Previous Article | Next Article 
Journal of Virology, July 1999, p. 5722-5730, Vol. 73, No. 7
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
A Complex Translational Program Generates Multiple Novel Proteins
from the Latently Expressed Kaposin (K12) Locus of Kaposi's
Sarcoma-Associated Herpesvirus
Robert
Sadler,1,2
Lijun
Wu,3
Bagher
Forghani,3
Rolf
Renne,1,2
Weidong
Zhong,1,2
Brian
Herndier,4 and
Don
Ganem1,2,5,*
Howard Hughes Medical
Institute1 and Departments of
Microbiology,2
Medicine,5 and
Pathology,4 University of California,
San Francisco, California 94143, and Viral and Rickettsial
Disease Laboratory, Division of Communicable Disease Control,
California State Department of Health Services, Berkeley,
California 947043
Received 16 February 1999/Accepted 15 April 1999
 |
ABSTRACT |
The most abundantly expressed latent transcripts encoded by the
Kaposi's sarcoma (KS)-associated herpesvirus derive from the genomic
region surrounding open reading frame (ORF) K12 (kaposin A). Here we
show that these transcripts, initially described as limited to ORF K12
itself, more frequently encompass upstream sequences spanning two
sets of 23-nucleotide GC-rich direct repeats (DRs) (DR1 and DR2).
Although the DRs lack AUG codons and were previously presumed to be
noncoding, a monoclonal antibody raised to infected cells detected
multiple polypeptides encoded by this region. These proteins are
expressed during latency and upon induction of lytic viral
replication in both primary effusion lymphoma (PEL) cell lines and KS
tumors. Biochemical and genetic analyses reveal that these proteins are
derived from variant translational initiation at CUG codons. The
predominant translation product in the PEL cell line BCBL-1 derives
from the 5'-most CUG codon in the transcript, resulting in a protein
(termed kaposin B) which is encoded largely by the repeats themselves
and which does not include K12 sequences. Other non-AUG codons in
alternate reading frames are also used at lower efficiency, including
one that initiates translation of a DR-K12 fusion protein (kaposin C)
that is predicted to sort to a different subcellular locale than
kaposin B. Thus, the products of the K12 region, which is the most
abundantly transcribed region in latency, are surprisingly complex and
may encompass multiple biological functions.
 |
INTRODUCTION |
Kaposi's sarcoma (KS) is a complex
multicentric neoplasm originally described as a rare tumor of elderly
men of Mediterranean origin (17). More recently, KS has been
recognized as a frequent malignancy among human immunodeficiency
virus-infected individuals (4). Established KS tumors
consist predominantly of spindle-shaped cells of apparent endothelial
origin which are regarded as the primary proliferative component of the
lesion. In addition, the tumors display abundant, abnormal neovascular
elements and infiltration by plasma cells and mononuclear cells (see
reference 6 for review). The recently discovered
KS-associated herpesvirus (KSHV) (10), also known as human
herpesvirus 8, is strongly linked to KS epidemiologically
(see references 11, 18, and 45
for review) and is consistently detected in the spindle cells of KS tissues (5, 48, 49). In keeping with its
classification as a lymphotropic herpesvirus (gamma-2-herpesvirus)
(32), the virus is also consistently present in at least two
lymphoproliferative diseases, primary effusion lymphoma (PEL; formerly
called body cavity-associated lymphoma) and multicentric Castleman's
disease (7, 47). In KS and PEL, the majority of the tumor
cells display latent KSHV infection, while lytic replication is limited
to a small subset of cells in both cases, presumably reflecting
spontaneous reactivation from the latent state (5, 48, 49).
KSHV, like other gamma-2-herpesviruses, encodes a large number of
proteins that have homology to cellular genes that influence or
regulate proliferation of the cell (35, 41). These include homologs of chemokines (31, 36), a G protein-coupled
chemokine receptor (9), the cytokine interleukin-6 (31,
36) and other signaling molecules (K1 protein [27,
28]), antiapoptotic proteins (vBcl-2 [13,
43]), Flice inhibitor proteins (vFLIPs [50]), and a D-type cyclin (Orf 72) (9, 12). Of these genes,
however, only the cyclin D homolog and vFLIP are known to be
transcribed during viral latency (16, 25, 44). Given the
prominence of latent infection in KS tumors and the known role of
latent gene products in tumorigenesis by other herpesviruses
(30), we (24, 40, 48, 51) and others (15,
25, 39, 42) have sought to define additional viral genes
expressed during KSHV latency.
We have previously identified in a pulmonary KS tumor a highly abundant
transcript, T0.7, which spanned the K12 open reading frame (ORF K12),
the predicted translation product of which is an extremely hydrophobic
60-amino-acid (aa) protein, kaposin (41, 51). RNAs bearing
ORF K12 sequences are consistently detectable by in situ hybridization
in the majority of spindle cells and in all stages of KS progression,
as well as in all PEL cell lines analyzed (48, 49). In both
situations, the RNAs are expressed at variable levels in latently
infected cells and at much higher levels in cells undergoing viral
reactivation (48). Recently, it has been reported that
expression of the K12 coding region in the Rat-3 cell line is capable
of inducing focus formation in vitro (33).
In this study, we have further examined the transcription and
translation of the K12 region. These experiments establish that in PELs
and in most KS tumors the predominant mRNA containing K12 is much
larger than the T0.7 transcript previously described. Detailed
transcript mapping reveals that the 5' end of the larger mRNA is
positioned well upstream of the K12 AUG codon, immediately 5' of
two large sets of GC-rich direct repeats (DRs) (DR1 and DR2).
Surprisingly, although these upstream sequences are without AUG
codons, they are nonetheless translated in vivo, as a result of
variant initiation at non-AUG codons, into a family of novel proteins. In the PEL cell line BCBL-1, the predominant translation product, named kaposin B, does not contain ORF K12 sequences. However,
K12 sequences are translated in this cell line by low-level initiation
at an alternate start codon, resulting in expression of ORF K12
sequences as a DR-K12 fusion protein.
 |
MATERIALS AND METHODS |
Cell lines and transfection.
The following cell lines were
maintained in RPMI 1640 medium supplemented with 10% fetal calf serum
and penicillin-streptomycin: BCBL-1 (40), BC1
(8), BC3 (1), Raji Burkitt's lymphoma, BJAB
Burkitt's lymphoma, and SLK KS (46) (a gift of S. Leventon-Kriss). Rodent Rat-3 (a gift of L. Rosenthal) and NIH 3T3
cells and monkey CV-1 fibroblasts were maintained in Dulbecco modified
Eagle medium H-21 supplemented as described above. For transfections,
cell lines were plated at 5 × 104 cells per
35-mm-diameter dish overnight prior to addition of Superfect
transfection reagent (Qiagen) with up to 2 µg of DNA used according
to the manufacturer's instructions.
cDNA libraries and plasmid expression constructs.
KS tissue
and BCBL-1 oligo(dT)-primed cDNA libraries from poly(A)+
RNA were prepared with the ZAP cDNA synthesis kit (Stratagene) according to the manufacturer's instructions and screened with randomly primed labeled KSHV genomic fragments. Subgenomic plasmid constructs were prepared from BCBL-1 cells and a pulmonary KS sample as
described elsewhere (51). XhoII-NheI
subfragments of the DR-K12 region were subcloned into pcDNA3.0
(Invitrogen), creating pBCBL-1 XhoII-NheI. Xpress
epitope tags were added at the NsiI restriction site
immediately 5' of the K12 ORF by PCR with the pcDNA3.1 (Invitrogen)
anti-Xpress epitope region as template and three different 5' PCR
primers (differing by 1 nucleotide [nt] to generate tags in all three
reading frames) with a common 3' primer, creating pBCBL-1
XhoII-NsiI-XprFr1, -XprFr2, and -XprFr3. The CUG
codon at position 118679 (all numbered KSHV genomic positions are
according to the BC1 sequence [41]) of
pBCBL-1-XhoII-NheI was mutated to UUG by PCR with
pBCBL-1-XhoII-NheI as template and the primers
5'-GGGGTACT GCAGGGTTCGCAGGGTTCGGGGGTACTACCTGGTTTCCTGGGGTGT GCCAAGACGGGTTCCT
and 5'-GATCCAAGCTTGGGATCTCTTGGATGGACACGTATCG. The PCR
product was ligated into the HindIII site in the
polylinker and the PstI site adjacent to DR2 within
pBCBL-1-XhoII-NheI. Plasmids were purified with
Qiagen plasmid purification kits (Qiagen) and verified by DNA sequencing.
