| 54.
|
Zerfass-Thome, K.,
W. Zwerschke,
B. Mannhardt,
R. Tindle,
J. W. Botz, and P. Jansen-Durr.
1996.
Inactivation of the cdk inhibitor p27KIP1 by the human papillomavirus type 16 E7 oncoprotein.
Oncogene
13:2323-2330[Medline].
|
| 55.
|
zur Hausen, H.
1996.
Papillomavirus infections a major cause of human cancers.
Biochim. Biophys. Acta
1288:F55-F78[Medline].
|
Journal of Virology, July 1999, p. 5887-5893, Vol. 73, No. 7
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Chung, S.-H., Wiedmeyer, K., Shai, A., Korach, K. S., Lambert, P. F.
(2008). Requirement for Estrogen Receptor {alpha} in a Mouse Model for Human Papillomavirus-Associated Cervical Cancer. Cancer Res.
68: 9928-9934
[Abstract]
[Full Text]
-
Shai, A., Pitot, H. C., Lambert, P. F.
(2008). p53 Loss Synergizes with Estrogen and Papillomaviral Oncogenes to Induce Cervical and Breast Cancers. Cancer Res.
68: 2622-2631
[Abstract]
[Full Text]
-
Strati, K., Lambert, P. F.
(2007). Role of Rb-Dependent and Rb-Independent Functions of Papillomavirus E7 Oncogene in Head and Neck Cancer. Cancer Res.
67: 11585-11593
[Abstract]
[Full Text]
-
Cheng, Y.-W., Wu, M.-F., Wang, J., Yeh, K.-T., Goan, Y.-G., Chiou, H.-L., Chen, C.-Y., Lee, H.
(2007). Human Papillomavirus 16/18 E6 Oncoprotein Is Expressed in Lung Cancer and Related with p53 Inactivation. Cancer Res.
67: 10686-10693
[Abstract]
[Full Text]
-
Maufort, J. P., Genther Williams, S. M., Pitot, H. C., Lambert, P. F.
(2007). Human Papillomavirus 16 E5 Oncogene Contributes to Two Stages of Skin Carcinogenesis. Cancer Res.
67: 6106-6112
[Abstract]
[Full Text]
-
Hoover, A. C., Spanos, W. C., Harris, G. F., Anderson, M. E., Klingelhutz, A. J., Lee, J. H.
(2007). The Role of Human Papillomavirus 16 E6 in Anchorage-Independent and Invasive Growth of Mouse Tonsil Epithelium. Arch Otolaryngol Head Neck Surg
133: 495-502
[Abstract]
[Full Text]
-
Storrs, C. H., Silverstein, S. J.
(2007). PATJ, a Tight Junction-Associated PDZ Protein, Is a Novel Degradation Target of High-Risk Human Papillomavirus E6 and the Alternatively Spliced Isoform 18 E6. J. Virol.
81: 4080-4090
[Abstract]
[Full Text]
-
Shai, A., Brake, T., Somoza, C., Lambert, P. F.
(2007). The Human Papillomavirus E6 Oncogene Dysregulates the Cell Cycle and Contributes to Cervical Carcinogenesis through Two Independent Activities. Cancer Res.
67: 1626-1635
[Abstract]
[Full Text]
-
Strati, K., Pitot, H. C., Lambert, P. F.
(2006). Identification of biomarkers that distinguish human papillomavirus (HPV)-positive versus HPV-negative head and neck cancers in a mouse model. Proc. Natl. Acad. Sci. USA
103: 14152-14157
[Abstract]
[Full Text]
-
Dong, W., Kloz, U., Accardi, R., Caldeira, S., Tong, W.-M., Wang, Z.-Q., Jansen, L., Durst, M., Sylla, B. S., Gissmann, L., Tommasino, M.
(2005). Skin Hyperproliferation and Susceptibility to Chemical Carcinogenesis in Transgenic Mice Expressing E6 and E7 of Human Papillomavirus Type 38. J. Virol.
79: 14899-14908
[Abstract]
[Full Text]
-
Nakahara, T., Peh, W. L., Doorbar, J., Lee, D., Lambert, P. F.
(2005). Human Papillomavirus Type 16 E1{wedge}E4 Contributes to Multiple Facets of the Papillomavirus Life Cycle. J. Virol.
79: 13150-13165
[Abstract]
[Full Text]
-
Simonson, S. J.S., Difilippantonio, M. J., Lambert, P. F.
