Previous Article | Next Article 
Journal of Virology, July 1999, p. 5568-5576, Vol. 73, No. 7
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The Versatility of Paramyxovirus RNA
Polymerase Stuttering
Stéphane
Hausmann,
Dominique
Garcin,
Christophe
Delenda, and
Daniel
Kolakofsky*
Department of Genetics and Microbiology,
University of Geneva School of Medicine, CH1211 Geneva, Switzerland
Received 25 November 1998/Accepted 19 March 1999
 |
ABSTRACT |
Paramyxoviruses cotranscriptionally edit their P gene mRNAs by
expanding the number of Gs of a conserved AnGn
run. Different viruses insert different distributions of guanylates,
e.g., Sendai virus inserts a single G, whereas parainfluenza virus type
3 inserts one to six Gs. The sequences conserved at the editing site,
as well as the experimental evidence, suggest that the insertions occur
by a stuttering process, i.e., by pseudotemplated transcription. The
number of times the polymerase "stutters" at the editing site before continuing strictly templated elongation is directed by a
cis-acting sequence found upstream of the insertions. We
have examined the stuttering process during natural virus infections by
constructing recombinant Sendai viruses with mutations in their cis-acting sequences. We found that the template stutter
site is precisely determined (C1052) and that a relatively
short region (~6 nucleotides) just upstream of the
AnGn run can modulate the overall frequency of
mRNA editing as well as the distribution of the nucleotide insertions.
The positions more proximal to the 5' AnGn run
are the most important in this respect. We also provide evidence that
the stability of the mRNA/template hybrid plays a determining role in
the overall frequency and range of mRNA editing. When the template U
run is extended all the way to the stutter site, adenylates rather than guanylates are added at the editing site and their distribution begins
to resemble the polyadenylation associated with mRNA 3' end formation
by the viral polymerase. Our data suggest how paramyxovirus mRNA
editing and polyadenylation are related mechanistically and how
editing sites may have evolved from poly(A)-termination sites or vice versa.
 |
INTRODUCTION |
The concept of RNA editing was
introduced in 1986 to describe the posttranscriptional insertion of
nongenomically encoded uridylates within the coding region of
trypanosome mitochondrial mRNAs; this insertion restores the coding
capacity of these genes (3). Many other examples of RNA
editing by a variety of mechanisms, including nucleotide insertion,
deletion, and base substitution, were subsequently found. The term RNA
editing now encompasses a large number of separate processes that
produce RNA transcripts whose sequence (and informational capacity)
differs from that encoded by the corresponding gene, other than by
splicing or 5'- and 3'-end formation (2, 18, 50). Although
"editing" implies that the process occurs posttranscriptionally,
there are two examples, both by nucleotide insertion, where it has not
been possible to separate the modification of the RNA from its
synthesis, namely, the paramyxovirus P genes and those of the
mitochondria of Physarum polycephalum. The editing of the
Physarum mRNAs is relatively complex. Single cytidylates or
uridylates, and certain dinucleotides, are added to ca. 1,000 different
sites of the mRNAs from this ~60-kb genome, and the information that
determines the specificity of the insertions at each site is unclear.
The mechanism(s) operating here is tightly coupled to the synthesis of
the mRNA, but this editing does not appear to be due to the reiterative
copying of a template base(s) (i.e., pseudotemplated transcription
[56, 57]). In contrast, the editing of paramyxovirus P
gene mRNAs is relatively simple, since only a single site per 15-kb
viral genome is modified and only guanylates are added within a short run of guanylates. Moreover, different paramyxoviruses insert different
distributions of guanylates at their editing sites, and the sequences
conserved here as well as experimental evidence suggests that the
insertions occur by a stuttering process, i.e., by pseudotemplated
transcription (30, 32).
The Paramyxovirinae are organized into three genera:
Respiroviruses, including Sendai virus (SeV) and human and
bovine parainfluenza virus type 3 (h- and bPIV3);
Morbilliviruses (e.g., measles virus and the distemper
viruses); and Rubulaviruses (e.g., mumps virus and simian
virus 5 [SV5]). They contain nonsegmented 15- to 16-kb negative-strand RNA genomes found as helical nucleocapsids, in which
each nucleocapsid protein (N) subunit is associated with precisely six
nucleotides, and only viral genomes which are multiples of six
nucleotides in length are found in nature (the "rule of six"
[5, 12, 31]). Ca. 300 copies of the P (phosphoprotein) and ca. 50 copies of the L (large) protein are also bound to each nucleocapsid. Six mRNAs (in the order N, P, M, F, HN, and L) are transcribed from the N:RNA genome by the P-L polymerase. All of these
viral mRNAs, except the P gene mRNA, express a single primary translation product from a single open reading frame (ORF). The P gene
mRNAs, in contrast, generally contain one or two alternate ORFs that
overlap the middle region of the P-protein ORF and that are expressed
as fusion proteins with the N-terminal half of P. In contrast to
retroviruses or coronaviruses, where alternate downstream ORFs are
accessed by ribosomal frameshifting (4, 23, 60), the
trans-frame P-fusion proteins result from transcriptional frameshifting due to the programmed insertion of different numbers of guanylates.
Most paramyxoviral P genes contain a 5' AnGn
purine run (Fig. 1A) at the start of the
internal, overlapping V ORF (by convention, plus strands are written 5'
to 3' and minus strands are written 3' to 5'). mRNAs with expanded G
runs are transcribed from these genes in addition to those which are
faithful copies of their templates, and the number of G insertions
which occur for each virus group mirrors their requirements to switch
between the in-frame and trans-frame downstream ORFs
(30). For the morbilliviruses and Sendai virus (SeV), which
require a single nucleotide insertion to frameshift to the V ORF from
the genome-encoded P ORF, a single G is added as the predominant
editing event (Fig. 1A). For the rubulaviruses, which require the
insertion of two nucleotides to access the remainder of the P ORF from
the genome-encoded V ORF, two Gs are added at high frequency when
insertions occur. For bPIV3, where both V and another ORF (called D)
overlap the middle of the genome-encoded P ORF, one to six Gs are added
at roughly equal frequency so that mRNAs encoding all three overlapping ORFs are expressed.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Sequence homologies at the paramyxovirus editing
sites. The sequences are written as [+] RNA, 5' to 3', and are
grouped into the three genera of the Paramyxovirinae. Spaces
have been introduced to emphasize the different elements of the
sequence, and shaded boxes indicate sequence conservations. The short G
run which is expanded on mRNA editing is shown on the right, together
with the pattern of G insertions which occurs for each group. Note that
the A run preceding the G run is the only part of this
cis-acting sequence that is strictly conserved according to
genera. Also note that the second A residue upstream of the rubulavirus
G run is replaced by a G (highlighted with a rectangle), which
presumably accounts for why rubulaviruses insert a minimum of two G