Northern and Southern blot analysis.
RNA was harvested from
tetradecanoyl phorbol acetate (TPA)-induced (20 ng/ml, 24 h) or
uninduced cell lines with RNAzol B RNA isolation solvent (Tel-Test). To
prepare RNA from frozen KS tissue, samples were pulverized in liquid
N2 with a Microdismembrator U (Braun) pulverizer for 1 min
and solubilized in RNAzol B. RNA gel electrophoresis was performed with
approximately 10 µg of total RNA per sample by standard methods,
blotted onto Hybond-N nylon membranes (Amersham Life Sciences), and
hybridized as previously described (27), at 65°C with
single-stranded [32P]UTP-labeled riboprobes at
106 cpm/ml. For Southern blots, 10 µg of genomic DNA,
isolated by standard methods as described elsewhere (21),
was digested with PstI prior to blotting and hybridization
at 65°C with 106 cpm of a random-hexamer primed
[32P]dCTP-labeled probe per ml made with the Redi-Prime
II random prime labeling kit (Amersham).
RNase protection and primer extension assays.
RNase
protection assays were performed with total cellular RNA hybridized to
gel-purified single-stranded 32P-labeled riboprobes at
55°C. Hybrids were digested with RNase T2 (Gibco BRL)
prior to phenol chloroform extraction and ethanol precipitation and
resolved by 6% polyacrylamide gel electrophoresis (2).
Primer extension assays were performed with Superscript II reverse
transcriptase (Gibco BRL) as described previously (51) with
5 µg of total BCBL-1 RNA and a 32P-end-labeled primer,
5'-TTCGCAGGGTTCGGGGGTACTACCTG, with a 5' end at position 118635.
Western blot analysis.
Western blotting was performed with
total cell extracts solubilized in 2× sodium dodecyl sulfate (SDS)
sample buffer (4% SDS, 3% dithiothreitol) followed by
SDS-polyacrylamide gel electrophoresis on 12.5 or 10% polyacrylamide
or Tricine separation gels (2). Proteins were transferred to
polyvinylidene difluoride Immobilon-P transfer membranes (Millipore)
which were processed according to the manufacturer's instructions.
Incubations were performed with primary and secondary antibodies
diluted as follows: monoclonal antibody (MAb) 5B2, 1:5,000; Anti-Xpress
MAb (Invitrogen), 1:5,000; horseradish peroxidase-conjugated anti-mouse
immunoglobulin (Babco), 1:5,000. Horseradish peroxidase-conjugated
antibodies were visualized with ECL Western blotting detection reagents
(Amersham Life Sciences) and Biomax MS scientific imaging film (Kodak).
Immunohistochemistry.
Standard three-step diaminobenzidine
colorimetric immunoperoxidase staining was performed on acetone-fixed
tissue sections as described previously (23) with MAb 5B2 at
a dilution of 1:100.
 |
RESULTS |
The K12 region is transcribed in BCBL-1 cells as a 2.3-kb
mRNA.
Although our previous study identified a 700-nt
mRNA (T0.7) spanning the K12 ORF in a KS tumor
(51), examination of RNA from the PEL cell line BCBL-1 by
Northern blotting with a K12 region probe did not detect a transcript
of this size. Rather, an mRNA of 2.3 kb was identified in
uninduced cells, and this transcript increased in abundance upon
induction of viral replication with the phorbol ester TPA (Fig.
1B). To define the structure of this
transcript, we isolated cDNA clones from an oligo(dT)-primed BCBL-1
cDNA library with a K12 region-specific probe. Sequence analysis of
these cDNAs indicated that the 2.3-kb transcript is 3' coterminal with
the previously identified T0.7 mRNA and extends without
splicing into a region that contains two sets of 23-bp, GC-rich DRs
(DR1 and DR2) located immediately 5' to the K12 ORF (Fig. 1A). The size
of the cDNA clones (1.0 to 1.6 kb) indicated that none of them was full
length; all terminated within DR1, presumably due to the inability of
reverse transcriptase to extend through these long GC-rich elements.
For initial mapping of the 2.3-kb RNA, we carried out Northern blotting
with probes from the adjacent genomic regions. A probe (P1) within DR2
annealed strongly to the transcript, as did an additional probe (P5)
adjacent to DR2, while a probe further 5' (P6) was negative (Fig. 1C). These data, plus the size of the RNA, suggest that if the transcript were unspliced it would initiate immediately 5' of DR2
an inference that was validated by 5'-end mapping of the transcript (see below).

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 1.
The K12 region is transcribed in BCBL-1 cells as a
2.3-kb mRNA. (A) Diagram of the ORF K12 region of BCBL-1
cells, including DRs DR1 and DR2, shown with relevant restriction sites
and genomic coordinates derived from the sequenced BC1 isolate
(41). The locations of the T0.7 mRNA
(51) and BCBL-1 cDNA sequences are shown above the line; the
locations of probes used for RNA mapping by Northern blotting are shown
below. Note that the transcripts are depicted in a rightward
orientation but are leftward relative to the numbered genome of the
sequenced BC1 isolate. (B) Northern blotting of uninduced ( ) and
TPA-induced (+) BCBL-1 (Bcbl) and BJAB (BJ; KSHV negative) RNA with a
T0.7 antisense riboprobe which detects the 2.3-kb mRNA
species. (C) RNA mapping of the 2.3-kb mRNA in BCBL-1 cells
with probes P1, P5, and P6. Abbreviations are the same as those for
panel B.
|
|
We examined additional PEL cell lines and KS tumors to determine
whether the DR-K12 transcripts seen in BCBL-1 cells were
representative
of those produced in the majority of KSHV-infected
cells. RNA from
these samples was analyzed by Northern blotting
with an antisense
riboprobe encompassing the K12 ORF. In the PEL
cell lines BC1 and BC3,
TPA-induced transcripts of ca. 1.5 and
1.6 kb, respectively, were
detected (Fig.
2A), while in five KS
tumor samples K12 mRNAs ranging in size from 1.7 to 2.5 kb
were
observed (Fig.
2B). The T0.7 species was not detected by this
assay in any of these samples.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 2.
The DR-K12 mRNA is transcribed in PEL cell
lines and KS tumors. (A and B) Northern blot of uninduced ( ) and
TPA-induced (+) PEL cell line RNA from BC1, BC3, and BCBL-1 (Bcbl) (A)
and KS tumor RNA (K1, K6, K7, K8, and K9) (B) with a T0.7 antisense
riboprobe. BJ, BJAB (KSHV negative). (C) Southern blot with a
double-stranded DNA (dsDNA) probe from the K12 region of
PstI-digested genomic DNA isolated from KSHV-infected cell
lines and tumors. The size of the PstI fragment encompassing
the DRs and the corresponding size of the DR region itself (DR2 + DR1) are indicated. Isolates that have been sequenced through this
region are underlined. K3, K10, and K11 are KS tumors. MCD,
multicentric Castleman's disease. Bcbl, BCBL-1 cells.
|
|
The variability in the size of the DR-K12 transcript in these samples
can be understood in terms of the genomic organization
of KSHV. The
length of the GC-rich repeats, DR1 and DR2, is polymorphic
among KSHV
isolates, as demonstrated by Southern blot analysis
of numerous KS and
PEL DNA samples (Fig.
