Previous Article | Next Article 
Journal of Virology, July 1999, p. 5757-5766, Vol. 73, No. 7
Departments of Immunology and Molecular
Biology, Division of Virology, The Scripps Research Institute, La
Jolla, California 92037,2 and The
R. W. Johnson Pharmaceutical Research Institute, San Diego,
California 921211
Received 28 December 1998/Accepted 9 April 1999
We describe, for the first time, the generation of a viral DNA chip
for simultaneous expression measurements of nearly all known open
reading frames (ORFs) in the largest member of the herpesvirus family,
human cytomegalovirus (HCMV). In this study, an HCMV chip was
fabricated and used to characterize the temporal class of viral gene
expression. The viral chip is composed of microarrays of viral DNA
prepared by robotic deposition of oligonucleotides on glass for ORFs in
the HCMV genome. Viral gene expression was monitored by hybridization
to the oligonucleotide microarrays with fluorescently labelled cDNAs
prepared from mock-infected or infected human foreskin fibroblast
cells. By using cycloheximide and ganciclovir to block de novo viral
protein synthesis and viral DNA replication, respectively, the kinetic
classes of array elements were classified. The expression profiles of
known ORFs and many previously uncharacterized ORFs provided a temporal
map of immediate-early ( Human cytomegalovirus (HCMV) has one
of the largest known viral genomes, with a complexity that approximates
0.25 Mb of double-stranded DNA. The complete genome sequence of the
AD169 laboratory strain of HCMV was made available in 1990 (4). Analysis of this sequence and of related laboratory and
clinical strains for potential protein-coding content has revealed at
least 226 distinct open reading frames (ORFs) (3, 4, 23). To
date, expression analysis of the HCMV genome has resulted in the
characterization of approximately 30% of the genome (reviewed in
reference 22 and Table 1).
The expression of HCMV genes upon infection is temporally regulated.
The first genes expressed (immediate-early [IE or Recently, DNA chips have been constructed and used to measure
genome-wide expression levels of genes in plants, bacteria, yeast, and
human cells (6, 25, 27, 28 and references therein).
Of these methods, DNA microarrays, consisting of individual ORF
sequences printed in a miniaturized format on glass, is a relatively
simple but powerful tool for studying gene expression on a large scale
(28). Here, we report on the construction of a viral DNA
chip for HCMV. These fabricated microarrays of viral DNA allow, in a
single hybridization, the analysis of gene expression for many of the
predicted HCMV ORFs. In the present study we have applied this
technique to examine the temporal transcription program of HCMV gene
expression. HCMV array elements that displayed differential patterns of
viral gene expression and were thus classified in different kinetic
classes were characterized. This study therefore provides a more
complete analysis of the transcription program of HCMV.
(Part of these results were presented at the 7th International
Cytomegalovirus Workshop in Brighton, United Kingdom,
28 April to 1 May 1999.)
Selection and synthesis of oligonucleotides for DNA
microarrays.
The complete set of ORFs from the HCMV genome was
analyzed with a custom sequence analysis program that selected a
75-base sequence to be used as a microarray deposition target. The
analysis preferentially selects unique sequences with a 3' gene bias
and a G-C content of 40 to 60% and rejects sequences that contain homopolymeric stretches and potential hairpin structures. The 3' gene
bias is preferred, as fluorescently labelled cDNA prepared for
hybridization is generated by using oligo(dT) to prime poly(A) tails of
mRNA. The selected target sequences were synthesized by using a PE
Perseptive BioSystem (Framingham, Mass.) Expedite MOSS DNA synthesizer
with membrane columns. Synthesized gene target oligonucleotides were
cleaved, deprotected, and purified by standard procedures. Target
oligonucleotides were transferred in triplicate to 96-well master
plates at a concentration of 1 µg/µl (in 3× SSC [1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate]) for robotic deposition. The
sequence of oligonucleotides comprising the deposited HCMV ORF
microarray is shown in Fig. 1. The small
ORF UL48/49 (8) and the UL74 ORF described by Huber and
Compton (13) were not included in the present chip design.
Also shown in Fig. 1 is a subset of cellular genes that were included
as internal controls for normalization between chips, as follows:
elongation factor 1-alpha (accession no. M29548), human acidic
ribosomal phosphoprotein (RiboPO; accession no. M17885), alpha tubulin (accession no. K00558), glyceraldehyde-3-phosphate dehydrogenase (GAPDH; accession no. J04038), retinoic acid receptor (RARa1; accession
no. X06614), and CAAT box DNA binding protein (NFY; accession no.
X59711). Two plant homeobox genes, HAT 1 (accession no. UO9332) and HAT
4 (accession no. Z19602) were deposited as further specificity
controls.
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
DNA Microarrays of the Complex Human
Cytomegalovirus Genome: Profiling Kinetic Class with Drug Sensitivity
of Viral Gene Expression
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
), early (
), early-late (
1), and late
(2) genes in the entire genome of HCMV. Sequence compositional
analysis of the 5' noncoding DNA sequences of the temporal classes,
performed by using algorithms that automatically search for defined and
recurring motifs in unaligned sequences, indicated the presence of
potential regulatory motifs for , 1, and 2 genes. In summary,
these fabricated microarrays of viral DNA allow rapid and parallel
analysis of gene expression at the whole viral genome level. The viral
chip approach coupled with global biochemical and genetic strategies
should greatly speed the functional analysis of established as well as
newly discovered large viral genomes.
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
] genes) are
independent of any viral de novo protein synthesis and encode mostly
regulatory trans-acting factors. The next set of genes
expressed (early [E or ] genes) requires the presence of the viral
IE proteins and contributes an essential source of factors, including
viral DNA replication, repair enzymes, and other nonstructural
proteins, such as those that serve in immune evasion. Late (L or )
genes are essentially expressed after the onset of viral DNA
replication and contribute primarily to assembly and morphogenesis of
the virion. Thus, the time of viral gene expression during infection is
an important clue to its functional role. Systematic approaches that
permit high throughput evaluation of specific ORF expression would
greatly assist efforts to elucidate viral gene function of highly
complex viruses, such as CMV, on a genome-wide scale. Historically,
prominent regions of HCMV IE, E, and L gene expression were initially
identified by hybridization to genomic subfragments, and therefore
these early studies provided a first analysis of the HCMV transcription
program (5, 19, 31, 34, 36).
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
View larger version (102K):
[in a new window]
FIG. 1.
Oligonucleotides used in the microarray deposition.