residues when stuttering begins. The precise SeV editing site
determined in this study (arrow) is listed as position 1, and
positions upstream are numbered according to their distance from this
mRNA 3' end when the polymerase active site is at the editing site.
Virus abbreviations: MeV, measles virus; PDV, phocine distemper virus;
RPV, rinderpest virus; CDV, canine distemper virus; DMV, dolphin
morbillivirus; MuV, mumps virus; PI4, human parainfluenza virus type 4;
LPMV, La Piedad, Michoacan virus; PI2, human parainfluenza virus type
2. (b) Competitive kinetic model for SeV RNAP stuttering-elongation
decision. The template and mRNA chains of the transcription elongation
complex at the editing site are shown schematically. The putative 7-bp
hybrid between the polypyrimidine tract of the [ ] genome (top
strand) and the polypurine run of the nascent mRNA chain (bottom
strand) when the transcription elongation complex is at the editing
site is boxed. The mRNA upstream of the hybrid is proposed to enter an
exit channel (gray-shaded box) before it reaches the surface of the
RNAP, which maintains the length of the hybrid as transcription
elongation proceeds. The exit channel, analogous to other RNAPs, would
contain ~10 nt (see text). The RNAP bipartite active site, in which
the nascent mRNA 3' end (position 1) and the NTP -phosphate
(position +1) are coordinated via two Mg2+ ions, is
highlighted in gray. The transcription complex at the top left is at
the editing site (the middle template C1052, boxed in gray)
and has just incorporated a strictly templated G1052 (top
left). The transcription complex at the editing site presumably pauses
due to backsliding of RNAP by one position along both the template and
the mRNA chains, undoing the last base pair of the hybrid (and removing
the mRNA 3' end from the active site) and reforming 1 bp on the
upstream side. RNAP at pause sites is envisaged as oscillating between
the inactive backtracked alignment (second line) and the active
alignment (top line). If a strictly templated GMP is the next
nucleotide incorporated, RNAP moves past the stutter site and resumes
normal elongation (top line). Alternatively, realignment of the hybrid
also correctly repositions the mRNA 3' end in the active site. Hybrid
realignment when RNAP is in the backtracked state is initiated when the
unpaired 3' G re-pairs with C 2 (third line), causing the
penultimate G to bulge out. Realignment is completed upon translocation
of the single nucleotide bulge to the upstream side of the hybrid,
reforming a 7-bp hybrid which is nearly as stable as its predecessor.
The mRNA 3' G is now correctly repositioned in the active site, and
nucleotide addition at this point leads to a single pseudotemplated G
insertion, or stutter (lower case g, bottom line). Having stuttered
once, the transcription complex is back to where it started from and
has the same choices (second branchpoint, bottom right). Escape from
stuttering occurs when the transcription complex moves to a template
position where hybrid realignment (stuttering) is no longer favored.
Numbers above the genome sequence always indicate the positions
relative to mRNA 3' end at the start of the stutter (top left).
|
|
Paramyxovirus mRNAs are made in the cytoplasm, and these viruses must
consequently fend for themselves in all aspects of mRNA synthesis.
Negative-strand virus RNA polymerases (RNAPs) polyadenylate their mRNAs
by stuttering on a short run of template U residues (4 to 7 nucleotides
[nt] long) at the end of each gene. It was this characteristic that
first suggested that the G insertions would similarly occur by
pseudotemplated transcription (6, 24, 51, 54), and there is
now strong experimental evidence that the insertions occur
cotranscriptionally, by a stuttering mechanism (21, 55). By
analogy to the elongation-termination decision of Escherichia
coli RNAP (58, 59), paramyxovirus mRNA editing can be
described by a competitive kinetic model (Fig. 1B). The paramyxovirus
RNAP elongation complex has two choices at any template position; it
can extend the nascent chain by 1 nt, or it can be induced by features
of the template or nascent chain sequence to pause (Fig. 1B). At this
point (the first branchpoint, see below) there is a significant
probability that the active site together with its nascent chain are
repositioned one (respiroviruses and morbilliviruses) or two
(rubulaviruses) residues upstream of the template C which has just been
copied (shown as C
1 in Fig. 1B, top left). In the realignment of the
nascent mRNA/template hybrid, U:G (but not A:C) pairs are permitted,
and in analogy to ribosomal frameshifting, the region where alternate
base pairing occurs after realignment is called the slippery sequence.
The template cytidylate(s) is then copied a second time when nucleotide addition recurs, resulting in pseudotemplated G insertions. If a
strictly templated rather than a pseudotemplated nucleotide monophosphate (NMP) is nevertheless added; this allows RNAP to move
past the potential site of editing (the stutter site) and to escape
downstream (Fig. 1B, top line). This first branchpoint thus determines
the overall frequency of edited mRNAs. However, if a stutter occurs,
the frequency with which RNAP now escapes to strictly templated
elongation or restutters represents a second branchpoint, because h-
and bPIV3 behave differently than SeV at this juncture. The second
branchpoint thus determines the range of G insertions once stuttering
has commenced.
The replacement of the SeV editing region with that of bPIV3 in an SeV
minigenome leads to mRNAs with G insertions whose distribution resembles those found in bPIV3 infection (21, 25). The
counting mechanism that determines this difference in distribution of G insertions is thus apparently controlled in large part by a
cis-acting sequence. This study reports that the editing
site is precisely determined (C1052) and examines how the
controlling sequences which lie immediately upstream of the 5'
A6G3 slippery sequence affect the counting mechanism. Our results suggest how mRNA editing and polyadenylation might be related mechanistically.
 |
MATERIALS AND METHODS |
Generation of pFL-3
2.
To generate pFL-3
2, pFL-3
1
(16) was digested with SmaI, religated, and
transformed into XL1-Blue bacteria. This resulted in a Sendai
full-length clone with a deletion between the NcoI site (nt
358, in the N gene) and the SmaI site (nt 3553, in the P
gene), 5 nt downstream of the P ORF.
Generation of mutations in the shuttle vector
pN/PxhoM and in PHA.
Construction of the
pN/PxhoM shuttle vector is described in Garcin et al.
(16). The A3G6,
A4G5, A5G4,
A7G2, A8G1, and
A9 mutants were constructed in pGEM-PHA by
inserting their respective P cassettes in place of the corresponding 1028XbaI-EcoRI1130
fragment of wild-type PHA. The A3G6, A4G5, A5G4, A7G2, and
A8G1 cassettes were obtained by PCP amplification from
pGEM-PHA with primer A3G6
(5'-GACTCTAGAGAGCGACTCTAACAAAGGGGGGCATAGGAGAG), primers A4G5,
A5G4, A7G2,
A8G1, and A9 (which are identical
to A3G6 except for the polypurine run
[underlined]), and primer PEcoP (5'-GGGCACGTCTTGCAAACAC).
The PCR products were then digested with XbaI and
EcoRI and introduced into pGEM-PHA. These series
of mutations were then transferred to the shuttle vector
pN/PxhoM by inserting the SmaI fragment of
PHA derivatives.
Other mutations were constructed as described above with primers AAt
(5'-GACTCTAGAGAGCGACTCT
AATAAAAAAGGGCATAGGAGAG)
and Att,
AtC, and ttt (which are identical to AAt except at
the upstream
sequences underlined); primers Comp(