2C). DNA sequencing reveals
that this size
polymorphism is due to variation in the number
of repeats present in
both DR1 and DR2. In the BCBL-1 isolate,
for example, the DR1 region is
ca. 900 bp (39 repeat units of
23 bp) and the DR2 region is ca. 400 bp
(17.5 repeat units) (
50a),
resulting in a total repeat
length of 1.3 kb. (The corresponding
PstI restriction
fragment is 2.2 kb [Fig.
2C].) In the BC1 isolate,
fewer copies of
both repeats are present (
41), resulting in
DR1 and DR2
regions of ca. 300 and 200 bp, respectively. (The
corresponding
PstI restriction fragment is 1.4 kb.) These differences
in
viral genome size correspond to the variation in mRNA size
in
the PELs and are likely to account for the variation in the
size of the
mRNAs in the KS samples as well. Interestingly, in
the KSHV
isolate from the pulmonary KS tumor in which we initially
observed
T0.7, the DR-K12 mRNA (1.6 kb) was also evident at low
abundance (see Fig. 2B of reference
51).
5'-end mapping of the 2.3-kb RNA from BCBL-1 cells.
The 5' end
of the 2.3-kb BCBL-1 DR-K12 mRNA was mapped by RNase
protection assay with riboprobes P2 and P5, which were shown to
hybridize to the 2.3-kb mRNA by Northern blotting (Fig. 1C). These probes, which are 5' coterminal and 228 and 380 nt in length, respectively (Fig. 3A), were hybridized
with BCBL-1 RNA; nonannealed, single-stranded regions were digested
with T2 RNase. Both probes demonstrated protection of
130-nt hybridized fragments (Fig. 3B), which corresponds to a
discontinuity (5' end or splice site) in the RNA at position 118758, 158 bp 5' of the end of DR2 and 34 bp 3' of a consensus
TATA box sequence. The protected signal was increased in TPA-induced
BCBL-1 RNA, consistent with the Northern blot data, and was not
present with RNA from the KSHV-negative Burkitt's lymphoma cell line
Raji.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 3.
5'-end mapping of the 2.3-kb DR-K12 mRNA in
BCBL-1 cells. (A) Diagram showing locations of probes and primer used
for RNase protection and primer extension assays, respectively, with
genomic coordinates according to the BC1 isolate. (B) RNase protection
assays with uninduced ( ) and TPA-induced (+) BCBL-1 and Raji (Ra;
KSHV negative) RNA with single-stranded riboprobes P2 and P5. The
protected fragment of 130 nt corresponding to a start site at position
118758 is indicated. The larger fragments in the overexposed samples
from the TPA-treated cells represent incomplete digestion of the probe.
(C) Primer extension assay with uninduced ( ) and TPA-induced (+)
BCBL-1 RNA and an end-labeled primer with the 5' end at position
118635. The 123-nt extended product corresponding to a start site at
position 118758 is indicated. Fragment sizes were determined by
comparison with a DNA sequencing ladder.
|
|
To confirm that this discontinuity in the RNA was indeed a start site
and not a splice site, we carried out a primer extension
assay with an
end-labeled, antisense oligonucleotide with a 5'
end at position
118635. Upon annealing to TPA-induced BCBL-1 mRNA,
the
oligonucleotide was extended in the presence of reverse transcriptase
to a length of 123 nt, as determined by comigration with a sequencing
ladder (Fig.
3C). This length predicts a start site at position
118758, in excellent agreement with the RNase protection data.
The signal of
the extended product was also greatly increased
compared to RNA from
uninduced cells. This start site would result
in an unspliced
transcript of approximately 2,130 nt in BCBL-1
cells, which, upon
polyadenylation at nt 117429 (as indicated
by BCBL-1 cDNAs),
corresponds well to the size of the 2.3-kb mRNA
estimated by
Northern blotting. Owing to the high GC content of
the repeats, we were
unable to perform RNase mapping across DR1
and DR2 to confirm the
absence of splicing within the repeats.
However, the excellent
agreement between the observed and predicted
transcript sizes and the
absence of canonical splice site sequences
within this region make this
exceedingly
unlikely.
Coding potential of the 2.3-kb DR-K12 mRNA.
Analysis
of the coding potential of the DR-K12 transcript reveals continuous
coding regions extending through the entire length of DR1 and DR2 in
all three reading frames. The absence of AUG codons within and
immediately 5' of the DRs, however, precluded recognition of the coding
potential of this region in previous studies (41). There is
considerable evidence, however, that in certain situations eukaryotic
ribosomes can initiate at codons other than AUG, most notably, CUG
(e.g., in c-myc [20] and basic fibroblast
growth factor [38]) and GUG (reference
19 and references therein) as well as ACG (3,
14). In the DR-K12 transcript, a single GUG codon and three
CUG codons (in two different reading frames) are present
immediately 5' of the DRs, and numerous CUG codons are present in
each reading frame of every repeat unit of DR1. The potential
translation products produced by initiations at these codons are
depicted schematically in Fig. 4. In
addition, the DR-K12 transcript also includes the AUG codon of ORF
K12, which could direct translational initiation of a 60-aa (6-kDa) product (originally named kaposin [41]), although
without an internal ribosome entry site element within DR1 such
initiation would be expected to be very inefficient in a transcript of
this structure (22, 26).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 4.
Coding potential of the DR-K12 mRNA. (A) CUG
and GUG potential translation initiation codons within the DR-K12
mRNA are indicated with the reading frame and size of
resultant translation products for the BCBL-1 isolate. Note that the
K12 ORF is assigned to reading frame 1. Additional CUG codons are
present in all three reading frames within each repeat of DR1.
|
|
The presence of 23-nt DRs that lack stop codons in any reading
frame gives rise to another translational curiosity in this
region

namely, that translation of DR1 or DR2 results in a repeating
23-aa peptide of common sequence in all three reading frames (Fig.
5). This is because the number of
nucleotides in each repeat (23
nt) is not a multiple of 3; therefore,
ribosomes entering a repeat
in one reading frame will translate seven
codons (21 nt) and utilize
the first nucleotide of the next repeat
to translate the eighth
codon, thereby shifting the reading frame
by 1 nt. After translating
three repeats, ribosomes are once again in
the original frame,
and thus, the resulting protein sequence consists
of repeats of
23 codons. In BCBL-1 cells, there are ca. 13 reiterations of the
DR1 peptide repeat and 6 reiterations of DR2, while
in the shorter
BC1 isolate, the DR1 and DR2 peptides are repeated ca.
four and
three times, respectively.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 5.
Translation of DR1 or DR2 results in a repeating 23-aa
peptide in all three reading frames. (A) The single-letter amino acid
code of DR1 is shown below the appropriate reading frame of the DNA
sequence. The proline residue (P) that is arbitrarily assigned as the
start of each repeat unit is underlined in each reading frame. (B) The
amino acid code of DR2 is shown in all three reading frames; the
histidine residue (H) at the start of the repeat is underlined. The
sequences of the 23-bp repeat elements are identical in the BC1 and
BCBL-1 isolates.
|
|
Translated products from the DR region are expressed in
vivo.
Evidence that the DR region of the 2.3-kb DR-K12
mRNA is in fact translated in infected cells emerged from
parallel studies aimed at generating MAbs to KSHV proteins in BCBL-1
lysates. TPA-induced BCBL-1 whole-cell lysate was used to immunize mice
in order to generate a library of MAbs. Hybridoma culture supernatants
were screened by immunofluorescence analysis on fixed and permeabilized BCBL-1 cell preparations with appropriate controls (KSHV-negative BJAB
cells) to exclude recognition of nonviral proteins. Positively staining supernatants were subsequently used to screen a
-ZAP cDNA
expression library, in which oligo(dT)-primed BCBL-1 cDNAs were
fused to lacZ sequences that direct their expression in
Escherichia coli. Supernatant from MAb 5B2 identified two
lambda clones that contained partial BCBL-1 cDNA sequences from the
DR-K12 mRNA. Interestingly, in one clone lacZ was
fused to reading frame 1 of the DR1 region, while in the other clone
lacZ was fused to reading frame 2 of DR1 (Fig.