Generation of microarrays, hybridization, and scanning. The preparation of coated glass slides and the subsequent deposition printing of DNA was carried out in a manner similar to that described previously (28). Briefly, a custom-made microarrayer was built by using a Galil (Mountain View, Calif.) DMC1030-18 motion controller. The motion control signals were used to control NEMA 23 sized DC servo motors which drove Parker Dadeal (Harrison City, Pa.) 500,000 ET series linear stage with optical encoder feedback. The array table held up to 40 slides and one titer tray of source DNA targets for spotting. The custom-designed spotting tip was based on the concept of a rod with a closed tweezer tip manufactured to fit into a standard 384-well plate. The spotting tips were washed in a custom-built wash-and-vacuum station before each round of spotting. The entire spotting assembly was placed under a custom-made acrylic enclosure with a class 100 HEPA filter (Envirco, Albuquerque, N. Mex.).
The HCMV chips used in this study were prepared by using a single-tip format. The microarrayer tip delivered approximately 4 nl per spot on prescreened silylated aldehyde-coated glass slides (CEL Associates, Houston, Tex.). Viral microarrays were hybridized for 4 h under coverslips with a Cy3-dCTP (Amersham)-labelled cDNA probe. The entire assembly was enclosed in a custom-made hybridization chamber. After hybridization, the microarray slide assembly was washed and dried. Microarrays were subsequently scanned by using a confocal laser ScanArray 3000 (General Scanning Inc.) system. Data were collected at a maximum resolution of 10 µm/pixel with 16 bits of depth by using ImaGene software (BioDiscovery Inc.).Virus and cells. Human foreskin fibroblasts (HFF) were grown in Dulbecco's modified essential medium supplemented with 2 mM glutamine, 100 U of penicillin per ml, 100 µg of gentamicin, and 10% fetal bovine serum. The Towne strain of HCMV was used for all the experiments.
Viral infections, probe preparation, and labelling. HFF were mock infected or infected with HCMV at a multiplicity of 5 PFU/cell. To assess IE transcription, cultures were treated with cycloheximide (100 µg/ml) 1 h before infection, and whole-cell RNA was harvested 13 h postinfection. For early transcription, ganciclovir (100 µM) was added at the time of virus infection for 72 h prior to total RNA isolation. Under these conditions, ganciclovir reduces virus yield by greater than 99% (2). For late RNA isolation, whole-cell RNA was harvested from cultures 72 h after infection. Mock-infected cells were treated with cycloheximide or ganciclovir for the same period of time as infected HFF cultures were. Total RNA was isolated from mock-infected and infected cells by using the RNAzol B method (Tel-Test, Inc.; Friendswood, Tex.) according to the manufacturer's protocol. RNAs were passed through an RNAeasy Qiagen column after DNase I treatment, and cDNA probes were synthesized. Fluorescently labelled cDNA was prepared from RNA by oligo(dT)-primed polymerization by using superscript II reverse transcriptase. The pool of nucleotides in the labelling reaction consisted of 0.5 mM dGTP, dATP, and dTTP and 0.04 mM dCTP and fluorescent nucleotide Cy3-dCTP (Amersham) at 0.04 mM. Probes were purified by using the Qiaquick PCR purification kit (Qiagen) and ethanol precipitation.
Statistical analysis. Quantitated hybridization levels were normalized so that the 75th percentiles of the cellular gene expression levels were equal across chips. HCMV gene expression was determined by comparing normalized values between mock-infected control chips and infected chips by using a Wilcoxon-Mann-Whitney test (12).
Northern blot analysis.
Total RNA, 14 µg per lane, was
separated by electrophoresis on a 1% agarose gel containing 2.2 M
formaldehyde, transferred onto a nylon membrane (Hybond-N; Amersham),
immobilized by UV cross-linking (Stratagene, La Jolla, Calif.), and
hybridized with 32P-labelled probes. The probes for UL110
and US35 were composed of PCR-generated fragments. Primers used to
amplify a 451-bp fragment from pCM1050 (7), a cosmid
containing the UL110 gene, were 18087 (5'CATCAATCATCGTAGTGACGTC3')
and 18088 (5'GCCTATTGATAATAATCTACCCC3'). Primers used
to amplify a 211-bp fragment from pCM1035 (7), a cosmid
containing the US35 gene, were 18119 (5'GTACCGTTGTACGCATTACAC3') and 18120 (5'GACGAAGATGCCGATGTGTGAC3'). The resulting
PCR fragments were isolated from agarose gels and then radiolabelled
with [-32P]dATP by the random-primed labelling method
(Boehringer, Mannheim, Germany) according to the manufacturer's
protocol. For TRL8-IRL8, TRL9-IRL9, UL15, UL31, UL48, UL66, and UL73,
the corresponding oligonucleotides shown in Fig. 1 were used as probes,
after being [-32P]ATP end labelled with polynucleotide
kinase (Stratagene). Oligonucleotide probes were hybridized to the
filters for 1 h at 45°C by using Quick Hybridization solutions
(Stratagene) under conditions recommended by the manufacturer.
PCR-generated probes were hybridized with the filters for 12 h at
65°C in 1× Denhardt's solution, 6× SSC, and 100 µg of denatured
salmon sperm DNA/ml. Filters were washed to a stringency of 0.1%
sodium dodecyl sulfate (SDS) at 60°C or 1% SDS at 42°C depending
whether PCR-generated DNA fragments or oligonucleotides, respectively,
were used during the hybridization. Hybridization signals were
quantitated by using a Molecular Dynamics PhosphorImager system with
ImageQuant software.