20 to

12)
(5'-GACTCTAGActcgctgagAACAAAAAAGGGCATAGGAGAG),
Comp(

20 to

15) (5'-GACTCTAGActcgctCTCAACAAAAAAGGGCATAGGAGAG),
and
Comp(

20 to

18)
(5'-GACTCTAGActcCGACTCAACAACAAAAAAGGGCATAGGAGAG);
primer SV5 (5'-GACTCTAGAccccatCgattttAAgAggggCATAGGAGAGAAC);
primers
Swap(

16 to

9)
(5'-GACTCTAGAGAGCagggaAttAAAAAAGGGCATAGGAGAG)
and Swap(

16
to

12) (5'-GACTCTAGAGAGCagggaAACAAAAAAGGGCATAGGAGAG);
primer Co.Sw(

16 to

9)
(5'-GACTCTAGAGAGCtcccttggAAAAAAGGGCATAGGAGAG);
and finally
primer SeV(Z)
(5'-GACTCTAGAGAcCGACTCTAACAAAAAAGGGCATAGGAGAG).
Generation of recombinant SeV (rSeV).
Briefly, one
9-cm-diameter dish of A549 cells was infected with 3 PFU of vaccinia
virus TF7-3 (14) per cell and transfected 1 h later
with 1.5 µg of pGEM-L, 5 µg of pGEM-N, 5 µg of
pGEM-PHA (which do not express C proteins), 15 µg of
pFL3-
2, and 5 µg of the various pN/PXho/M shuttle
vectors (15, 16). All mutations were introduced into both
pN/PXho/M and pGEM-PHA to prevent possible loss
of the mutation by recombination. Twenty-four hours later,
1-
-D-arabinofuranosylcytosine (100 µg/ml) was added to
inhibit vaccinia virus replication, and after a further 24 h the
cells were scraped into their medium and directly injected into the
allantoic cavity of 10-day-old embryonated chicken eggs. Three days
later, the allantoic fluids were harvested and reinjected undiluted
into eggs. For further passages, the viruses were diluted 1/500 before
injection. The presence of viruses was determined by pelleting the
allantoic fluids through a TNE-25% glycerol cushion at 14,000 rpm.
Virus pellets were then lysed in sample buffer, and the proteins were
separated by sodium dodecyl sulfate-10% polyacrylamide gel
electrophoresis and stained with Coomassie brilliant blue.
Analysis of mRNAs and genomes and antigenomes by limited primer
extension.
A549 cell monolayers in 9-cm-diameter dishes were
infected with 10 to 30 PFU of the various rSeV per cell. At 24 hours
postinfection (hpi), the cells were solubilized by scraping into 150 mM
NaCl-50 mM Tris (pH 7.4)-10 mM EDTA-0.6% Nonidet P-40. Nuclei were
removed by pelleting at 12,000 × g for 5 min. To
separate mRNA and the viral nucleocapsids, cytoplasmic extracts were
centrifuged in a step gradient composed of a 5.7 M CsCl cushion, 40%
CsCl, and 20% CsCl at 35,000 rpm overnight in an SW55 rotor. RNAs from
either viral nucleocapsids (the 20 to 40% interface) or pelleted mRNAs were analyzed by limited primer extension after reverse
transcription-PCR amplification. The reverse transcription reaction
used the oligonucleotide PEcoP (5'-GGGCACGTCTTGCAAACAC) and
a 1/10 aliquot was used for PCR with 50 pM of PEcoP and PEag primer
(5'-CCAGCCAACGGCCGCCC) in 10 mM Tris-Cl (pH 8.3)-50 mM
KCl-2 mM MgCl2-100 µM deoxynucleoside triphosphates
(dNTP). PCR was carried out in 50 µl with 1 U of Taq
polymerase in a GeneAmp PCR system 9600, with denaturation at 94°C
for 20 s, elongation at 72°C for 30 s, and annealing at 45°C for 18 cycles. The PCR products were purified on a 2% agarose gel and annealed to 32P-labeled primers (SeV-edit;
5'-GATGTGTTCTCTCCTATG) complementary to the sequence
immediately downstream of the editing site. Primer extension was
performed in 10 µl at 37°C for 6 min with 1 U of T7 DNA polymerase
(Pharmacia) in the presence of 40 µM concentrations (each) of dGTP,
dTTP, and dCTP and 4 µM ddATP. Then, 300 µM dNTP was added, and the
mix was incubated an additional 2 min to chase stalled complexes. The
reaction was stopped by adding 4 µl of STOP solution (95% formamide,
20 mM EDTA, 0.1% bromophenol blue, and xylene cyanol FF). The products
were boiled 1 min and electrophoresed on a 12.5% sequencing gel
(1).
 |
RESULTS |
5' A run.
The three respiroviruses that edit their P mRNAs
contain a 5' A6G3-5 run at the editing site
(Fig. 1A). Consistent with this conservation, a minimum of three Gs are
required for SeV editing activity, and minigenomes containing
G4 or G5 runs continued to edit their mRNAs at
slightly reduced frequencies (21). The importance of the
length of the A run, in contrast, is unclear. An SeV minigenome in
which the 5' A6 run is replaced with 5' AAAAGA or a recombinant measles virus in which the 5' A5 run
is replaced with 5' AAAGA (both in attempts to induce the insertion of
2 Gs in a single stutter as postulated for rubulaviruses) are editing inactive (25, 47). This inactivity is presumably because
unstable A:C pairs would be formed during the realignment of the
mRNA/template hybrid required for editing, and these pairs must be
avoided in designing our mutants.
It has recently become possible to recover infectious
mononegaviruses from DNA (
15,
44,
48) and therefore to
study SeV
mRNA editing within the context of a natural virus infection
by
reverse genetics. This approach is possible because the products
of
the edited mRNAs (the V and W proteins) are not required for
the
infection of cultured cells or hen's eggs but rather play
a crucial
role during infections of mammals (
10,
11,
28,
29). We have
examined the importance of the length of the A
run for mRNA editing by
systematically mutating the adenylates
abutting the G run to guanylates
and vice versa (from 5' A
3G
6 to
A
9G
0, without altering other positions [Fig.
2A]) in rSeV.
As the A and G runs in
these rSeV remain intact, unstable A:C
pairs are not encountered during
hybrid realignment. Except for
rSeV-A
9G
0, the
other viruses were recovered from DNA as efficiently
as rSeV-wt and
were amplified in hen's eggs similarly to rSeV-wt.
In contrast, we
were unable to prepare rSeV-A
9G
0 despite
repeated
attempts.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 2.
mRNA editing in rSeV-A3G6 to
-A8G1-infected cells. (A) The ORFs expressed
from the P gene mRNA (shaded boxes) are shown above. The sequences of
the various rSeVs in which the lengths of the A and G runs were altered
(as described in the text) are shown. (B) Parallel cultures of A549
cells were infected with 20 PFU of the various rSeVs per cell as
indicated. CsCl pellet RNA was prepared at 24 hpi, and the distribution
of lengths of their P gene mRNA purine runs was determined by primer
extension analysis limited with ddATP, as schematized in the upper
panel. RNA from uninfected cells (mock) served as a negative control.
The relative intensities of the various bands was determined, and the
fraction of the mRNA population with a single (+1G) or multiple (>+1G)
purine insertion is listed below. The lengths of their G runs alone was
determined by primer extension analysis limited with ddTTP (not shown),
as schematized in the upper panel, and the nature of the insertion
deduced (see the text) is also listed below.
|
|
Parallel cultures of A549 cells were infected with 20 PFU of the
various rSeV per cell. The editing regions of the P gene
mRNAs (at 24 hpi) were then examined by limited primer extension
terminated with
ddATP to measure the combined length of the A
and G runs (Fig.
2).
rSeV-A
3G
6 and -A
4G
5
infections were found
to contain little or no edited mRNAs.
rSeV-A
5G
4 displayed some
editing activity (7%
of the mRNAs contained a single insertion),
but clearly less than the
wild-type control (30%). rSeV-A
7G
2,
on the
other hand, was found to edit 67% of its mRNAs, and mRNAs
with two
additional purines now represented 12% of the total.
Most remarkably,
rSeV-A
8G
1 infections contained mRNAs with a
very
broad range of insertions (up to at least 20 nt) which slowly
decreased in frequency, such that mRNAs with multiple insertions
now
represented 59% of the total. Thus, systematically mutating
the
upstream adenylates to guanylates progressively decreases
the frequency
of mRNA editing, whereas mutating the downstream
guanylates to
adenylates has the opposite effect. The nature of
the bases inserted
was determined by also carrying out primer
extension limited with
ddTTP, which measures the length of the
G run alone. The pattern of
bands obtained with ddTTP for the
A
5G
4 to
A
7G
2 viruses was identical to that obtained
with ddATP,
indicating that only guanylates were added to the purine
run in
these cases. The pattern of bands obtained with ddTTP for
rSeV-A
8G
1,
in contrast, showed that very few
guanylates had been inserted
into these mRNAs (only a very weak band at
position +1 was visible
with ddTTP, which could account for only ca.
1% of the total insertions
[not shown]). Predominantly adenylates
were thus added to the
purine run for
rSeV-A
8G
1. Limited primer extension carried out
with antigenomes showed that no insertions had occurred during
genome
replication (data not shown), and thus the extra nucleotides
must have
been added during mRNA
synthesis.
G insertion into the SeV P gene mRNA occurs by a pseudotemplated
process where one (or more) of the three cytidylates of the
template 3'
1045UUUUUU
CCCG
1054 slippery
sequence are copied more than once (numbers refer to
distance from the
5' end of the P mRNA). In virion polymerase
reactions in which the
various NTPs were severely limited to increase
the step time for
nucleotide addition, low concentrations of CTP
did not affect the
frequency of editing, indicating that the downstream
C
1053
was not copied twice. Low GTP concentrations, on the other hand,
strongly enhanced editing, suggesting that either C
1051 or
C
1052 (or both) acted as the insertion or stutter site
(
55). The
results shown in Fig.
2 indicate that
C
1052 is used as a stutter site, since the nucleotide
insertions change
from G to A when U replaces C
1052
(rSeV-A
8G
1). By the same criteria
C
1051 is not being used, because guanylates continue to be
inserted
into the mRNA when U replaces C
1051
(rSeV-A
7G
2). The SeV stutter site thus appears
to be precisely
determined (C
1052 [or C
1 in
Fig.
1B]), in a way similar to the pause and termination sites
in
Escherichia coli (
8).
Importance of the upstream trinucleotide.
Except for SeV which
contains the trinucleotide 5' AAC immediately upstream of the 5'
AnGn run, the other respiroviruses and morbilliviruses have 5' AUU (Fig. 1A). All RNAPs are thought to add
nucleotides to the nascent RNA in a bipartite active site which
coordinates the RNA 3' end (position
1) and the NTP
-phosphate (position +1) via two Mg2+ ions (24). If the SeV
stutter site is C1052 (3'
1045UUUUUUCCC1053) and the mRNA/template hybrid
is 7 bp long, as shown in Fig. 1B (see below), then the AAC in question
is at positions
11 to
9 relative to the mRNA 3' end
(
11AAC
9), i.e., just upstream of the
hybrid. When
11AAC
9 is changed to AUU in
rSeV, this virus edits its P gene mRNA similarly to PIV3 in that mRNAs
with two to four additional guanylates are now as numerous as mRNAs
without insertions (lane AUU; Fig. 3). To
investigate whether both uridylates are important for this phenotype
switch, rSeV in which
11AAC
9 was changed to
AAU or AUC were prepared. The adenylate that begins this trinucleotide
(position
11) is invariant for respiroviruses and morbilliviruses,
whereas 5' UUU precedes the purine run of all rubulaviruses (Fig. 1A).
An rSeV in which
11AAC
9 was changed to UUU
was also prepared to examine whether the conservation of
A
11 was important for editing.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 3.
mRNA editing in rSeV-infected cells with mutations in
positions 11 to 9. The various rSeVs with mutations at positions
11 to 9 (relative to the middle G of the G run at position 1) are
shown above. The distribution of lengths of their P gene mRNA purine
runs determined by primer extension analysis limited with ddATP (as in
Fig. 2) are shown below. The lengths of the various extended primers
representing the uninserted mRNA (zero bands) vary here due to
differences in the position of the limiting ddATP incorporated. The
fastest band in each lane represents the zero or uninserted mRNA.
|
|
When compared to wild-type rSeV, rSeV-AAU clearly increased the
fraction of mRNAs with a single G insertion (from 30 to 53%).
However,
in contrast to rSeV-AUU where mRNAs with more than one
G insertions
were predominantly affected (from 1 to 36%), mRNAs
with more than one
G were increased only marginally for rSeV-AAU
(from 1 to 9%).
According to the competitive kinetic model of
Fig.
1B, the mutation
from C to U at position