6A). This indicated that MAb 5B2 recognized an epitope within the repeating 23-aa peptide of DR1 that is
common to all three reading frames, as noted above. Of the 46 hybridoma
supernatants that were screened, 21 displayed the same specificity as
MAb 5B2, indicating that this is an immunodominant epitope in mice.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 6.
Translation products from the DR region are expressed in
vivo. (A) Structure of -ZAP BCBL-1 cDNA expression clones 23 and 24 showing fusion of lacZ coding sequence to DR1 sequences in
reading frames 1 and 2, respectively. Both clones were identified with
MAb 5B2. (B) Western blot with MAb 5B2 of TPA-induced BCBL-1 (Bcbl) and
BJAB (BJ) cell lysates. Microliter amounts of loaded lysates are
indicated; two loads of BCBL-1 lysate are shown to allow an estimation
of relative abundance of translated products. The arrow indicates the
predominant 48-kDa protein in BCBL-1 cells.
|
|
We performed Western blot analyses with MAb 5B2 to identify its viral
protein target in PEL. A strongly predominant band of
approximately 48 kDa was detected in TPA-induced and in uninduced
(not shown) BCBL-1
cell lysates (Fig.
6B). This band corresponds
in size to that of a
product initiating at the first CUG codon
of the mRNA, in
reading frame 2 (Fig.
4). If CUG initiations behave
similarly to AUG
initiations with regard to ribosomal scanning,
this would be predicted
to be the predominant site of translational
initiation on the message
(
26). (Further evidence that this
CUG codon is in fact
the principal initiation codon is presented
below.) The next most
abundant species observed in the BCBL-1
lysate is a minor band of ca.
32 kDa. This size is consistent
with initiations at CUGs within DR1 in
reading frame 2 or 3, although
the possibility that these bands are
derived from the larger species
by proteolysis is not excluded.
Additional species of 54 and 38
kDa were also reproducibly detected by
MAb 5B2, but at relatively
low abundance. The sizes of these products
are consistent with
(but not diagnostic of) translation initiations in
reading frame
1, from a CUG codon 5' of DR2 and from a CUG
codon within DR1,
respectively. As products of reading frame 1, these 54- and 38-kDa
proteins would contain the K12 ORF at their C
termini (Fig.
4).
Although these reading frame assignments are based on
apparent
molecular weights and are therefore provisional, they are also
supported by genetic evidence, presented
below.
Western blotting with MAb 5B2 also detected multiple proteins in
TPA-induced BC1 and BC3 PEL cell lysates (data not shown).
The apparent
levels of 5B2-reactive proteins in these cell lines
were lower overall
than those in BCBL-1 cells, which can be attributed
at least in part to
(i) the ca. threefold-lower number of 5B2
epitopes within their shorter
DR1 regions and (ii) a lower percentage
of lytic induction achieved by
TPA treatment of the
cells.
To determine if these MAb 5B2-reactive products could also be detected
in KS lesions, we examined KS tissues by immunohistochemistry.
These
samples displayed strongly positive staining in a small
number of
cells, some of which had spindle-like morphology (Fig.
7). These cells are likely to represent
sites of lytic viral reactivation
within the KS lesion. The presence of
the 5B2 epitope in KS cells
provides further evidence that the DR-K12
transcript of the type
described herein is common in KS tumors.
Although we have previously
shown that the majority of spindle cells
express detectable levels
of K12 region mRNA (
48),
we were unable to detect 5B2-immunoreactive
protein in the bulk of the
tumor. This result is not surprising
in view of (i) the relative
insensitivity of the immunohistochemical
detection method compared to
in situ hybridization and (ii) the
relative inefficiency of CUG versus
AUG initiation (
29,
37).
(We considered the alternate
possibility that the DR-K12 mRNA
might require viral lytic
cycle products for its translation;
however, this model is excluded by
the transfection studies presented
in the following section.)

View larger version (128K):
[in this window]
[in a new window]
|
FIG. 7.
Colorimetric immunohistochemistry of KS tissue with MAb
5B2. A typical strongly positive-staining cell with MAb 5B2 at a 1:100
dilution is indicated by the arrow. Magnification, ca. ×300.
|
|
Analysis of the translational strategy of DR-K12
mRNAs.
To more explicitly determine which of the
many potential reading frames and alternate start
codons in the DR-K12 mRNA are actually translated
in vivo, we examined protein expression from transfected plasmid
constructs in which the products of translation from each frame were
individually marked with epitope tags. In these vectors, the
cytomegalovirus immediate-early promoter was used to drive expression
of an mRNA whose structure mimics that of the 2.3-kb
transcript, including the transcription start site, DR2, and DR1
sequences; all CUG and GUG codons were left in their normal
context. In place of the K12 ORF, however, an Xpress epitope tag was
fused to the 3' end of DR1 in each of the three reading frames (Fig.
8A, top). These three constructs were
separately transfected into several KSHV-negative cell lines, including
SLK (a spindle cell line derived from a KS tumor
[46]), Rat-3 and NIH 3T3 rodent fibroblasts, and CV-1
monkey fibroblasts. Cell extracts were examined at 48 h
posttransfection by immunoblotting with either MAb 5B2 or an
anti-Xpress epitope antibody. Identical results were obtained in all
cell lines, indicating that no endothelium-specific factors were
necessary for translation. Western blotting of transfected SLK cells
with MAb 5B2 demonstrated that all three constructs expressed the DR
region to equivalent levels (Fig. 8B, left). Blotting with the
anti-Xpress antibody, however, detected a translation product primarily
from the construct that contained the Xpress epitope in reading frame 2 (Fig. 8B, right). This result indicates that the predominant protein
expressed from the DR-K12 mRNA is a frame 2 translation
product, as predicted from the size of the dominant protein observed by
Western blotting of BCBL-1 cells (Fig. 4 and 6B). Lower-abundance
products generated by the frame 3 construct and, upon long exposure
(data not shown), by the frame 1 construct were also evident,
faithfully reflecting the complexity of translation that is observed in
BCBL-1 cells in vivo. Because the frame 3 product migrates more slowly
than expected given the available CUG codons (Fig. 4), this protein
either may use a different initiator or migrates aberrantly.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 8.
The predominantly expressed protein in BCBL-1 cells is
the 48-kDa product of reading frame 2. (A) (Top) Diagram indicating the
structure of expression constructs (pBCBL-1
XhoII-NsiI-XprFr1, -XprFr2, and -XprFr3) which
contain the Xpress epitope (Invitrogen) in different reading frames at
the 3' end. (B) (Left) Equivalent expression of the three constructs in
transfected SLK cells was verified by Western blotting with MAb 5B2,
the epitope for which is present in all three reading frames (see
text). (Right) Western blotting of equivalent lysate loads was also
performed with the anti-Xpress epitope MAb, demonstrating that
translation of the Xpress epitope occurred predominantly in frame 2. Note that the frame 3 construct is overloaded to allow detection of the
epitope tag. The tag is also detectable in frame 1 upon longer exposure
(data not shown). (C) Western blotting of SLK cells transfected with
pBCBL-1 XhoII-NheI (wild type [wt] [A,
bottom]) demonstrates authentic translation of the predominant 48-kDa
product as detected in BCBL-1 lysate (BCBL). Mutation of CUG (to UUG)
in reading frame 2 at position 118679 in an equivalent transfected
construct (mut) eliminates detection of the protein.
|
|
Examination of the sequence shows two potential alternate (non-AUG)
start codons in reading frame 2 that could generate the
observed,
predominant translation product: the 5'-most CUG codon
in the
mRNA (at position 118679) and a nearby GUG codon (Fig.
4). To test which codon might be used in vivo, we transfected
SLK
cells with untagged constructs containing the entire DR-K12
region
under the control of the cytomegalovirus immediate-early
promoter; in
these constructs, the CUG codon at position 118679
was either wild
type (CUG) or mutant (UUG). The wild-type construct
demonstrated
predominant expression of a 48-kDa protein that comigrated
with the
authentic protein from BCBL-1 lysate (Fig.