(2005). Two Distinct Activities Contribute to Human Papillomavirus 16 E6's Oncogenic Potential. Cancer Res.
65: 8266-8273
[Abstract]
[Full Text]
-
Genther Williams, S. M., Disbrow, G. L., Schlegel, R., Lee, D., Threadgill, D. W., Lambert, P. F.
(2005). Requirement of Epidermal Growth Factor Receptor for Hyperplasia Induced by E5, a High-Risk Human Papillomavirus Oncogene. Cancer Res.
65: 6534-6542
[Abstract]
[Full Text]
-
Lagrange, M., Charbonnier, S., Orfanoudakis, G., Robinson, P., Zanier, K., Masson, M., Lutz, Y., Trave, G., Weiss, E., Deryckere, F.
(2005). Binding of human papillomavirus 16 E6 to p53 and E6AP is impaired by monoclonal antibodies directed against the second zinc-binding domain of E6. J. Gen. Virol.
86: 1001-1007
[Abstract]
[Full Text]
-
Liu, X., Yuan, H., Fu, B., Disbrow, G. L., Apolinario, T., Tomaic, V., Kelley, M. L., Baker, C. C., Huibregtse, J., Schlegel, R.
(2005). The E6AP Ubiquitin Ligase Is Required for Transactivation of the hTERT Promoter by the Human Papillomavirus E6 Oncoprotein. J. Biol. Chem.
280: 10807-10816
[Abstract]
[Full Text]
-
Brake, T., Lambert, P. F.
(2005). Estrogen contributes to the onset, persistence, and malignant progression of cervical cancer in a human papillomavirus-transgenic mouse model. Proc. Natl. Acad. Sci. USA
102: 2490-2495
[Abstract]
[Full Text]
-
Malanchi, I., Accardi, R., Diehl, F., Smet, A., Androphy, E., Hoheisel, J., Tommasino, M.
(2004). Human Papillomavirus Type 16 E6 Promotes Retinoblastoma Protein Phosphorylation and Cell Cycle Progression. J. Virol.
78: 13769-13778
[Abstract]
[Full Text]
-
Lu, Z., Hu, X., Li, Y., Zheng, L., Zhou, Y., Jiang, H., Ning, T., Basang, Z., Zhang, C., Ke, Y.
(2004). Human Papillomavirus 16 E6 Oncoprotein Interferences with Insulin Signaling Pathway by Binding to Tuberin. J. Biol. Chem.
279: 35664-35670
[Abstract]
[Full Text]
-
Chakrabarti, O., Veeraraghavalu, K., Tergaonkar, V., Liu, Y., Androphy, E. J., Stanley, M. A., Krishna, S.
(2004). Human Papillomavirus Type 16 E6 Amino Acid 83 Variants Enhance E6-Mediated MAPK Signaling and Differentially Regulate Tumorigenesis by Notch Signaling and Oncogenic Ras. J. Virol.
78: 5934-5945
[Abstract]
[Full Text]
-
Helfrich, I., Chen, M., Schmidt, R., Furstenberger, G., Kopp-Schneider, A., Trick, D., Grone, H.-J., zur Hausen, H., Rosl, F.
(2004). Increased Incidence of Squamous Cell Carcinomas in Mastomys natalensis Papillomavirus E6 Transgenic Mice during Two-Stage Skin Carcinogenesis. J. Virol.
78: 4797-4805
[Abstract]
[Full Text]
-
Schaeffer, A. J., Nguyen, M., Liem, A., Lee, D., Montagna, C., Lambert, P. F., Ried, T., Difilippantonio, M. J.
(2004). E6 and E7 Oncoproteins Induce Distinct Patterns of Chromosomal Aneuploidy in Skin Tumors from Transgenic Mice. Cancer Res.
64: 538-546
[Abstract]
[Full Text]
-
Nguyen, M. M., Nguyen, M. L., Caruana, G., Bernstein, A., Lambert, P. F., Griep, A. E.
(2003). Requirement of PDZ-Containing Proteins for Cell Cycle Regulation and Differentiation in the Mouse Lens Epithelium. Mol. Cell. Biol.
23: 8970-8981
[Abstract]
[Full Text]
-
Watson, R. A., Thomas, M., Banks, L., Roberts, S.