9 would predominantly
affect the first
branchpoint. rSeV-AUC, in contrast, edited its
mRNA very similarly to
the wild-type virus (rSeV-AAC), although
there was a small increase in
the ">1G" population (to 6%). The
presence of uridylates at both
positions

9 and

10 are thus required
for the strong increase in
>+1G mRNAs seen in rSeV-AUU infections
(i.e., the switch to a
PIV3-like phenotype). According to the
competitive kinetic model, the
enhancing effect of a uridylate
at position

10 (in rSeV-AUU) would
predominantly affect the second
branchpoint. Lastly, rSeV-UUU was found
to edit a smaller fraction
of its mRNAs than rSeV-wt (AAC), and only
the +1G population could
be detected. The presence of the conserved
A
11 is thus critical for the enhancing effects of the
uridylates
at positions

9 and

10. The sequence of the 3 nt just
upstream
of the 5' A
nG
n run can clearly affect
the distribution of G insertions
during SeV mRNA
editing.
Positions
12 to
14.
SeV and the morbilliviruses, which
predominantly add a single G to their edited mRNAs, contain only
pyrimidines at positions
12 to
14 of the plus strand, whereas h-
and bPIV3 contain purines at these positions (Fig. 1A). Farther
upstream, however, there is no obvious sequence that is conserved
according to editing phenotype. To examine the extent of the upstream
sequences which can modulate mRNA editing, rSeV were prepared in which
the bases at positions
20 to
12,
20 to
15, and
20 to
18
were radically mutated to their Watson-Crick complements (Fig.
4). When P mRNAs from these various
rSeV-infected cells were compared with wild-type virus infections for
their distribution of G insertions, the distribution in the Comp(
20
to
18) mRNAs was found to be very similar to that of the wild-type
virus, and the overall fraction of edited mRNAs was unchanged.
Sequences beyond position
17 thus appear to have little or no effect
on the pattern of editing. rSeV-Comp(
20 to
15) and rSeV-Comp(
20
to
12) edited a smaller fraction of their mRNAs; hence, the nature of
the bases at positions
17 to
12 can affect the overall frequency of
editing (presumably at the first branchpoint). The bases at positions
17 to
12 also appear to affect the second branchpoint, since
rSeV-Comp(
20 to
12) infections contained a significant fraction of
edited mRNAs with a broad distribution of insertions (from 2 to >6 Gs,
8% of the total) (Fig. 4). As rSeV-Comp(
20 to
12) has replaced the 5'
14CUC
12 pyrimidine run of SeV-wt with
purines (5'
14GAG
12), the difference in
editing patterns between rSeV-Comp(
20 to
12) and rSeV-Comp(
20 to
15) is presumably due to differences at positions
14 to
12, i.e.,
the presence of a purine as opposed to a pyrimidine run here may
contribute to enhancing multiple G insertions independent of the
presence of UU at positions
9 and
10.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 4.
mRNA editing in rSeV-infected cells with complementary
sequences at positions 20 to 12 and an rSeV with a SV5 editing
site. The various rSeVs in which the sequences at positions 20 to
18, 20 to 15, or 20 to 12 were mutated to their complements,
as well as one containing positions 20 to 1 of the rubulavirus SV5
sequence (SV5), are shown above. The sequences of SeV strains H and Z,
which vary at position 18, are also shown. The distribution of
lengths of their P gene mRNA purine runs, as determined by primer
extension analysis limited with ddATP (as in Fig. 2 and 3), are shown
below.
|
|
We have previously described rSeV-Swap8 [or Swap(