MEME analysis of the upstream noncoding DNA sequences. The computer program Multiple EM for Motif Elicitation (MEME) was used to search for sequence motifs in 500 bp of noncoding sequences upstream of the initiation codon. MEME analysis was performed by using the sequence of strain AD169 of HCMV. The 5' noncoding regions were categorized according to class of expression as follows: E (TRL4-IRL4, UL104-5, UL11, UL112, UL124, UL13, UL16-7, UL24, UL26-7, UL35, UL4-5, UL45, UL53-7, UL77-9, US8-14, US16-7, US19, US23-4, US26, US28, and US30), early-late (E-L) (TRL-IRL6, TRL-IRL10, TRL-IRL12, TRL-IRL13, UL1, UL106, UL130, UL40, UL44, UL46-7, UL49, UL72, UL83-5, UL95-8, US6-7, and US29), and L (TRL-IRL8, TRL-IRL11, TRL-IRL14, UL100, UL103, UL111A, UL117, UL119, UL131, UL14, UL18, UL2-3, UL7, UL9, UL25, UL29, UL32-3, UL43, UL48, UL52, UL59, UL67, UL73, UL80, UL82, UL91-3, UL99, US18, and US27). By using MEME, 30 motifs (10 of 8 bases in length, 10 of 10 bases in length or longer, and 10 of 12 bases in length or longer) were derived from each gene set. The distribution of the combined 90 patterns was identified, allowing for 10% mismatch. MEME is available on the World Wide Web (20a). The resulting motifs that developed a significant polarized distribution pattern are summarized in Table 2. In addition, the transcription factor database (TFD) was used to search for known regulatory sequences. The TFD was downloaded from the National Center for Biotechnology Information.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Viral microarray (chip) of the HCMV genome. Microarray technology provides an excellent method by which nucleic acids can be attached to a solid surface in a highly dense format. Given that the HCMV genome consists of ~200 ORFs, the entire set of potential genes can be easily arrayed in a small area. With this capability and the availability of the complete sequence of HCMV, our strategy was to use a directed approach for generating the viral genome array. This procedure involved synthesizing a 75-base oligonucleotide corresponding to the sense strand of each ORF. The length of this deposition element provides a more efficient target for specific hybridization than does a 25-base oligonucleotide and therefore affords greater sensitivity. For these experiments, almost all ORFs present in the AD169 laboratory strain of HCMV and four ORFs from the Towne strain (UL147 and UL152-4) were selected for deposition. In addition, a set of cellular genes (see Materials and Methods for details; Fig. 1) and two plant genes were included as controls. The generation of sense-strand oligonucleotides as deposition elements has the advantage of the assignation of polarity of transcription. In the present study, the target oligonucleotide representing the ORF of interest was arrayed in triplicate on glass slides. Three independent experiments were performed for each experimental data point. The viral arrays were less than 1 cm2 and contained approximately 1,000 elements, at a spacing of ~350 µm. This spacing allows the hybridization volumes to be minimized (15 µl); thus, 2 µg of total RNA (from cells infected at a multiplicity of infection [MOI] of 5) is sufficient for analysis, and subsequent amplification steps are unnecessary.
Gene expression analysis by CMV microarrays. In this study, the viral microarrays were used to delineate kinetic class by examination of the drug sensitivity of viral gene expression. The infection of permissive cells with HCMV in the presence of an inhibitor of protein synthesis leads to the specific accumulation of viral IE RNA. The IE genes of HCMV are well characterized, and therefore a comparison with the results from the viral microarray hybridization is a good first test of the accuracy of the chip. Previously, it has been shown that viral IE RNA arises from only a few distinct regions of the genome and, on the basis of their levels of expression, can be classified into two groups. The major IE genes, referred to as IE1 (UL123) and IE2 (UL122), are transcribed and expressed at relatively high levels. The other class of genes, including primarily the US3, TRS1-IRS1, and UL36-38 loci, is expressed at lower relative levels (reviewed in reference 22).
Accordingly, we used cycloheximide as an inhibitor of protein synthesis to investigate IE transcription of HCMV. For these experiments, primary HFF cells were pretreated for 1 h with 100 µg of cycloheximide/ml and subsequently mock infected or infected with HCMV (Towne strain) at an MOI of 5. RNA was isolated in five independent experiments, converted to fluorescently labelled cDNA, and hybridized to the HCMV chips. Fluorescence intensities were normalized by using a set of cellular genes. An absolute fluorescent signal whose intensity was greater than that observed over the mock-infected control microarray element was considered to represent specific viral hybridization. Figure 2 (top panel) shows a scatterplot of these results, with the points above the line of equivalence indicating expression. Conservatively, viral gene-specific hybridization was considered significantly different between mock-infected and infected samples only if the following two criteria were met: (i) the median level of intensity in the infected samples was at least threefold greater than that in the mock-infected samples, and (ii) a nonparametric test for an increase in level of intensity under conditions of virus infection versus mock infection was significant at a P value of <0.05. On the basis of these criteria, four viral ORFs, as follows, were specifically detected at IE: US3, UL122, UL123, and UL110. The UL36-38, TRS1-IRS1 ORFs all showed ratios of approximately 2, with P values of less than 0.05, and thus while they showed a statistically significant increase, were not scored as such under these selection conditions. It is noteworthy that only two other ORFs (UL111A and US8) exhibited twofold ratios. In the case of the UL110 ORF, the results of Northern analysis corroborated the IE gene expression identified by the microarray hybridization (Fig. 4). By the Northern analysis, a 5-kb transcript was detected that corresponds to a previously characterized IE transcript reported from this region (15). As a whole, these analyses show that while the CMV chip does not score positive for all known IE genes, no false-positive signals were detected. The false-negative results are likely due to poor design of the target probe and/or related to level of sensitivity for the detection of low-abundance transcripts. Nevertheless, these experiments clearly demonstrate an efficacious approach for the stringent detection of viral-specific RNA species and thereby validate the microarray hybridization assay.
|
|
|
|
Examining upstream noncoding DNA sequence of HCMV E, E-L, and L
genes.
The above experiments designate the kinetic class of
expression of more than 150 ORFs, most of which have not been
previously characterized. To date, little is known about how the
kinetics of HCMV gene expression are controlled, in part because thus
far, relatively few genes have been studied. Relatedly, the regulation of DNA-virus gene expression involves the interaction of host-encoded and viral proteins with discrete elements (DNA or RNA) in the 5'-end
region of the gene. Therefore, to gain further insight into the
regulation of the kinetics of HCMV gene expression, we examined a set
of upstream DNA sequences corresponding to 40 E, 27 E-L, and 36 L ORFs
that contain an initiation codon. The rationale for examining this set
of upstream regions was that perhaps, as in some viral systems
(24), a single regulatory motif may act either as a negative
or a positive regulator of gene expression, depending on its kinetic
class. The upstream DNA sequence corresponding to each ORF was bounded
at the 3' end by the ORF's translation start. The 5' end of the
upstream region was designated as being 500 bp from the translation
start. This choice of the upstream-region boundaries was justified, as
most genes have control elements that lie between 0 and 500 bp upstream
of the translation start. In the present study, we used the MEME
algorithm (one of several algorithms developed for discovering
recurring motifs in unaligned sequences) to search for common motifs
within a given kinetic class (see Materials and Methods for details).
The results of this analysis, summarized in Table
2, indicate no readily apparent single,
dominant element unique to a kinetic class. However, a subset of E,
E-L, and L promoter regions have in common conserved sequence motifs of
about 8 to 12 bp in length. For example, 25 and 11% of E and E-L
promoter regions, respectively, contain the sequence pattern
ACGACGTCGG, which harbors a core ATF recognition site (underlined sequence) (Table 2). By contrast, the palindromic sequence pattern CCGCGGGCGCGG is present in 17% of L
promoters alone and does not match any known transcription factor
binding site (Table 2). The upstream noncoding regions were further
analyzed for the presence of binding sites common to known
transcription factors by using the TFD. In general, L promoters
contained fewer binding sites to known transcription factors than did
promoters in the E and E-L expression classes (data not shown). This
observation may correlate with a reduction in the complexity of the
transcriptional control regions associated with the L expression class.