8C). Rat-3
mouse fibroblasts
and all other cell lines tested also demonstrated
the same capacity to
translate the 48-kDa protein from this construct
(data not shown).
Transfection of the construct containing the
mutated CUG codon,
however, resulted in virtual ablation of translation
from this region,
although very low abundance products were visible
upon long exposure
(Fig.
8C and data not shown). These results
indicate that this CUG
codon is the principal initiator used in
vivo and gives rise to the
48-kDa protein observed in BCBL-1
cells.
 |
DISCUSSION |
These results demonstrate that the expression of the kaposin-K12
locus of KSHV displays a remarkable and previously unanticipated complexity. The principal transcript from this region spans a series of
23-nt GC-rich repeats whose number is highly variable among KSHV
isolates. These repeats, previously assumed to be noncoding due to an
absence of AUG codons, in fact direct the synthesis of multiple
polypeptides by initiation at alternate start codons in several
reading frames. In BCBL-1 cells, the predominant product of the locus
appears to initiate at the most 5' CUG codon, resulting in a
product of reading frame 2 derived primarily from translation of DR
sequences. We propose the term kaposin B for this polypeptide. In
addition, the data indicate that initiations also occur at other
non-AUG codons, including the second CUG codon in the message that generates a DR-K12 fusion protein from reading frame 1
a protein
for which we propose the name kaposin C. By virtue of the extremely
hydrophobic C terminus provided by the K12 ORF, this protein, unlike
kaposin B, is predicted to be membrane associated.
Our current estimate of the translational complexity of the locus is a
minimal one, and more products may well be produced, especially given
the multiplicity of CUGs within DR1. Given the sequence variation and
variation in repeat lengths among KSHV isolates, other isolates may
express certain reading frames at levels or ratios differing from that
which is observed in BCBL-1 cells. Even with invariant use of the
different CUG codons, the variability in repeat number among KSHV
isolates will result in kaposin B and kaposin C species of strikingly
different sizes, which potentially could produce differences in
activity. For example, if the repeats encode motifs involved in
protein-protein interactions, then differences in repeat number could
create large differences in affinity for their protein target(s). It is
also possible that differences in repeat length might affect the
stability of the translated products.
Our findings raise the question of whether the 60-aa product of ORF K12
is ever produced as such (as a 6-kDa protein). In cells in which the
T0.7 mRNA is not present
which appears from the present work
to be the majority case
the only way such a protein could be generated
would be by internal initiation from the K12 AUG codon. As yet, we
have not detected expression of such a polypeptide from RNAs initiating
upstream of the DRs. However, we cannot exclude the possibility that,
at very low efficiency, scanning ribosomes could reach the K12 AUG
codon. It is also formally possible that the DR region might also
be able to function as an internal ribosome entry site to allow direct
internal access to the K12 AUG codon.
The fact that the AUG codon for ORF K12 has been conserved in all
sequenced isolates of KSHV also suggests that circumstances exist under
which this ORF may be separately translated (34, 41, 50a).
Of course, the most obvious way for such an ORF to be expressed would
be by translation of an RNA like T0.7, which lacks DR sequences.
Clearly, such an RNA was present in one KS tumor previously studied
(51), although it is noteworthy that even this tumor also
had evidence for an RNA initiating from the upstream start site. Given
its apparent rarity in other specimens, we think it possible that the
0.7-kb transcript in that tumor might have resulted from aberrant RNA
processing from the larger transcript rather than from de novo
initiation. Further work will be required to determine if there are
certain cell types or physiologic conditions in which K12-specific
mRNAs might be preferentially produced. In the meantime, it
seems prudent to remain open to the possibility that ORF K12 may be
translated as such; accordingly, we propose the name kaposin A for its
putative 60-aa product.
Lastly, is there any biological rationale for the seemingly baroque
coding arrangement described here? While we lack definitive evidence,
certain experimental observations may be pertinent. Recently, we have
attempted to explore the phenotype mediated by expression of the DR-K12
locus in transfected cells, by using constructs designed to overexpress
kaposins B and C. Although we have had little difficulty with transient
expression of these proteins, stable transformants bearing these
constructs often display little or no 5B2 immunoreactivity. This raises
the possibility that one or more of the kaposins may be powerful
regulatory molecules whose expression at high levels is not compatible
with cell survival or growth. If so, then translation schemes employing
inefficient, noncanonical initiators and/or ribosomal scanning may have
evolved to titrate levels of expression down to those consistent with host cell survival.
 |
ACKNOWLEDGMENT |
We gratefully acknowledge N. Abbey for expert technical assistance.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Howard Hughes
Medical Institute and Departments of Microbiology and Medicine,
University of California, San Francisco, CA 94143. Phone: (415)
476-2826. Fax: (415) 476-8201. E-mail:
ganem{at}socrates.ucsf.edu.
 |
REFERENCES |
| 1.
|
Arvanitakis, L.,
E. A. Mesri,
R. G. Nador,
J. W. Said,
A. S. Asch,
D. M. Knowles, and E. Cesarman.
1996.
Establishment and characterization of a primary effusion (body cavity-based) lymphoma cell line (BC-3) harboring Kaposi's sarcoma-associated herpesvirus (KSHV/HHV-8) in the absence of Epstein-Barr virus.
Blood
88:2648-2654[Abstract/Free Full Text].
|
| 2.
|
Ausubel, F. M.
1994.
Current protocols in molecular biology, vol. 2.
John Wiley & Sons, Inc., New York, N.Y.
|
| 3.
|
Becerra, S. P.,
J. A. Rose,
M. Hardy,
B. M. Baroudy, and C. W. Anderson.
1985.
Direct mapping of adeno-associated virus capsid proteins B and C: a possible ACG initiation codon.
Proc. Natl. Acad. Sci. USA
82:7919-7923[Abstract/Free Full Text].
|
| 4.
|
Beral, V.
1991.
Epidemiology of Kaposi's sarcoma.
Cancer Surv.
10:5-22[Medline]. (Erratum, 12:226, 1992.)
|
| 5.
|
Boshoff, C.,
T. F. Schulz,
M. M. Kennedy,
A. K. Graham,
C. Fisher,
A. Thomas,
J. O. McGee,
R. A. Weiss, and J. J. O'Leary.
1995.
Kaposi's sarcoma-associated herpesvirus infects endothelial and spindle cells.
Nat. Med.
1:1274-1278[Medline].
|
| 6.
|
Boshoff, C., and R. A. Weiss.
1997.
Aetiology of Kaposi's sarcoma: current understanding and implications for therapy.
Mol. Med. Today
3:488-494[Medline].
|
| 7.
|
Cesarman, E.,
Y. Chang,
P. S. Moore,
J. W. Said, and D. M. Knowles.
1995.
Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas.
N. Engl. J. Med.
332:1186-1191[Abstract/Free Full Text].
|
| 8.
|
Cesarman, E.,
P. S. Moore,
P. H. Rao,
G. Inghirami,
D. M. Knowles, and Y. Chang.
1995.
In vitro establishment and characterization of two acquired immunodeficiency syndrome-related lymphoma cell lines (BC-1 and BC-2) containing Kaposi's sarcoma-associated herpesvirus-like (KSHV) DNA sequences.
Blood
86:2708-2714[Abstract/Free Full Text].
|
| 9.
|
Cesarman, E.,
R. G. Nador,
F. Bai,
R. A. Bohenzky,
J. J. Russo,
P. S. Moore,
Y. Chang, and D. M. Knowles.
1996.
Kaposi's sarcoma-associated herpesvirus contains G protein-coupled receptor and cyclin D homologs which are expressed in Kaposi's sarcoma and malignant lymphoma.
J. Virol.
70:8218-8223[Abstract].
|
| 10.
|
Chang, Y.,
E. Cesarman,
M. S. Pessin,
F. Lee,
J. Culpepper,
D. M. Knowles, and P. S. Moore.
1994.
Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma.
Science
266:1865-1869[Abstract/Free Full Text].
|
| 11.
|
Chang, Y., and P. S. Moore.