16 to

9)], so
named because the 8 nt upstream of the SeV 5'
8AAAAAAGGG
+1 purine run (5'
16GA
CUCAAC
9) were replaced with
those of bPIV3 (5'
16AG
GGAAUU
9), and which led to
a significant fraction of the mRNAs (~40%)
with >+1G
(
21). The distribution of >+1G mRNAs in rSeV-Comp(

20
to

12)-infected cells, however, was much weaker than those of
rSeV-Swap(

16 to

9) infections (only 8%), possibly because
rSeV-Swap(

16
to

9) contains both the
14GGA
12 purine run and
11AUU
9. The relative importance of these
two elements in contributing
to multiple G insertions was estimated by
preparing and examining
rSeV-Swap(

16 to

12) (5'
16AG
GGAAAC
9), which contains
a
14GGA
12 purine run, but the
wild-type 5'
11AAC
9. When Swap(

16 to

12) and Swap(

16 to

9) were compared (Fig.
5), the extent of multiple G insertions
was much reduced when
11AAC
9 rather than
11AUU
9 is present (from 39 to 5%), but it
was still clearly detectable.
A 5'
14RRR
12
run thus also contributes to enhancing multiple G insertions,
but this
element is clearly less important than the presence of
5'
11AUU
9. Finally, we also prepared
rSeV-Comp/Swap(

16 to

9) in which
the 8 nt upstream present in bPIV3
(5'
16AG
GGAAUU
9) were changed
to the complementary sequence (5'
16UC
CCUUGG
9) except for
positions

10 and

9, which were 5' GG rather than
5' AA, so the
length of the 5' A
6 run would remain unaltered.
rSeV-Comp/Swap(

16 to

9), like rSeV-UUU (Fig.
3), continued to
edit
its mRNA with single G insertions at a somewhat reduced frequency
(15 to 20%). Since neither of these latter two rSeV contain either
a
5'
14RRR
12 run or
11AAC
9 or
11AUU
9, the 5' A
6G
3
slippery sequence by itself appears to be sufficient
to direct a
moderate level of single G insertions during mRNA
editing. The 5'
A
6G
3 slippery sequence by itself has previously
been shown to allow for insertions (and deletions) in the slippery
sequence during antigenome synthesis from non-hexamer-length
minigenomes
(
20).