Overall, we conclude that HCMV kinetic classes of promoters may be
characterized not by discrete consensus sequence motifs but, instead,
by common subsets of related sites, indicating more-elaborate
regulatory pathways.
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
This study evaluates a novel approach for profiling the gene expression of large DNA viruses. By applying DNA chip technology, which has been successfully used with a number of microorganisms (references 27 and 28 and references therein) to monitor genome-wide transcription, we were able to specifically detect HCMV-expressed messages in the context of abundant cellular RNAs by using oligonucleotides corresponding to each ORF of the HCMV genome. The obvious advantage this system has over traditional methods is the speed with which global changes in CMV transcription can be simultaneously monitored. These fabricated DNA microarrays greatly extend and complement existing RNA transcript-mapping procedures, such as Northern analysis, slot blot, reverse transcription-PCR, primer extension, and nuclease protection-based methods.
In this study we were able to detect, in parallel, the expression of a total of 151 HCMV ORFs. A comparison of the results we obtained by viral microarray hybridization with previously reported results provided a good test for the sensitivity and accuracy of the chip approach. The expression patterns we observed by chip analysis for previously characterized genes showed almost-perfect concordance with results published earlier. In addition, we further characterized by Northern analysis TRS8-IRS8, TRS9-IRS9, UL15, UL31, UL48, UL68, and UL73 expression patterns. In each case tested, there was complete agreement with the chip analysis. Overall, the HCMV chip proved to be a reliable and robust assay, as the false-negative rate was low (~10%), providing confidence in the reliability of the analysis determined in this study. The rate of false-negative results can be decreased in the future by selecting different oligonucleotides or by using PCR fragments for deposition. It is important that the microarray approach for defining the kinetic class of gene expression has limitations in distinguishing overlapping viral messages that may be under the control of multiple promoter elements, allowing the assignation of expression to more than one kinetic class (e.g., UL102 and US18). In this case, the false-positive rate (<15%) was primarily due to overlapping transcription units. The present analysis probably underestimates the full expression profile of HCMV, since we measured only predicted ORFs, and some of the viral ORF array DNAs may not be optimal (e.g., UL66, US2, and UL99). More-detailed RNA-mapping experiments will be required to fully characterize the program of HCMV transcription.
Identification and characterization of regulatory sequences are critical to elucidating global mechanisms of transcriptional regulation. The distribution of ORFs to a specific expression class was used to search for regulatory motifs possibly associated with a set of coregulated genes. Automatic alignments obtained by using MEME algorithms of the upstream noncoding DNA sequences of many of the coregulated ORFs did not readily identify a unique class-specific consensus sequence motif. However, a subset of E, E-L, and L genes was found to contain a conserved sequence motif, indicating redundancy in the use of specific elements or perhaps a more complex regulatory hierarchy. Further investigation will be required to assess the role of the regulatory sequences suggested by these experiments.
The position and pairwise polarity of genes may strongly influence their transcription, especially in viral genomes, since limited intergenic sequence necessitates the sharing of upstream regulatory elements. Little evidence was observed for a direct correlation between kinetic class and location or polarity of transcription in infection, as illustrated by the UL112-113 and UL122-123 E and IE regions, respectively. The divergent UL111A ORF is close to the UL112-113 E promoter, yet it displays L expression characteristics. The divergent ORF UL127 is immediately proximal to the major IE enhancer for UL122-123 but is not apparently expressed. Consistent with the chip data, we failed to detect UL127 transcripts by Northern analysis. However, 70% of the US genes exhibit the E kinetic class of expression. Thus, the HCMV genome may be able to accommodate more elaborate control of its transcription program than smaller viral genomes. Evolutionarily, large viral genomes such as HCMV may thus have been provided with a selective advantage.
Viral microarrays have many other potential uses. For instance, viral DNA microarrays may be used to characterize transcripts associated with latency and viral programs of transcription in different tissues and cell types. Viral chips will be particularly useful in analyzing the transcriptional consequences of mutations affecting the activity of host and viral regulatory molecules. This combination of genetics with DNA chip analysis will provide a powerful approach to the dissection and characterization of the infectious program and associated regulatory networks in a variety of biologically important cell types. This strategy also has important practical applications in antiviral drug screening. DNA microarrays can be used to define the signature pattern of known viral inhibitors (e.g., this study) and can also be used to screen for compounds that develop an alternatively desired signature (18). Moreover, mutations in specific genes encoding potential drug targets can serve as surrogates for chemical inhibitors of their activity. Viral chips can also be used to monitor drug resistance by expression profiling and typing genotypic strain variation (40) in clinical samples and thus serve as a valuable diagnostic tool.
In summary, we have developed a viral microarray-based approach to transcriptionally map the genome of HCMV. In the present study, we used viral microarray chips to profile the drug sensitivity of viral gene expression and delineate the kinetic classes of the majority of the predicted ORFs in the HCMV genome. In the future, viral and cellular DNA microarrays (41) will be a rich source of useful insights into viral biology and contribute to a deeper understanding of the gene pathways involved in viral growth and pathogenesis.
| |
ACKNOWLEDGMENTS |
|---|
J.C. and A.A. contributed equally to this work.
This work was supported by grants from the National Institutes of Health to P.G. (CA-66167 and AI-30627). P.G. is a Scholar of the Leukemia Society of America. A.A. is a Fellow of the Universitywide AIDS Research Program.
We thank Kathy Witmeyer, Jon Fleismann, and Dave Ladmer for cooperation in designing, synthesizing and purifying the gene targets; Mehrdad Khaleghi and John Wittig for help with data collection; Kenny Simmen for help with Northern blot analysis; Fatima Garcia del Rey for cooperation in preparing viral master plates for robotic printing; and Tom Hasse for the CAD layouts and machine work. Last, we apologize to the investigators whose work on the characterization of transcription units in the HCMV genome we unintentionally neglected to cite. We thank Kelly White for assistance in the preparation of the manuscript.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Departments of Immunology and Molecular Biology, Division of Virology, The Scripps Research Institute, 10550 N. Torrey Pines Rd., La Jolla, CA 92037. Phone: (619) 784-8678. Fax: (619) 784-9272. E-mail: ghazal{at}scripps.edu.