1996.
Kaposi's sarcoma (KS)-associated herpesvirus and its role in KS.
Infect. Agents Dis.
5:215-222[Medline].
|
| 12.
|
Chang, Y.,
P. S. Moore,
S. J. Talbot,
C. H. Boshoff,
T. Zarkowska,
K. Godden,
H. Paterson,
R. A. Weiss, and S. Mittnacht.
1996.
Cyclin encoded by KS herpesvirus.
Nature
382:410[Medline]. (Letter.)
|
| 13.
|
Cheng, E. H.,
J. Nicholas,
D. S. Bellows,
G. S. Hayward,
H. G. Guo,
M. S. Reitz, and J. M. Hardwick.
1997.
A Bcl-2 homolog encoded by Kaposi sarcoma-associated virus, human herpesvirus 8, inhibits apoptosis but does not heterodimerize with Bax or Bak.
Proc. Natl. Acad. Sci. USA
94:690-694[Abstract/Free Full Text].
|
| 14.
|
Curran, J., and D. Kolakofsky.
1988.
Ribosomal initiation from an ACG codon in the Sendai virus P/C mRNA.
EMBO J.
7:245-251[Medline].
|
| 15.
|
Davis, M. A.,
M. A. Sturzl,
C. Blasig,
A. Schreier,
H. G. Guo,
M. Reitz,
S. R. Opalenik, and P. J. Browning.
1997.
Expression of human herpesvirus 8-encoded cyclin D in Kaposi's sarcoma spindle cells.
J. Natl. Cancer Inst.
89:1868-1874[Abstract/Free Full Text].
|
| 16.
|
Dittmer, D.,
M. Lagunoff,
R. Renne,
K. Staskus,
A. Haase, and D. Ganem.
1998.
A cluster of latently expressed genes in Kaposi's sarcoma-associated herpesvirus.
J. Virol.
72:8309-8315[Abstract/Free Full Text].
|
| 17.
|
Franceschi, S., and M. Geddes.
1995.
Epidemiology of classic Kaposi's sarcoma, with special reference to Mediterranean population.
Tumori
81:308-314[Medline].
|
| 18.
|
Ganem, D.
1997.
KSHV and Kaposi's sarcoma: the end of the beginning?
Cell
91:157-160[Medline].
|
| 19.
|
Gupta, K. C.,
E. Ono,
E. V. Ariztia, and M. Inaba.
1994.
Translation initiation from non-AUG codons in COS1 cells is mRNA species dependent.
Biochem. Biophys. Res. Commun.
201:567-573[Medline].
|
| 20.
|
Hann, S. R.,
M. W. King,
D. L. Bentley,
C. W. Anderson, and R. N. Eisenman.
1988.
A non-AUG translational initiation in c-myc exon 1 generates an N-terminally distinct protein whose synthesis is disrupted in Burkitt's lymphomas.
Cell
52:185-195[Medline].
|
| 21.
|
Hansen, L. J.,
B. C. Tennant,
C. Seeger, and D. Ganem.
1993.
Differential activation of myc gene family members in hepatic carcinogenesis by closely related hepatitis B viruses.
Mol. Cell. Biol.
13:659-667[Abstract/Free Full Text].
|
| 22.
|
Herman, R. C.
1989.
Alternatives for the initiation of translation.
Trends Biochem. Sci.
14:219-222[Medline].
|
| 23.
|
Herndier, B. G.,
A. Werner,
P. Arnstein,
N. W. Abbey,
F. Demartis,
R. L. Cohen,
M. A. Shuman, and J. A. Levy.
1994.
Characterization of a human Kaposi's sarcoma cell line that induces angiogenic tumors in animals.
AIDS
8:575-581[Medline].
|
| 24.
|
Kedes, D. H.,
D. Ganem,
N. Ameli,
P. Bacchetti, and R. Greenblatt.
1997.
The prevalence of serum antibody to human herpesvirus 8 (Kaposi sarcoma-associated herpesvirus) among HIV-seropositive and high-risk HIV-seronegative women.
JAMA
277:478-481[Abstract/Free Full Text].
|
| 25.
|
Kellam, P.,
C. Boshoff,
D. Whitby,
S. Matthews,
R. A. Weiss, and S. J. Talbot.
1997.
Identification of a major latent antigen (LNA-1) in the human herpesvirus-8 genome.
J. Hum. Virol.
1:19-29.
[Medline] |
| 26.
|
Kozak, M.
1989.
The scanning model for translation: an update.
J. Cell Biol.
108:229-241[Abstract/Free Full Text].
|
| 27.
|
Lagunoff, M., and D. Ganem.
1997.
The structure and coding organization of the genomic termini of Kaposi's sarcoma-associated herpesvirus.
Virology
236:147-154[Medline].
|
| 28.
|
Lee, H.,
R. Veazey,
K. Williams,
M. Li,
J. Guo,
F. Neipel,
B. Fleckenstein,
A. Lackner,
R. C. Desrosiers, and J. U. Jung.
1998.
Deregulation of cell growth by the K1 gene of Kaposi's sarcoma-associated herpesvirus.
Nat. Med.
4:435-440[Medline].
|
| 29.
|
Mehdi, H.,
E. Ono, and K. C. Gupta.
1990.
Initiation of translation at CUG, GUG, and ACG codons in mammalian cells.
Gene
91:173-178[Medline].
|
| 30.
|
Miller, G.
1990.
Epstein-Barr virus biology, pathogenesis and medical aspects, p. 1921-1958.
In
B. Fields, and D. Knipe (ed.), Fields' virology, vol. 2. Raven Press, New York, N.Y.
|
| 31.
|
Moore, P. S.,
C. Boshoff,
R. A. Weiss, and Y. Chang.
1996.
Molecular mimicry of human cytokine and cytokine response pathway genes by KSHV.
Science
274:1739-1744[Abstract/Free Full Text].
|
| 32.
|
Moore, P. S.,
S. J. Gao,
G. Dominguez,
E. Cesarman,
O. Lungu,
D. M. Knowles,
R. Garber,
P. E. Pellett,
D. J. McGeoch, and Y. Chang.
1996.
Primary characterization of a herpesvirus agent associated with Kaposi's sarcoma.
J. Virol.
70:549-558[Abstract]. (Erratum, 70:9083.)
|
| 33.
|
Muralidhar, S.,
A. M. Pumfery,
M. Hassani,
M. R. Sadaie,
N. Azumi,
M. Kishishita,
J. N. Brady,
J. Doniger,
P. Medveczky, and L. J. Rosenthal.
1998.
Identification of kaposin (open reading frame K12) as a human herpesvirus 8 (Kaposi's sarcoma-associated herpesvirus) transforming gene.
J. Virol.
72:4980-4988[Abstract/Free Full Text].
|
| 34.
|
Neipel, F.,
J.-C. Albrecht,
A. Enser,
Y.-Q. Huang,
A. E. Freidman-Kien, and B. Fleckenstein.
1997.
Primary structure of the Kaposi's sarcoma-associated human herpesvirus 8. GenBank accession no. U93872.
.
|
| 35.
|
Neipel, F.,
J. C. Albrecht, and B. Fleckenstein.
1997.
Cell-homologous genes in the Kaposi's sarcoma-associated rhadinovirus human herpesvirus 8: determinants of its pathogenicity?
J. Virol.
71:4187-4192[Medline].
|
| 36.
|
Nicholas, J.,
V. R. Ruvolo,
W. H. Burns,
G. Sandford,
X. Wan,
D. Ciufo,
S. B. Hendrickson,
H. G. Guo,
G. S. Hayward, and M. S. Reitz.
1997.
Kaposi's sarcoma-associated human herpesvirus-8 encodes homologues of macrophage inflammatory protein-1 and interleukin-6.
Nat. Med.
3:287-292[Medline].
|
| 37.
|
Peabody, D. S.
1989.
Translation initiation at non-AUG triplets in mammalian cells.