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 5.
mRNA editing in rSeV-Swap( 16 to 9)-, Swap( 16 to
12)-, and Comp/Swap( 16 to 9)-infected cells. The sequences of the
various rSeVs in which positions 16 to 9 were exchanged for those
of bPIV3 [Swap( 16 to 9)] or the complement of the bPIV3 sequence
[comp/swap( 16 to 9)] or in which the sequences at positions 16
to 12 were exchanged for those of bPIV3 [swap( 16 to 12)] are
shown at the top of the figure. The distributions of lengths of their P
gene mRNA purine runs, as determined by primer extension analysis
limited with ddATP (as in Fig. 2 to 4), are shown below.
|
|
 |
DISCUSSION |
The catalytic subunits of all RNAPs, both cellular and viral, are
thought to have evolved from a common ancestor (9). Although detailed structural information for most RNAPs is not available, it is
generally assumed that all RNAPs have retained the basic structural
features of this enzyme (e.g., the aspartate triad that coordinates two
Mg2+ ions [26, 27]).
SeV RNAP, like other highly processive RNAPs, must grip the nascent RNA
and template tightly enough to prevent even a low frequency of
dissociation during elongation, yet loosely enough to translocate along
the chains quickly (ca. 6 nt/s for VSV or SeV in vitro [8a,
22]). To explain these paradoxical properties, the concept of
the sliding clamp has been proposed, analogous to the DNA replication
apparatus (34, 35). In current models of E. coli
RNAP, the sliding clamp is proposed to consist of three elements which
bind the template, the nascent RNA/template hybrid (~8 to 9 bp in
length [17, 40]), and the nascent RNA as it leaves the
RNAP. This latter site is also referred to as the tight product binding
site (7, 39). Together, these latter two elements should
cover 16 to 18 3'-proximal nucleotides of the mRNA, in accord with the
RNase protection data (references 40 and
53 and references therein) and the availability of
the nascent RNA to anneal to short oligonucleotides (33,
45). The observation that a strong RNA secondary structure
(hairpins) just upstream of the hybrid (at 7 to 9 nt from the RNA 3'
end) destabilizes the elongation ternary complex at termination sites
indicates that the nascent RNA binding site may be an area of important protein-RNA interactions (8, 26, 46).
SeV RNAP, like other RNAPs which respond to signals during elongation,
must also be able to reverse one or both of the above properties (high
ternary complex stability and smooth translocation along the chains) at
high efficiency at the single template positions where pausing and mRNA
editing (and presumably also polyadenylation and/or termination) are
programmed. Since only sequences upstream of the paramyxovirus 5'
AnGn run are conserved according to virus group
and editing pattern (Fig. 1A), the cis-acting sequences (other than the AnGn run) that help determine
this precise position are presumably found here. This work has provided
evidence that ca. six positions upstream of the
AnGn run (positions
14 to
9 relative to the
stutter site at position
1) can modulate the overall frequency of
mRNA editing as well as the distribution of the nucleotide insertions.
Moreover, the positions more proximal to the 5'
AnGn run are the most important in this
respect. Converting
11AAC
9 to the conserved
11AUU
9 in rSeV strongly increases the
overall fraction of mRNAs with insertions and particularly those with
two to six extra guanylates. Positions
14 to
12 appear to exert a
small but noticeable effect, whereas sequences upstream of position
14 appear not to play a role. The model of Fig. 1B, based on current
models of the bacterial and eucaryotic RNAP elongation complex
(53), assumes a constant 7 bp between the nascent mRNA and
the SeV genome (the maximum number of base pairs consistent with this
slippage mechanism). This number is based on the position of the
stutter site (C
1/C1052), the conserved length
of the respirovirus A6 run, and the need to leave
U
7 of the template U6 run initially unpaired
to accommodate realignment of the mRNA/template hybrid. The length of
the hybrid could be maintained by the entry of the mRNA chain into an
exit channel (or tight product-binding site) at this point, which
prevents further hybridization of the nascent RNA to the template
(41; see also Fig. 1B). If it is assumed that the
basic structural features of all RNAPs have been conserved throughout
evolution (9), the 5'
14CUCAAC
9
region of the SeV cis-acting sequence would be located in
the exit channel when the SeV RNAP catalytic center is at the stutter site. Base-specific interactions within the exit channel then provide a
possible explanation of how the upstream cis-acting sequences can modulate the insertion process by SeV RNAP. We note, however, that there is as yet no detailed structural information for
any mononegavirus RNAP.
RNAPs are thought to normally advance continuously along the template
during elongation as each nucleotide is added. At pause sites, however,
RNAP is thought to backtrack along the template and nascent mRNA
chains, unwinding the hybrid at the mRNA 3' end and reforming an equal
number of base pairs upstream (40). The number of positions
that RNAP backtracks varies according to the particular pause site
(19, 37, 42). The temporary loss of catalytic activity at
pause sites has been ascribed to the loss of contact between the mRNA
3' end and the enzyme's catalytic center. This process is reversible,
and RNAP at pause sites is envisaged as oscillating between the
inactive backtracked state and its return to the original active
location, from where RNAP can escape downstream (33). The
defining feature of paramyxovirus mRNA editing is that the pause site
coincides with a slippery sequence, i.e., one where mRNA 3' end
realignment can occur because the resulting hybrid is almost as stable
as the original one. Within this model for editing, the SeV RNAP would
backtrack by only a single position, leaving a single 3' nucleotide
unpaired. Realignment can then be envisaged as the translocation of the unpaired nucleotide from the mRNA 3' end to the upstream side of the
hybrid by a series of looping-out transitions (Fig. 1B), which is
energetically more favorable than simultaneously breaking and reforming
all of the base pairs. Realignment correctly repositions the mRNA 3'
end in the catalytic center, and nucleotide addition at this point
leads to a single pseudotemplated insertion. For SeV RNAP, backtracking
at the stutter site may be limited to a single position, since this
RNAP cannot edit its mRNA like rubulavirus RNAPs (i.e., by initiating
the process by the simultaneous addition of two guanylates) even when
they contain the appropriate cis-acting sequences (Fig. 4
and data not shown). If rubulavirus RNAPs, in contrast to those of
respiroviruses and morbilliviruses, can backtrack by two positions at
the stutter site, this will allow the translocation of a 2-nt bulge
which bypasses the unstable A:C pair (55). These differences
between the various paramyxovirus RNAPs could be due to different
specific base contacts in their respective exit channels.
The model as outlined in Fig. 1B predicts that varying the stability of
the mRNA/template hybrid should affect the editing process. Consistent
with this, partial replacement of GTP with ITP in the virion RNAP
reaction (which could act to weaken the hybrid by replacing G:C with
I:C base pairs) led to a strong enhancement of mRNA editing
(55). Since then, however, it was found that yeast RNAP III
and calf thymus RNAP II pause after incorporation of IMP (38,
52), and the enhancing effects of IMP incorporation on SeV mRNA
editing may have been due as well to extending the pause at the stutter
site. The experiment of Fig. 2, however, provides more direct evidence
that the stability of the hybrid per se plays a determining role in the
overall frequency and range of mRNA editing. Strengthening the hybrid
by converting the contiguous adenylates of the 5'
A6G3 site to guanylates progressively reduces the editing process, whereas weakening the hybrid by converting the
contiguous guanylates to adenylates progressively increases the
editing. There is thus an inverse relationship in rSeV-infected cells
between estimated hybrid stability (assuming a constant number of base
pairs) and the overall fraction of edited mRNAs, as well as the
distribution of the insertions. Furthermore, when the template U run
extends all the way to the stutter site
(rSeV-A8G1), the distribution of A insertions