This is publication no. 12111-IMM from The Scripps Research Institute.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. | Baldick, C. J., Jr., and T. Shenk. 1996. Proteins associated with purified human cytomegalovirus particles. J. Virol. 70:6097-6105[Abstract]. |
| 2. | Barnard, D. L., J. H. Huffman, R. W. Sidwell, and E. J. Reist. 1993. Selective inhibition of cytomegaloviruses by 9-(3'-ethylphosphono-1'-hydorxymethyl-1'-propyloxy-methyl) guanine. Antiviral Res. 22:77-89[Medline]. |
| 3. | Cha, T.-A., E. Tom, G. W. Kemble, G. M. Duke, E. S. Mocarski, and R. R. Spaete. 1996. Human cytomegalovirus clinical isolates carry at least 19 genes not found in laboratory strains. J. Virol. 70:78-83[Abstract]. |
| 4. | Chee, M. S., A. T. Bankier, S. Beck, R. Bohni, C. M. Brown, R. Cerny, T. Horsnell, C. A. Hutchison III, T. Kouzarides, J. A. Martignetti, E. Preddie, S. C. Satchwell, P. Tomlinson, K. M. Weston, and B. G. Barrell. 1990. Analysis of the protein-coding content of the sequence of human cytomegalovirus strain AD169. Curr. Top Microbiol. Immunol. 154:125-170[Medline]. |
| 5. |
DeMarchi, J. M.,
C. A. Schmidt, and A. S. Kaplan.
1980.
Patterns of transcription of human cytomegalovirus in permissively infected cells.
J. Virol.
35:277-286 |
| 6. | DeRisi, J., L. Penland, P. O. Borwn, M. L. Bittner, P. S. Meltzer, M. Ray, Y. Chen, Y. A. Su, and J. M. Trent. 1996. Use of a cDNA microarray to analyse gene expression. Nat. Genet. 14:457-460[Medline]. |
| 7. | Fleckenstein, B., I. Mullerand, and J. Collins. 1982. Cloning of the complete human cytomegalovirus genome in cosmids. Gene 18:39-46[Medline]. |
| 8. |
Gibson, W.,
K. S. Clopper,
W. J. Britt, and M. K. Baxter.
1996.
Human cytomegalovirus (HCMV) smallest capsid protein identified as product of short open reading frame located between HCMV UL48 and UL49.
J. Virol.
70:5680-5683 |
| 9. |
Guo, Y.-W., and E.-S. Huang.
1993.
Characterization of a structurally tricistronic gene of human cytomegalovirus composed of US18, US19, and US20.
J. Virol.
67:2043-2054 |
| 10. |
He, Y. S.,
L. Xu, and E.-S. Huang.
1992.
Characterization of human cytomegalovirus UL84 early gene and identification of its putative protein product.
J. Virol.
66:1098-1108 |
| 11. | Hitomi, S., H. Kozuka-Hata, Z. Chen, S. Sugano, N. Yamaguchi, and S. Watanabe. 1997. Human cytomegalovirus open reading frame UL11 encodes a highly polymorphic protein expressed on the infected cell surface. Arch. Virol. 142:1407-1427[Medline]. |
| 12. | Hollander, M., and D. A. Wolfe. 1973. Nonparametric statistical analysis. John Wiley, New York, N.Y. |
| 13. |
Huber, M. T., and T. Compton.
1998.
The human cytomegalovirus UL74 gene encodes the third component of the glycoprotein H-glycoprotein L-containing envelope complex.
J. Virol.
72:8191-8197 |
| 14. | Hutchinson, N. I., R. T. Sondermeyer, and M. J. Tocci. 1986. Organization and expression of the major genes from the long inverted repeat of the human cytomegalovirus genome. Virology 155:160-171[Medline]. |
| 15. |
Jahn, G.,
E. Knust,
H. Schmolla,
T. Sarre,
J. A. Nelson,
J. K. McDougall, and B. Fleckenstein.
1984.
Predominant immediate-early transcripts of human cytomegalovirus AD169.
J. Virol.
49:363-370 |
| 16. |
Jones, T. R., and V. P. Muzithras.
1991.
Fine mapping of transcripts expressed from the US6 gene family of human cytomegalovirus strain AD169.
J. Virol.
65:2024-2036 |
| 17. |
Kaye, J.,
H. Browne,
M. Stoffel, and T. Minson.
1992.
The UL16 gene of human cytomegalovirus encodes a glycoprotein that is dispensable for growth in vitro.
J. Virol.
66:6609-6615 |
| 18. | Marton, M. J., J. L. DeRisi, H. A. Bennett, V. R. Iyer, M. R. Meyer, C. J. Roberts, R. Stoughton, J. Burchard, D. Slade, H. Dai, D. E. Bassett, Jr., L. H. Hartwell, P. O. Brown, and S. H. Friend. 1998. Drug target validation and identification of secondary drug target effects using DNA microarrays. Nat. Med. 4:1293-1301[Medline]. |
| 19. | McDonough, S. H., and D. H. Spector. 1983. Transcription in human fibro-blasts permissively infected by human cytomegalovirus strain AD169. Virology 125:31-46[Medline]. |
| 20. |
McDonough, S. H.,
S. I. Staprans, and D. H. Spector.
1985.
Analysis of the major transcripts encoded by the long repeat of human cytomegalovirus strain AD169.
J. Virol.
53:711-718 |
| 20a. | MEME algorithm. 1994, copyright date. [Online.] Regents of the University of California. www.sdsc.edu/meme/website/intro.html. [25 Feb. 1998, last date accessed.] |
| 21. | Michel, D., I. Pavic, A. Zimmermann, E. Haupt, D. Wunderlich, M. Heuschmid, and T. Merthens. 1996. The UL97 gene product of human cytomegalovirus is an early-late protein with a nuclear localization but is not a nucleoside kinase. J. Virol. 70:6340-6346[Abstract]. |
| 22. | Mocarski, E. S. 1996. Cytomegalovirus and their replication, p. 2447. In B. N. Fields, K. M. Knipe, and P. M. Howley (ed.), Virology, 3rd ed. Lippincott-Raven Publishers, Philadelphia, Pa. |
| 23. | Mocarski, E. S., M. N. Prichard, C. S. Tan, and J. M. Brown. 1997. Reassessing the organization of the UL42-UL43 region of the human cytomegalovirus strain AD169 genome. Virology 239:169-175[Medline]. |
| 24. | Moss, B. 1990. Regulation of vaccinia virus transcription. Annu. Rev. Biochem. 59:661-688[Medline]. |
| 25. | Ramsay, G. 1997. DNA chips: state-of-the-art. Nat. Biotechnol. 16:40-44. |
| 26. | Razzaque, A., N. Jahn, and D. McWeeney. 1988. Localization and DNA sequence analysis of the transforming domain (mtrII) of human cytomegalovirus. Proc. Natl. Acad. Sci. USA 85:5705-5793. |
| 27. | Schena, M. 1996. Genome analysis with gene expression microarrays. Bioessays 18:427-431[Medline]. |
| 28. |
Schena, M.,
D. Shalon,
R. W. Davis, and P. O. Brown.
1995.