J. Biol. Chem.
264:5031-5035[Abstract/Free Full Text].
|
| 38.
|
Prats, H.,
M. Kaghad,
A. C. Prats,
M. Klagsbrun,
J. M. Lelias,
P. Liauzun,
P. Chalon,
J. P. Tauber,
F. Amalric,
J. A. Smith, et al.
1989.
High molecular mass forms of basic fibroblast growth factor are initiated by alternative CUG codons.
Proc. Natl. Acad. Sci. USA
86:1836-1840[Abstract/Free Full Text].
|
| 39.
|
Rainbow, L.,
G. M. Platt,
G. R. Simpson,
R. Sarid,
S. J. Gao,
H. Stoiber,
C. S. Herrington,
P. S. Moore, and T. F. Schulz.
1997.
The 222- to 234-kilodalton latent nuclear protein (LNA) of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) is encoded by orf73 and is a component of the latency-associated nuclear antigen.
J. Virol.
71:5915-5921[Abstract].
|
| 40.
|
Renne, R.,
W. Zhong,
B. Herndier,
M. McGrath,
N. Abbey,
D. Kedes, and D. Ganem.
1996.
Lytic growth of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in culture.
Nat. Med.
2:342-346[Medline].
|
| 41.
|
Russo, J. J.,
R. A. Bohenzky,
M. C. Chien,
J. Chen,
M. Yan,
D. Maddalena,
J. P. Parry,
D. Peruzzi,
I. S. Edelman,
Y. Chang, and P. S. Moore.
1996.
Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8).
Proc. Natl. Acad. Sci. USA
93:14862-14867[Abstract/Free Full Text].
|
| 42.
|
Sarid, R.,
O. Flore,
R. A. Bohenzky,
Y. Chang, and P. S. Moore.
1998.
Transcription mapping of the Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) genome in a body cavity-based lymphoma cell line (BC-1).
J. Virol.
72:1005-1012[Abstract/Free Full Text].
|
| 43.
|
Sarid, R.,
T. Sato,
R. A. Bohenzky,
J. J. Russo, and Y. Chang.
1997.
Kaposi's sarcoma-associated herpesvirus encodes a functional bcl-2 homologue.
Nat. Med.
3:293-298[Medline].
|
| 44.
|
Sarid, R.,
J. S. Wiezorek,
P. S. Moore, and Y. Chang.
1999.
Characterization and cell cycle regulation of the major Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) latent genes and their promoter.
J. Virol.
73:1438-1446[Abstract/Free Full Text].
|
| 45.
|
Schulz, T. F.
1998.
Kaposi's sarcoma-associated herpesvirus (human herpesvirus-8).
J. Gen. Virol.
79:1573-1591[Medline].
|
| 46.
|
Siegal, B.,
S. Levinton-Kriss,
A. Schiffer,
J. Sayar,
I. Engelberg,
A. Vonsover,
Y. Ramon, and E. Rubinstein.
1990.
Kaposi's sarcoma in immunosuppression. Possibly the result of a dual viral infection.
Cancer
65:492-498[Medline].
|
| 47.
|
Soulier, J.,
L. Grollet,
E. Oksenhendler,
P. Cacoub,
D. Cazals-Hatem,
P. Babinet,
M. F. d'Agay,
J. P. Clauvel,
M. Raphael,
L. Degos, et al.
1995.
Kaposi's sarcoma-associated herpesvirus-like DNA sequences in multicentric Castleman's disease.
Blood
86:1276-1280[Abstract/Free Full Text].
|
| 48.
|
Staskus, K. A.,
W. Zhong,
K. Gebhard,
B. Herndier,
H. Wang,
R. Renne,
J. Beneke,
J. Pudney,
D. J. Anderson,
D. Ganem, and A. T. Haase.
1997.
Kaposi's sarcoma-associated herpesvirus gene expression in endothelial (spindle) tumor cells.
J. Virol.
71:715-719[Abstract].
|
| 49.
|
Sturzl, M.,
C. Blasig,
A. Schreier,
F. Neipel,
C. Hohenadl,
E. Cornali,
G. Ascherl,
S. Esser,
N. H. Brockmeyer,
M. Ekman,
E. E. Kaaya,
E. Tschachler, and P. Biberfeld.
1997.
Expression of HHV-8 latency-associated T0.7 RNA in spindle cells and endothelial cells of AIDS-associated, classical and African Kaposi's sarcoma.
Int. J. Cancer
72:68-71[Medline].
|
| 50.
|
Thome, M.,
P. Schneider,
K. Hofmann,
H. Fickenscher,
E. Meinl,
F. Neipel,
C. Mattmann,
K. Burns,
J. L. Bodmer,
M. Schroter,
C. Scaffidi,
P. H. Krammer,
M. E. Peter, and J. Tschopp.
1997.
Viral FLICE-inhibitory proteins (FLIPs) prevent apoptosis induced by death receptors.
Nature
386:517-521[Medline].
|
| 50a.
| Zhong, W., and D. Ganem. Unpublished data.
|
| 51.
|
Zhong, W.,
H. Wang,
B. Herndier, and D. Ganem.
1996.
Restricted expression of Kaposi sarcoma-associated herpesvirus (human herpesvirus 8) genes in Kaposi sarcoma.
Proc. Natl. Acad. Sci. USA
93:6641-6646[Abstract/Free Full Text].
|
Journal of Virology, July 1999, p. 5722-5730, Vol. 73, No. 7
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Izumiya, Y., Izumiya, C., Hsia, D., Ellison, T. J., Luciw, P. A., Kung, H.-J.
(2009). NF-{kappa}B Serves as a Cellular Sensor of Kaposi's Sarcoma-Associated Herpesvirus Latency and Negatively Regulates K-Rta by Antagonizing the RBP-J{kappa} Coactivator. J. Virol.
83: 4435-4446
[Abstract]
[Full Text]
-
Chen, S.-J., Ko, C.-Y., Yen, C.-W., Wang, C.-C.
(2009). Translational Efficiency of Redundant ACG Initiator Codons Is Enhanced by a Favorable Sequence Context and Remedial Initiation. J. Biol. Chem.
284: 818-827
[Abstract]
[Full Text]
-
Morris, V. A., Punjabi, A. S., Lagunoff, M.
(2008). Activation of Akt through gp130 Receptor Signaling Is Required for Kaposi's Sarcoma-Associated Herpesvirus-Induced Lymphatic Reprogramming of Endothelial Cells. J. Virol.
82: 8771-8779
[Abstract]
[Full Text]
-
Chen, S.-J., Lin, G., Chang, K.-J., Yeh, L.-S., Wang, C.-C.
(2008). Translational Efficiency of a Non-AUG Initiation Codon Is Significantly Affected by Its Sequence Context in Yeast. J. Biol. Chem.
283: 3173-3180
[Abstract]
[Full Text]
-
Gandy, S. Z., Linnstaedt, S. D., Muralidhar, S., Cashman, K. A., Rosenthal, L. J., Casey, J. L.
(2007). RNA Editing of the Human Herpesvirus 8 Kaposin Transcript Eliminates Its Transforming Activity and Is Induced during Lytic Replication. J. Virol.
81: 13544-13551
[Abstract]
[Full Text]
-
Rezaee, S. A. R., Cunningham, C., Davison, A. J., Blackbourn, D. J.
(2006). Kaposi's sarcoma-associated herpesvirus immune modulation: an overview. J. Gen. Virol.
87: 1781-1804
[Abstract]
[Full Text]
-
McCormick, C., Ganem, D.
(2006). Phosphorylation and Function of the Kaposin B Direct Repeats of Kaposi's Sarcoma-Associated Herpesvirus.. J. Virol.
80: 6165-6170
[Abstract]
[Full Text]
-
Grundhoff, A., Sullivan, C. S., Ganem, D.
(2006). A combined computational and microarray-based approach identifies novel microRNAs encoded by human gamma-herpesviruses. RNA
12: 733-750
[Abstract]
[Full Text]
-
Chang, K.-J., Lin, G., Men, L.-C., Wang, C.-C.