is not limited to 1 to 6 nt, but mRNAs with an additional 1 to >20 nt
are found at roughly equal frequency. This dramatic extension of the
distribution of the insertions is presumably due not only to the
further weakening of the hybrid such that only A:U pairs are present.
There is now no loss of stability at all in forming the realigned
hybrid, because the hybrid is composed of homopolymers. The presence of
poly(A) in the exit channel may also stabilize realignment and further extend the distribution of the insertions.
Although the editing of the A8G1 mRNAs begins
to resemble 3' end formation of these viral mRNAs, it remains well
removed from the 100 or so adenylates found at the 3' ends of the
majority of paramyxovirus and rhabdovirus mRNAs. It is also not
associated with chain termination. For vesicular stomatitis virus
(VSV), a model mononegavirus with an exceptionally vigorous virion
transcriptase reaction, a similarly sized poly(A) tail is formed as
well under these in vitro conditions, indicating that this distribution
is due to virion proteins (13, 22). VSV mRNA polyadenylation takes place at a similar conserved cis-acting sequence
(3'-AUACUUUUUUUG versus
3'-AUUCUUUUUG for SeV), and Barr et al.
(1) have recently investigated the effect of mutating the
four bases upstream of the U run on VSV RNAP response at a gene
junction. They found that the upstream C (in boldface) was particularly
important, as any other base here prevented poly(A) termination and led
to read-through of the junction. Remarkably, when this C was mutated to
another base, VSV RNAP nevertheless inserted a relatively even distribution of ca. 6 to 15 adenylates before continuing on to transcribe the downstream gene, as did SeV RNAP at the
A8G1 editing site. Alteration of this critical
base-specific interaction for VSV RNAP at a poly(A)-termination site
eliminates termination and reduces stuttering to a maximum of ~20
cycles before resuming strictly templated synthesis. These VSV mRNAs
can be considered as having been edited.
How, then, can editing sites have evolved from poly(A)-termination
sites or vice versa? The model of Fig. 1B predicts that one way of
extending the number of insertions is to further weaken the stability
of the hybrid. Converting all the base pairs in the hybrid to A:U pairs
at the editing site, however, is insufficient for extensive
polyadenylation. Another way to weaken the hybrid is to reduce the
number of base pairs it contains. Inspection of the conserved SeV
cis-acting poly(A)-termination sequence
(3'-UNAUUCUUUUUG) in relation to the proposed
editing mechanism shows that there would be a maximum hybrid length of
only 4 bp (even if the stutter site is displaced to the most downstream
template uridylate (indicated in boldface) (Fig.
6). This leads to a relatively unstable
hybrid (
G of only
3 kcal/mol; dotted vertical line in Fig. 6).
Nascent mRNA chain realignment after NMP incorporation could then
become so favored over further NMP incorporation that stuttering is
prolonged, as presumably occurs during SeV mRNA 3'-end formation. The
manner in which mononegavirus RNAPs eventually cease stuttering and
release their mRNAs, however, remains unclear. The key difference
between mRNA editing and polyadenylation according to the scheme of
Fig. 6 is the shortening of the nascent chain-template hybrid in the latter process to help ensure the repetitive stuttering required for
poly(A) tail formation. This could occur by decreasing the distance
between the exit channel and the catalytic center, since there is
considerable internal flexibility in E. coli RNAP, at least
during chain initiation (7). Experiments to directly test
this notion for SeV cannot be carried out by modifying the resident P
gene, since extensive polyadenylation and/or termination at the editing
site will prevent virus viability. These experiments can best be
carried out by modifying an editing site within a supplemental (e.g.,
luciferase) trans gene.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 6.
Importance of hybrid stability in paramyxovirus RNAP
stuttering. The 5' nonapurine runs of the
rSeV-AnGn of Fig. 2 are aligned above the
conserved SeV poly(A)-termination signal (bottom line of panel A). The
seven purines thought to be hybridized to the [ ] genome when the
transcription elongation complex is at the editing site are boxed, as
are the proposed four adenylates hybridized to the [ ] genome when
the elongation complex is at the polyadenylation site (A). A comparison
of the proposed stuttering structures of the
rSeV-A8G1 transcription elongation complex at
the editing and poly(A)-termination sites is shown in panel B. Note
that in the poly(A) structure the stutter site has been displaced
downstream by one position relative to the alignment shown in panel A,
which would allow for a hybrid with a maximum of only 3 bp. The
stabilities of the various hybrids (Serra et al.
[49]), along with the distributions of insertions
which result, are listed in panel A and are plotted in panel C. The
vertical dashed line in panel C indicates the stability of the proposed
4-bp hybrid during polyadenylation as shown in panel B.
|
|
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Genetics, University of Geneva School of Medicine, CMU, 9 Ave. de
Champel, CH1211 Geneva, Switzerland. Phone: (41 22) 702-5657. Fax: (41 22) 702-5702. E-mail:
Daniel.Kolakofsky{at}medecine.unige.ch.
 |
REFERENCES |
| 1.
|
Barr, J. N.,
S. P. Whelan, and G. W. Wertz.
1997.
cis-Acting signals involved in termination of vesicular stomatitis virus mRNA synthesis include the conserved AUAC and the U7 signal for polyadenylation.
J. Virol.
71:8718-8725[Abstract].
|
| 2.
|
Benne, R.
1993.
RNA editing: an overview, p. 13-24.
In
R. Benne (ed.), RNA editing. Ellis Horwood, Chichester, England.
|
| 3.
|
Benne, R.,
J. Van den Burg,
J. P. Brakenhoff,
P. Sloof,
J. H. Van Boom,
M. C. Tromp, and M. C. Major.
1986.
Transcript of the frameshifted coxII gene from trypanosome mitochondria contains four nucleotides that are not encoded in the DNA.
Cell
46:819-826[Medline].
|
| 4.
|
Brierley, I.,
P. Digard, and S. C. Inglis.
1989.
Characterization of an efficient coronavirus ribosomal frameshifting signal: requirement for an RNA pseudoknot.
Cell
57:537-547[Medline].
|
| 5.
|
Calain, P., and L. Roux.
1993.
The rule of six: a basic feature for efficient replication of Sendai virus defective interfering RNA.
J. Virol.
67:4822-4830[Abstract/Free Full Text].
|
| 6.
|
Cattaneo, R.,
K. Kaelin,
K. Baczko, and M. A. Billeter.
1989.
Measles virus editing provides an additional cysteine-rich protein.
Cell
56:759-764[Medline].
|
| 7.
|
Chamberlin, M. J.
1995.
New models of transcription elongation and termination.
Harvey Lect.
88:1-21.
|
| 8.
|
Chan, C. L.,
D. Wang, and R. Landick.
1997.
Multiple interactions stabilize a single paused transcription intermediate in which hairpin to 3' end spacing distinguishes pause and termination pathways.
J. Mol. Biol.
268:54-68[Medline].
|
| 8a.
| Curran, J. Unpublished data.
|
| 9.
|
Delarue, M.,
O. Poch,
N. Tordo,
D. Moras, and P. Argos.
1990.
An attempt to unify the structure of polymerases.
Protein Eng.
3:461-467[Abstract/Free Full Text].
|
| 10.
|
Delenda, C.,
S. Hausmann,
D. Garcin, and D. Kolakofsky.
1997.
Normal replication of Sendai virus in cultured cells and embryonated chicken eggs without the trans-frame nonstructural V protein.
Virology
228:55-62[Medline].
|
| 11.
|
Delenda, C.,
G. Taylor,
S. Hausmann,
D. Garcin, and D. Kolakofsky.
1998.
Sendai viruses with altered P, V, and W protein expression.
Virology
242:327-337[Medline].
|
| 12.
|
Egelman, E. H.,
S. S. Wu,
M. Amrein,
A. Portner, and G. Murti.
1989.
The Sendai virus nucleocapsid exists in at least four different helical states.
J. Virol.
63:2233-2243[Abstract/Free Full Text].
|
| 13.
|
Ehrenfeld, E., and D. F. Summers.
1972.
Adenylate-rich sequences in vesicular stomatitis virus messenger ribonucleic acid.
J. Virol.
10:683-688[Abstract/Free Full Text].
|
| 14.
|
Fuerst, T. R.,
E. G. Niles,
F. W. Studier, and B. Moss.
1986.
Eukaryotic transient-expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase.
Proc. Natl. Acad. Sci. USA
83:8122-8126[Abstract/Free Full Text].
|
| 15.
|
Garcin, D.,
T. Pelet,
P. Calain,
L. Roux,
J. Curran, and D. Kolakofsky.
1995.
A highly recombinogenic system for the recovery of infectious Sendai paramyxovirus from cDNA: generation of a novel copy-back nondefective interfering virus.
EMBO J.
14:6087-6094[Medline].