Quantitative monitoring of gene expression patterns with a complementary DNA microarray.
Science
270:467-470 |
| 29. | Smith, J. A., and G. S. Pari. 1995. Human cytomegalovirus UL102 gene. J. Virol. 69:1734-1740[Abstract]. |
| 30. | Smith, J. A., S. Jairath, J. J. Crute, and G. S. Pari. 1996. Characterization of the human cytomegalovirus UL105 gene and identification of the putative helicase protein. Virology 220:251-255[Medline]. |
| 31. |
Stinski, M. F.,
D. R. Thomsen,
R. M. Stenberg, and L. C. Goldstein.
1983.
Organization and expression of the immediate early genes of human cytomegalovirus.
J. Virol.
46:1-14 |
| 32. | van Zeijl, M., J. Fairhurst, E. Z. Baum, L. Sun, and T. R. Jones. 1997. The human cytomegalovirus UL97 protein is phosphorylated and is a component of virions. Virology 231:72-80[Medline]. |
| 33. |
Vieira, J.,
T. J. Schall,
L. Corey, and A. P. Geballe.
1998.
Functional analysis of the human cytomegalovirus US28 gene by insertion mutagenesis with the green fluorescent protein gene.
J. Virol.
72:8158-8165 |
| 34. |
Wathen, M. W., and M. F. Stinski.
1982.
Temporal patterns of human cytomegalovirus transcription: mapping the viral RNAs synthesized at immediate early, early, and late times after infection.
J. Virol.
41:462-477 |
| 35. |
Welch, A. R.,
L. M. McNally, and W. Gibson.
1991.
Cytomegalovirus assembly protein nested gene family: four 3'-coterminal transcripts encode four in-frame, overlapping proteins.
J. Virol.
65:4091-4100 |
| 36. | Wilkinson, G. W. G., A. Akrigg, and P. J. Greenaway. 1984. Transcription of the immediate early genes of human cytomegalovirus strain AD169. Virus Res. 1:101-116[Medline]. |
| 37. | Wing, B. A., and E.-S. Huang. 1995. Analysis and mapping of a family of 3'-coterminal transcripts containing coding sequences for human cytomegalovirus open reading frames UL93 through UL99. J. Virol. 69:1521-1531[Abstract]. |
| 38. | Wing, B. A., G. C. Y. Lee, and E.-S. Huang. 1996. The human cytomegalovirus UL94 open reading frame encodes a conserved herpesvirus capsid/tegument-associated virion protein that is expressed with true late kinetics. J. Virol. 70:3339-3345[Abstract]. |
| 39. |
Winkler, M.,
S. A. Rice, and T. Stamminger.
1994.
UL69 of human cytomegalovirus, an open reading frame with homology to ICP27 of herpes simplex virus, encodes a transactivator of gene expression.
J. Virol.
68:3943-3954 |
| 40. |
Winzler, E. A.,
D. R. Richards,
A. R. Conway,
A. L. Goldstein,
S. Kalman,
M. J. McCullough,
J. H. McCusker,
D. A. Stevens,
L. Wodicka,
D. J. Lockhart, and R. W. Davis.
1998.
Direct allelic variation scanning of the yeast genome.
Science
281:1194-1197 |
| 41. | Zhu, H., J. P. Cong, G. Mamtora, T. Gingeras, and T. Shenk. 1998. Cellular gene expression altered by human cytomegalovirus: global monitoring with oligonucleotide arrays. Proc. Natl. Acad. Sci. USA 24:14470-14475. |
Journal of Virology, July 1999, p. 5757-5766, Vol. 73, No. 7
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Tsao, E. H., Kellam, P., Sin, C. S. Y., Rasaiyaah, J., Griffiths, P. D., Clark, D. A.
(2009). Microarray-based determination of the lytic cascade of human herpesvirus 6B. J. Gen. Virol.
90: 2581-2591
[Abstract] [Full Text] -
Mitchell, D. P., Savaryn, J. P., Moorman, N. J., Shenk, T., Terhune, S. S.
(2009). Human Cytomegalovirus UL28 and UL29 Open Reading Frames Encode a Spliced mRNA and Stimulate Accumulation of Immediate-Early RNAs. J. Virol.
83: 10187-10197
[Abstract] [Full Text] -
Hannemann, H., Rosenke, K., O'Dowd, J. M., Fortunato, E. A.
(2009). The Presence of p53 Influences the Expression of Multiple Human Cytomegalovirus Genes at Early Times Postinfection. J. Virol.
83: 4316-4325
[Abstract] [Full Text] -
Straat, K., de Klark, R., Gredmark-Russ, S., Eriksson, P., Soderberg-Naucler, C.
(2009). Infection with Human Cytomegalovirus Alters the MMP-9/TIMP-1 Balance in Human Macrophages. J. Virol.
83: 830-835
[Abstract] [Full Text] -
Zhao, Z., Ke, F., Huang, Y.-H., Zhao, J.-G., Gui, J.-F., Zhang, Q.-Y.
(2008). Identification and characterization of a novel envelope protein in Rana grylio virus. J. Gen. Virol.
89: 1866-1872
[Abstract] [Full Text] -
Fukui, Y., Shindoh, K., Yamamoto, Y., Koyano, S., Kosugi, I., Yamaguchi, T., Kurane, I., Inoue, N.
(2008). Establishment of a Cell-Based Assay for Screening of Compounds Inhibiting Very Early Events in the Cytomegalovirus Replication Cycle and Characterization of a Compound Identified Using the Assay. Antimicrob. Agents Chemother.
52: 2420-2427
[Abstract] [Full Text] -
Kalejta, R. F.
(2008). Tegument Proteins of Human Cytomegalovirus. Microbiol. Mol. Biol. Rev.
72: 249-265
[Abstract] [Full Text] -
Tabata, T., Kawakatsu, H., Maidji, E., Sakai, T., Sakai, K., Fang-Hoover, J., Aiba, M., Sheppard, D., Pereira, L.
(2008). Induction of an Epithelial Integrin {alpha}v{beta}6 in Human Cytomegalovirus-Infected Endothelial Cells Leads to Activation of Transforming Growth Factor-{beta}1 and Increased Collagen Production. Am. J. Pathol.
172: 1127-1140
[Abstract] [Full Text] -
Zhang, G., Raghavan, B., Kotur, M., Cheatham, J., Sedmak, D., Cook, C., Waldman, J., Trgovcich, J.
(2007). Antisense Transcription in the Human Cytomegalovirus Transcriptome. J. Virol.
81: 11267-11281
[Abstract] [Full Text] -
Smith, I., Juang, J.-L.
(2007). Misleading Messengers? Interpreting Baculovirus Transcriptional Array Profiles. J. Virol.