(2003). Activity of the human papillomavirus E6 PDZ-binding motif correlates with an enhanced morphological transformation of immortalized human keratinocytes. J. Cell Sci.
116: 4925-4934
[Abstract]
[Full Text]
-
Brake, T., Connor, J. P., Petereit, D. G., Lambert, P. F.
(2003). Comparative Analysis of Cervical Cancer in Women and in a Human Papillomavirus-Transgenic Mouse Model: Identification of Minichromosome Maintenance Protein 7 as an Informative Biomarker for Human Cervical Cancer. Cancer Res.
63: 8173-8180
[Abstract]
[Full Text]
-
Riley, R. R., Duensing, S., Brake, T., Munger, K., Lambert, P. F., Arbeit, J. M.
(2003). Dissection of Human Papillomavirus E6 and E7 Function in Transgenic Mouse Models of Cervical Carcinogenesis. Cancer Res.
63: 4862-4871
[Abstract]
[Full Text]
-
Nguyen, M. L., Nguyen, M. M., Lee, D., Griep, A. E., Lambert, P. F.
(2003). The PDZ Ligand Domain of the Human Papillomavirus Type 16 E6 Protein Is Required for E6's Induction of Epithelial Hyperplasia In Vivo. J. Virol.
77: 6957-6964
[Abstract]
[Full Text]
-
Genther, S. M., Sterling, S., Duensing, S., Munger, K., Sattler, C., Lambert, P. F.
(2003). Quantitative Role of the Human Papillomavirus Type 16 E5 Gene during the Productive Stage of the Viral Life Cycle. J. Virol.
77: 2832-2842
[Abstract]
[Full Text]
-
Wong, M., Pagano, J. S., Schiller, J. T., Tevethia, S. S., Raab-Traub, N., Gruber, J.
(2002). New Associations of Human Papillomavirus, Simian Virus 40, and Epstein-Barr Virus with Human Cancer. JNCI J Natl Cancer Inst
94: 1832-1836
[Full Text]
-
Nguyen, M., Song, S., Liem, A., Androphy, E., Liu, Y., Lambert, P. F.
(2002). A Mutant of Human Papillomavirus Type 16 E6 Deficient in Binding {alpha}-Helix Partners Displays Reduced Oncogenic Potential In Vivo. J. Virol.
76: 13039-13048
[Abstract]
[Full Text]
-
Watson, R. A., Rollason, T. P., Reynolds, G. M., Murray, P. G., Banks, L., Roberts, S.
(2002). Changes in expression of the human homologue of the Drosophila discs large tumour suppressor protein in high-grade premalignant cervical neoplasias. Carcinogenesis
23: 1791-1796
[Abstract]
[Full Text]
-
Nakagawa, S., Huibregtse, J. M.
(2000). Human Scribble (Vartul) Is Targeted for Ubiquitin-Mediated Degradation by the High-Risk Papillomavirus E6 Proteins and the E6AP Ubiquitin-Protein Ligase. Mol. Cell. Biol.
20: 8244-8253
[Abstract]
[Full Text]
-
Lee, S. S., Glaunsinger, B., Mantovani, F., Banks, L., Javier, R. T.
(2000). Multi-PDZ Domain Protein MUPP1 Is a Cellular Target for both Adenovirus E4-ORF1 and High-Risk Papillomavirus Type 18 E6 Oncoproteins. J. Virol.
74: 9680-9693
[Abstract]
[Full Text]
-
Kao, W. H., Beaudenon, S. L., Talis, A. L., Huibregtse, J. M., Howley, P. M.
(2000). Human Papillomavirus Type 16 E6 Induces Self-Ubiquitination of the E6AP Ubiquitin-Protein Ligase. J. Virol.
74: 6408-6417
[Abstract]
[Full Text]
-
Flores, E. R., Allen-Hoffmann, B. L., Lee, D., Lambert, P. F.
(2000). The Human Papillomavirus Type 16 E7 Oncogene Is Required for the Productive Stage of the Viral Life Cycle. J. Virol.
74: 6622-6631
[Abstract]
[Full Text]
-
Hu, X., Pang, T., Asplund, A., Ponten, J., Nister, M.
(2002). Clonality Analysis of Synchronous Lesions of Cervical Carcinoma Based on X Chromosome Inactivation Polymorphism, Human Papillomavirus Type 16 Genome Mutations, and Loss of Heterozygosity. JEM
195: 845-854
[Abstract]
[Full Text]