(2006). Redundancy of Non-AUG Initiators: A CLEVER MECHANISM TO ENHANCE THE EFFICIENCY OF TRANSLATION IN YEAST. J. Biol. Chem.
281: 7775-7783
[Abstract]
[Full Text]
-
Cai, X., Cullen, B. R.
(2006). Transcriptional Origin of Kaposi's Sarcoma-Associated Herpesvirus MicroRNAs. J. Virol.
80: 2234-2242
[Abstract]
[Full Text]
-
GOTTWEIN, E., CAI, X., CULLEN, B.R.
(2006). Expression and Function of MicroRNAs Encoded by Kaposi's Sarcoma-associated Herpesvirus. Cold Spring Harb Symp Quant Biol
71: 357-364
[Abstract]
-
Chen, L., Lagunoff, M.
(2005). Establishment and Maintenance of Kaposi's Sarcoma-Associated Herpesvirus Latency in B Cells. J. Virol.
79: 14383-14391
[Abstract]
[Full Text]
-
Pearce, M., Matsumura, S., Wilson, A. C.
(2005). Transcripts Encoding K12, v-FLIP, v-Cyclin, and the MicroRNA Cluster of Kaposi's Sarcoma-Associated Herpesvirus Originate from a Common Promoter. J. Virol.
79: 14457-14464
[Abstract]
[Full Text]
-
Samols, M. A., Hu, J., Skalsky, R. L., Renne, R.
(2005). Cloning and Identification of a MicroRNA Cluster within the Latency-Associated Region of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
79: 9301-9305
[Abstract]
[Full Text]
-
Matsumura, S., Fujita, Y., Gomez, E., Tanese, N., Wilson, A. C.
(2005). Activation of the Kaposi's Sarcoma-Associated Herpesvirus Major Latency Locus by the Lytic Switch Protein RTA (ORF50). J. Virol.
79: 8493-8505
[Abstract]
[Full Text]
-
McCormick, C., Ganem, D.
(2005). The Kaposin B Protein of KSHV Activates the p38/MK2 Pathway and Stabilizes Cytokine mRNAs. Science
307: 739-741
[Abstract]
[Full Text]
-
Tang, H.-L., Yeh, L.-S., Chen, N.-K., Ripmaster, T., Schimmel, P., Wang, C.-C.
(2004). Translation of a Yeast Mitochondrial tRNA Synthetase Initiated at Redundant non-AUG Codons. J. Biol. Chem.
279: 49656-49663
[Abstract]
[Full Text]
-
Stedman, W., Deng, Z., Lu, F., Lieberman, P. M.
(2004). ORC, MCM, and Histone Hyperacetylation at the Kaposi's Sarcoma-Associated Herpesvirus Latent Replication Origin. J. Virol.
78: 12566-12575
[Abstract]
[Full Text]
-
Chang, K.-J., Wang, C.-C.
(2004). Translation Initiation from a Naturally Occurring Non-AUG Codon in Saccharomyces cerevisiae. J. Biol. Chem.
279: 13778-13785
[Abstract]
[Full Text]
-
Milligan, S., Robinson, M., O'Donnell, E., Blackbourn, D. J.
(2004). Inflammatory Cytokines Inhibit Kaposi's Sarcoma-Associated Herpesvirus Lytic Gene Transcription in In Vitro-Infected Endothelial Cells. J. Virol.
78: 2591-2596
[Abstract]
[Full Text]
-
Lu, F., Zhou, J., Wiedmer, A., Madden, K., Yuan, Y., Lieberman, P. M.
(2003). Chromatin Remodeling of the Kaposi's Sarcoma-Associated Herpesvirus ORF50 Promoter Correlates with Reactivation from Latency. J. Virol.
77: 11425-11435
[Abstract]
[Full Text]
-
Song, M. J., Deng, H., Sun, R.
(2003). Comparative Study of Regulation of RTA-Responsive Genes in Kaposi's Sarcoma-Associated Herpesvirus/Human Herpesvirus 8. J. Virol.
77: 9451-9462
[Abstract]
[Full Text]
-
Dourmishev, L. A., Dourmishev, A. L., Palmeri, D., Schwartz, R. A., Lukac, D. M.
(2003). Molecular Genetics of Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Epidemiology and Pathogenesis. Microbiol. Mol. Biol. Rev.
67: 175-212
[Abstract]
[Full Text]
-
Li, H., Komatsu, T., Dezube, B. J., Kaye, K. M.
(2002). The Kaposi's Sarcoma-Associated Herpesvirus K12 Transcript from a Primary Effusion Lymphoma Contains Complex Repeat Elements, Is Spliced, and Initiates from a Novel Promoter. J. Virol.
76: 11880-11888
[Abstract]
[Full Text]
-
Fakhari, F. D., Dittmer, D. P.
(2002). Charting Latency Transcripts in Kaposi's Sarcoma-Associated Herpesvirus by Whole-Genome Real-Time Quantitative PCR. J. Virol.
76: 6213-6223
[Abstract]
[Full Text]
-
Curreli, F., Cerimele, F., Muralidhar, S., Rosenthal, L. J., Cesarman, E., Friedman-Kien, A. E., Flore, O.
(2002). Transcriptional Downregulation of ORF50/Rta by Methotrexate Inhibits the Switch of Kaposi's Sarcoma-Associated Herpesvirus/Human Herpesvirus 8 from Latency to Lytic Replication. J. Virol.
76: 5208-5219
[Abstract]
[Full Text]
-
Chang, P.-J., Shedd, D., Gradoville, L., Cho, M.-S., Chen, L.-W., Chang, J., Miller, G.
(2002). Open Reading Frame 50 Protein of Kaposi's Sarcoma-Associated Herpesvirus Directly Activates the Viral PAN and K12 Genes by Binding to Related Response Elements. J. Virol.
76: 3168-3178
[Abstract]
[Full Text]
-
Jeong, J., Papin, J., Dittmer, D.
(2001). Differential Regulation of the Overlapping Kaposi's Sarcoma-Associated Herpesvirus vGCR (orf74) and LANA (orf73) Promoters. J. Virol.
75: 1798-1807
[Abstract]
[Full Text]
-
Jenner, R. G., Albà, M. M., Boshoff, C., Kellam, P.
(2001). Kaposi's Sarcoma-Associated Herpesvirus Latent and Lytic Gene Expression as Revealed by DNA Arrays. J. Virol.
75: 891-902
[Abstract]
[Full Text]
-
Gradoville, L., Gerlach, J., Grogan, E., Shedd, D., Nikiforow, S., Metroka, C., Miller, G.
(2000). Kaposi's Sarcoma-Associated Herpesvirus Open Reading Frame 50/Rta Protein Activates the Entire Viral Lytic Cycle in the HH-B2 Primary Effusion Lymphoma Cell Line. J. Virol.
74: 6207-6212
[Abstract]
[Full Text]
-
Alexander, L., Denekamp, L., Knapp, A., Auerbach, M. R., Damania, B., Desrosiers, R. C.
(2000). The Primary Sequence of Rhesus Monkey Rhadinovirus Isolate 26-95: Sequence Similarities to Kaposi's Sarcoma-Associated Herpesvirus and Rhesus Monkey Rhadinovirus Isolate 17577. J. Virol.
74: 3388-3398
[Abstract]
[Full Text]
-
Damania, B., Choi, J.-K., Jung, J. U.
(2000). Signaling Activities of Gammaherpesvirus Membrane Proteins. J. Virol.
74: 1593-1601
[Full Text]
-
Lukac, D. M., Kirshner, J. R., Ganem, D.
(1999). Transcriptional Activation by the Product of Open Reading Frame 50 of Kaposi's Sarcoma-Associated Herpesvirus Is Required for Lytic Viral Reactivation in B Cells. J. Virol.
73: 9348-9361
[Abstract]
[Full Text]
-
Hayward, G. S.
(1999). Human Herpesvirus 8 Latent-State Gene Expression and Apoptosis in Kaposi's Sarcoma Lesions. JNCI J Natl Cancer Inst
91: 1705-1707
[Full Text]