81: 7819-7821
[Full Text] -
Streblow, D. N., van Cleef, K. W. R., Kreklywich, C. N., Meyer, C., Smith, P., Defilippis, V., Grey, F., Fruh, K., Searles, R., Bruggeman, C., Vink, C., Nelson, J. A., Orloff, S. L.
(2007). Rat Cytomegalovirus Gene Expression in Cardiac Allograft Recipients Is Tissue Specific and Does Not Parallel the Profiles Detected In Vitro. J. Virol.
81: 3816-3826
[Abstract] [Full Text] -
Feng, X., Schroer, J., Yu, D., Shenk, T.
(2006). Human Cytomegalovirus pUS24 Is a Virion Protein That Functions Very Early in the Replication Cycle.. J. Virol.
80: 8371-8378
[Abstract] [Full Text] -
Jiang, S. S., Chang, I-S., Huang, L.-W., Chen, P.-C., Wen, C.-C., Liu, S.-C., Chien, L.-C., Lin, C.-Y., Hsiung, C. A., Juang, J.-L.
(2006). Temporal Transcription Program of Recombinant Autographa californica Multiple Nucleopolyhedrosis Virus.. J. Virol.
80: 8989-8999
[Abstract] [Full Text] -
Tang, Q., Maul, G. G.
(2006). Mouse cytomegalovirus crosses the species barrier with help from a few human cytomegalovirus proteins.. J. Virol.
80: 7510-7521
[Abstract] [Full Text] -
Allen, M. J., Forster, T., Schroeder, D. C., Hall, M., Roy, D., Ghazal, P., Wilson, W. H.
(2006). Locus-specific gene expression pattern suggests a unique propagation strategy for a giant algal virus.. J. Virol.
80: 7699-7705
[Abstract] [Full Text] -
Jarvis, M. A., Borton, J. A., Keech, A. M., Wong, J., Britt, W. J., Magun, B. E., Nelson, J. A.
(2006). Human Cytomegalovirus Attenuates Interleukin-1{beta} and Tumor Necrosis Factor Alpha Proinflammatory Signaling by Inhibition of NF-{kappa}B Activation.. J. Virol.
80: 5588-5598
[Abstract] [Full Text] -
Das, S., Skomorovska-Prokvolit, Y., Wang, F.-Z., Pellett, P. E.
(2006). Infection-Dependent Nuclear Localization of US17, a Member of the US12 Family of Human Cytomegalovirus-Encoded Seven-Transmembrane Proteins. J. Virol.
80: 1191-1203
[Abstract] [Full Text] -
Lua, D. T., Yasuike, M., Hirono, I., Aoki, T.
(2005). Transcription Program of Red Sea Bream Iridovirus as Revealed by DNA Microarrays. J. Virol.
79: 15151-15164
[Abstract] [Full Text] -
Davison, A. J., Stow, N. D.
(2005). New Genes from Old: Redeployment of dUTPase by Herpesviruses. J. Virol.
79: 12880-12892
[Abstract] [Full Text] -
Kennedy, P. G. E., Grinfeld, E., Craigon, M., Vierlinger, K., Roy, D., Forster, T., Ghazal, P.
(2005). Transcriptomal analysis of varicella-zoster virus infection using long oligonucleotide-based microarrays. J. Gen. Virol.
86: 2673-2684
[Abstract] [Full Text] -
Wang, D., Shenk, T.
(2005). Human Cytomegalovirus UL131 Open Reading Frame Is Required for Epithelial Cell Tropism. J. Virol.
79: 10330-10338
[Abstract] [Full Text] -
Marks, H., Vorst, O., van Houwelingen, A. M. M. L., van Hulten, M. C. W., Vlak, J. M.
(2005). Gene-expression profiling of White spot syndrome virus in vivo. J. Gen. Virol.
86: 2081-2100
[Abstract] [Full Text] -
Wang, W., Taylor, S. L., Leisenfelder, S. A., Morton, R., Moffat, J. F., Smirnov, S., Zhu, H.
(2005). Human Cytomegalovirus Genes in the 15-Kilobase Region Are Required for Viral Replication in Implanted Human Tissues in SCID Mice. J. Virol.
79: 2115-2123
[Abstract] [Full Text] -
Lashmit, P. E., Lundquist, C. A., Meier, J. L., Stinski, M. F.
(2004). Cellular Repressor Inhibits Human Cytomegalovirus Transcription from the UL127 Promoter. J. Virol.
78: 5113-5123
[Abstract] [Full Text] -
Yamamoto-Tabata, T., McDonagh, S., Chang, H.-T., Fisher, S., Pereira, L.
(2004). Human Cytomegalovirus Interleukin-10 Downregulates Metalloproteinase Activity and Impairs Endothelial Cell Migration and Placental Cytotrophoblast Invasiveness In Vitro. J. Virol.
78: 2831-2840
[Abstract] [Full Text] -
Komazin, G., Ptak, R. G., Emmer, B. T., Townsend, L. B., Drach, J. C.
(2003). Resistance of Human Cytomegalovirus to the Benzimidazole L-Ribonucleoside Maribavir Maps to UL27. J. Virol.
77: 11499-11506
[Abstract] [Full Text] -
Silva, M. C., Yu, Q.-C., Enquist, L., Shenk, T.
(2003). Human Cytomegalovirus UL99-Encoded pp28 Is Required for the Cytoplasmic Envelopment of Tegument-Associated Capsids. J. Virol.
77: 10594-10605
[Abstract] [Full Text] -
Akter, P., Cunningham, C., McSharry, B. P., Dolan, A., Addison, C., Dargan, D. J., Hassan-Walker, A. F., Emery, V. C., Griffiths, P. D., Wilkinson, G. W. G., Davison, A. J.
(2003). Two novel spliced genes in human cytomegalovirus. J. Gen. Virol.
84: 1117-1122
[Abstract] [Full Text] -
Davison, A. J., Akter, P., Cunningham, C., Dolan, A., Addison, C., Dargan, D. J., Hassan-Walker, A. F., Emery, V. C., Griffiths, P. D., Wilkinson, G. W. G.
(2003). Homology between the human cytomegalovirus RL11 gene family and human adenovirus E3 genes. J. Gen. Virol.
84: 657-663
[Abstract] [Full Text] -
Davison, A. J., Dolan, A., Akter, P., Addison, C., Dargan, D. J., Alcendor, D. J., McGeoch, D. J., Hayward, G. S.
(2003). The human cytomegalovirus genome revisited: comparison with the chimpanzee cytomegalovirus genome. J. Gen. Virol.
84: 17-28
[Abstract] [Full Text] -
Ebrahimi, B., Dutia, B. M., Roberts, K. L., Garcia-Ramirez, J. J., Dickinson, P., Stewart, J. P., Ghazal, P., Roy, D. J., Nash, A. A.
(2003). Transcriptome profile of murine gammaherpesvirus-68 lytic infection. J. Gen. Virol.
84: 99-109
[Abstract] [Full Text] -
Yang, W. C., Devi-Rao, G. V., Ghazal, P., Wagner, E. K., Triezenberg, S. J.
(2002). General and Specific Alterations in Programming of Global Viral Gene Expression during Infection by VP16 Activation-Deficient Mutants of Herpes Simplex Virus Type 1. J. Virol.
76: 12758-12774
[Abstract] [Full Text] -
Holzerlandt, R., Orengo, C., Kellam, P., Alba, M. M.
(2002). Identification of New Herpesvirus Gene Homologs in the Human Genome. Genome Res
12: 1739-1748
[Abstract] [Full Text] -
Adair, R., Douglas, E. R., Maclean, J. B., Graham, S. Y., Aitken, J. D., Jamieson, F. E., Dargan, D. J.
(2002). The products of human cytomegalovirus genes UL23, UL24, UL43 and US22 are tegument components. J. Gen. Virol.
83: 1315-1324
[Abstract] [Full Text] -
Ahn, J. W., Powell, K. L., Kellam, P., Alber, D. G.
(2002). Gammaherpesvirus Lytic Gene Expression as Characterized by DNA Array. J. Virol.
76: 6244-6256
[Abstract] [Full Text] -
Child, S. J., Jarrahian, S., Harper, V. M., Geballe, A. P.
(2002). Complementation of Vaccinia Virus Lacking the Double-Stranded RNA-Binding Protein Gene E3L by Human Cytomegalovirus. J. Virol.
76: 4912-4918
[Abstract] [Full Text] -
Yu, D., Smith, G. A., Enquist, L. W., Shenk, T.
(2002). Construction of a Self-Excisable Bacterial Artificial Chromosome Containing the Human Cytomegalovirus Genome and Mutagenesis of the Diploid TRL/IRL13 Gene. J. Virol.
76: 2316-2328
[Abstract] [Full Text] -
Spaderna, S., Blessing, H., Bogner, E., Britt, W., Mach, M.
(2002). Identification of Glycoprotein gpTRL10 as a Structural Component of Human Cytomegalovirus. J. Virol.
76: 1450-1460
[Abstract] [Full Text] -
Baxter, M. K., Gibson, W.
(2001). Cytomegalovirus Basic Phosphoprotein (pUL32) Binds to Capsids In Vitro through Its Amino One-Third. J. Virol.
75: 6865-6873
[Abstract] [Full Text] -
Paulose-Murphy, M., Ha, N.-K., Xiang, C., Chen, Y., Gillim, L., Yarchoan, R., Meltzer, P., Bittner, M., Trent, J., Zeichner, S.
(2001). Transcription Program of Human Herpesvirus 8 (Kaposi's Sarcoma-Associated Herpesvirus). J. Virol.
75: 4843-4853
[Abstract] [Full Text] -
Wu, J., O’Neill, J., Barbosa, M. S.
(2001). Late temporal gene expression from the human cytomegalovirus pp28US (UL99) promoter when integrated into the host cell chromosome. J. Gen. Virol.
82: 1147-1155
[Abstract] [Full Text] -
Johnson, R. A., Ma, X.-L., Yurochko, A. D., Huang, E.-S.
(2001). The role of MKK1/2 kinase activity in human cytomegalovirus infection. J. Gen. Virol.
82: 493-497
[Abstract] [Full Text] -
(2001). Cashing in your chips: speculation on the future of diagnostic laboratories in the era of DNA chips. J Med Microbiol
50: 111-115
[Full Text] -
Jenner, R. G., Albà, M. M., Boshoff, C., Kellam, P.
(2001). Kaposi's Sarcoma-Associated Herpesvirus Latent and Lytic Gene Expression as Revealed by DNA Arrays. J. Virol.
75: 891-902
[Abstract] [Full Text] -
García-Ramírez, J. J., Ruchti, F., Huang, H., Simmen, K., Angulo, A., Ghazal, P.
(2001). Dominance of Virus over Host Factors in Cross-Species Activation of Human Cytomegalovirus Early Gene Expression. J. Virol.
75: 26-35
[Abstract] [Full Text] -
Renne, R., Barry, C., Dittmer, D., Compitello, N., Brown, P. O., Ganem, D.
(2001). Modulation of Cellular and Viral Gene Expression by the Latency-Associated Nuclear Antigen of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
75: 458-468
[Abstract] [Full Text] -
Morgan, R. W., Sofer, L., Anderson, A. S., Bernberg, E. L., Cui, J., Burnside, J.
(2001). Induction of Host Gene Expression following Infection of Chicken Embryo Fibroblasts with Oncogenic Marek's Disease Virus. J. Virol.
75: 533-539
[Abstract] [Full Text] -
Stingley, S. W., Ramirez, J. J. G., Aguilar, S. A., Simmen, K., Sandri-Goldin, R. M., Ghazal, P., Wagner, E. K.
(2000). Global Analysis of Herpes Simplex Virus Type 1 Transcription Using an Oligonucleotide-Based DNA Microarray. J. Virol.
74: 9916-9927
[Abstract] [Full Text] -
Greijer, A. E., Dekkers, C. A. J., Middeldorp, J. M.
(2000). Human Cytomegalovirus Virions Differentially Incorporate Viral and Host Cell RNA during the Assembly Process. J. Virol.
74: 9078-9082
[Abstract] [Full Text] -
Ulbrecht, M., Martinozzi, S., Grzeschik, M., Hengel, H., Ellwart, J. W., Pla, M., Weiss, E. H.
(2000). Cutting Edge: The Human Cytomegalovirus UL40 Gene Product Contains a Ligand for HLA-E and Prevents NK Cell-Mediated Lysis. J. Immunol.
164: 5019-5022
[Abstract] [Full Text] -
Angulo, A., Kerry, D., Huang, H., Borst, E.-M., Razinsky, A., Wu, J., Hobom, U., Messerle, M., Ghazal, P.
(2000). Identification of a Boundary Domain Adjacent to the Potent Human Cytomegalovirus Enhancer That Represses Transcription of the Divergent UL127 Promoter. J. Virol.
74: 2826-2839
[Abstract] [Full Text] -
Simmen, K. A., Singh, J., Luukkonen, B. G. M., Lopper, M., Bittner, A., Miller, N. E., Jackson, M. R., Compton, T., Fruh, K.
(2001). Global modulation of cellular transcription by human cytomegalovirus is initiated by viral glycoprotein B. Proc. Natl. Acad. Sci. USA
98: 7140-7145
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»