|
| 16.
|
Garcin, D.,
M. Itoh, and D. Kolakofsky.
1997.
A point mutation in the Sendai virus accessory C proteins attenuates virulence for mice, but not virus growth in cell culture.
Virology
238:424-431[Medline].
|
| 17.
|
Gelles, J., and R. Landick.
1998.
RNA polymerase as a molecular motor.
Cell
93:13-16[Medline].
|
| 18.
|
Grosjean, H., and R. Benne (ed.).
1998.
Modification and editing of RNA.
ASM Press, Washington, D.C.
|
| 19.
|
Gu, W., and D. Reines.
1995.
Identification of a decay in transcription potential that results in elongation factor dependence of RNA polymerase II.
J. Biol. Chem.
270:11238-11244[Abstract/Free Full Text].
|
| 20.
|
Hausmann, S.,
J.-P. Jacques, and D. Kolakofsky.
1996.
Paramyxovirus RNA editing and the requirement for hexamer genome length.
RNA
2:1033-1045[Abstract].
|
| 21.
|
Hausmann, S.,
D. Garcin,
A.-S. Morel, and D. Kolakofsky.
1999.
Two nucleotides immediately upstream of the essential A6G3 slippery sequence modulate the pattern of G insertions during Sendai virus mRNA editing.
J. Virol.
73:343-351[Abstract/Free Full Text].
|
| 22.
|
Iverson, L. E., and J. K. Rose.
1981.
Localized attenuation and discontinuous synthesis during vesicular stomatitis virus transcription.
Cell
23:477-484[Medline].
|
| 23.
|
Jacks, T., and H. E. Varmus.
1985.
Expression of the Rous sarcoma virus pol gene by ribosomal frameshifting.
Science
230:1237-1242[Abstract/Free Full Text].
|
| 24.
|
Jacques, J.-P., and D. Kolakofsky.
1991.
Pseudo-templated transcription in prokaryotic and eukaryotic organisms.
Genes Dev.
5:707-713[Free Full Text].
|
| 25.
|
Jacques, J.-P.,
S. Hausmann, and D. Kolakofsky.
1994.
Paramyxovirus mRNA editing leads to G deletions as well as insertions.
EMBO J.
13:5496-5503[Medline].
|
| 26.
|
Jeruzalmi, D., and T. A. Steitz.
1998.
Structure of T7 RNA polymerase complexed to the transcriptional inhibitor T7 lysozyme.
EMBO J.
17:4101-4113[Medline].
|
| 27.
|
Joyce, C. M., and T. A. Steitz.
1994.
Function and structure relationships in DNA polymerases.
Annu. Rev. Biochem.
63:777-822[Medline].
|
| 28.
|
Kato, A.,
K. Kiyotani,
Y. Sakai,
T. Yoshida, and Y. Nagai.
1997.
The paramyxovirus Sendai virus V protein encodes a luxury function required for viral pathogenesis.
EMBO J.
16:678-587.
|
| 29.
|
Kato, A.,
K. Kiyotani,
Y. Sakai,
T. Yoshida,
T. Shioda, and Y. Nagai.
1997.
Importance of the cysteine-rich carboxyl-terminal half of V protein for Sendai virus pathogenesis.
J. Virol.
71:7266-7272[Abstract].
|
| 30.
|
Kolakofsky, D.,
J. Curran,
T. Pelet, and J.-P. Jacques.
1993.
Paramyxovirus P gene mRNA editing, p. 105-123.
In
R. Benne (ed.), RNA editing. Ellis Horwood, Chichester, England.
|
| 31.
|
Kolakofsky, D.,
T. Pelet,
D. Garcin,
S. Hausmann,
J. Curran, and L. Roux.
1998.
Paramyxovirus RNA synthesis and the requirement for hexamer genome length: the rule of six revisited.
J. Virol.
72:891-899[Free Full Text].
|
| 32.
|
Kolakofsky, D., and S. Hausmann.
1998.
Cotranscriptional paramyxovirus mRNA editing: a contradiction in terms?, p. 413-420.
In
H. Grosjean, and R. Benne (ed.), Modification and editing of RNA. ASM Press, Washington, D.C.
|
| 33.
|
Komisarrova, N., and M. Kashlev.
1997.
Arrest of transcription: E. coli RNA polymerase translocates backward leaving the 3' end of the RNA intact and extruded.
Proc. Natl. Acad. Sci. USA
94:1755-1760[Abstract/Free Full Text].
|
| 34.
|
Kong, X. P.,
R. Onrust,
M. O'Donnell, and J. Kuriyan.
1992.
Three-dimensional structure of the beta subunit of E. coli DNA polymerase III holoenzyme: a sliding DNA clamp.
Cell
69:425-437[Medline].
|
| 35.
|
Kuriyan, J., and M. O'Donnell.
1993.
Sliding clamps of DNA polymerases.
J. Mol. Biol.
234:915-925[Medline].
|
| 36.
|
Lamb, R. A., and D. Kolakofsky.
1996.
Paramyxoviridae: the viruses and their replication, p. 1177-1204.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed. Raven Press, New York, N.Y.
|
| 37.
|
Landick, R.
1997.
RNA polymerase slides home: pause and termination site recognition.
Cell
88:741-744[Medline].
|
| 38.
|
Matsuzaki, H.,
G. A. Kassavetis, and E. P. Geiduschek.
1994.
Analysis of RNA chain elongation and termination by Saccharomyces cerevisiae RNA polymerase III.
J. Mol. Biol.
235:1173-1192[Medline].
|
| 39.
|
Nudler, E.,
E. Avetissova,
V. Markovtsov, and A. Goldfarb.
1996.
Transcription processivity: RNA polymerase-DNA interactions holding together the elongation complex.
Science
273:211-217[Abstract].
|
| 40.
|
Nudler, E.,
A. Mustaev,
E. Lukhtanov, and A. Goldfarb.
1997.
The RNA-DNA hybrid maintains the register of transcription by preventing backtracking of RNA polymerase.
Cell
89:33-41[Medline].
|
| 41.
|
Nudler, E.,
I. Gusarov,
E. Avetissova,
M. Kozlov, and A. Goldfarb.
1998.
Spatial organization of transcription elongation complex in Escherichia coli.
Science
281:424-428[Abstract/Free Full Text].
|
| 42.
|
Palangat, M.,
T. I. Meier,
R. G. Keene, and R. Landick.
1998.
Transcriptional pausing at +62 of the HIV-1 nascent RNA modulates formation of the TAR RNA structure.
Mol. Cell
1:1033-1042[Medline].
|
| 43.
|
Pelet, T.,
J. Curran, and D. Kolakofsky.
1991.
The P gene of bovine parainfluenza virus 3 expresses all three reading frames from a single mRNA editing site.
EMBO J.
10:443-448[Medline].
|
| 44.
|
Radecke, F.,
P. Spielhofer,
H. Schneider,
K. Kaelin,
M. Huber,
C. Dötsch,
G. Christiansen, and M. A. Billeter.
1995.
Rescue of measles viruses from cloned DNA.
EMBO J.
14:5773-5784[Medline].
|
| 45.
|
Reeder, T. C., and D. K. Hawley.
1996.
Promoter proximal sequences modulate RNA polymerase II elongation by a novel mechanism.
Cell
87:767-777[Medline].
|
| 46.
|
Sastry, S., and B. M. Ross.
1998.
RNA-binding site in T7 RNA polymerase.
Proc. Natl. Acad. Sci. USA
95:9111-9116[Abstract/Free Full Text].
|
| 47.
|
Schneider, H.,
K. Kaelin, and M. A. Billeter.
1997.
Recombinant measles viruses defective for RNA editing and V protein synthesis are viable in cultured cells.
Virology
227:314-322[Medline].
|
| 48.
|
Schnell, M. J.,
T. Mebatsion, and K. K. Conzelmann.
1994.
Infectious rabies viruses from cloned cDNA.
EMBO J.
13:4195-4203[Medline].
|
| 49.
|
Serra, M. J.,
D. H. Turner, and S. M. Freier.
1995.
Predicting thermodynamic properties of RNA.
Methods Enzymol.
259:243-261.
|
| 50.
|
Smith, H. C.,
J. M. Gott, and M. R. Hanson.
1997.
A guide to RNA editing.
RNA
3:1105-1123[Medline].
|
| 51.
|
Thomas, S. M.,
R. A. Lamb, and R. G. Paterson.
1988.
Two mRNAs that differ by two nontemplated nucleotides encode the amino coterminal proteins P and V of the paramyxovirus SV5.
Cell
54:891-892[Medline].
|
| 52.
|
Thomas, M. J.,
A. A. Platas, and D. K. Hawley.
1998.
Transcriptional fidelity and proofreading by RNA polymerase II.
Cell
15:627-637.
|
| 53.
|
Uptain, S. M.,
C. M. Kane, and M. J. Chamberlin.
1997.
Basic mechanisms of transcript elongation and its regulation.
Annu. Rev. Biochem.
66:117-172[Medline].
|
| 54.
|
Vidal, S.,
J. Curran, and D. Kolakofsky.
1990.
Editing of the Sendai virus P/C mRNA by G insertion occurs during mRNA synthesis via a virus-encoded activity.
J. Virol.
64:239-246[Abstract/Free Full Text].
|
| 55.
|
Vidal, S.,
J. Curran, and D. Kolakofsky.
1990.
A stuttering model for paramyxovirus P mRNA editing.
EMBO J.
9:2017-2022[Medline].
|
| 56.
|
Visomirski-Robic, L. M., and J. M. Gott.
1997.
Insertional editing in isolated Physarum mitochondria is linked to RNA synthesis.
RNA
3:821-837[Abstract].
|
| 57.
|
Visomirski-Robic, L. M., and J. M. Gott.
1997.
Insertional editing of nascent mitochondrial RNAs in Physarum.
Proc. Natl. Acad. Sci. USA
94:4324-4329[Abstract/Free Full Text].
|
| 58.
|
von Hippel, P. H., and T. D. Yager.
1992.
The elongation-termination decision in transcription.
Science
255:809-812[Abstract/Free Full Text].
|
| 59.
|
von Hippel, P. H.
1998.
An integrated model of the transcription complex in elongation, termination, and editing.
Science
281:660-665[Abstract/Free Full Text].
|
| 60.
|
Weiss, R. B.,
D. M. Dunn,
J. F. Atkins, and R. F. Gesteland.
1990.
Ribosomal frameshifting from 2 to +50 nucleotides.
Prog. Nucleic Acid Res. Mol. Biol.
30:159-183.
|
Journal of Virology, July 1999, p. 5568-5576, Vol. 73, No. 7
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kulkarni, S., Volchkova, V., Basler, C. F., Palese, P., Volchkov, V. E., Shaw, M. L.
(2009). Nipah Virus Edits Its P Gene at High Frequency To Express the V and W Proteins. J. Virol.
83: 3982-3987
[Abstract]
[Full Text]
-
Belshaw, R., de Oliveira, T., Markowitz, S., Rambaut, A.
(2009). The RNA Virus Database. Nucleic Acids Res
37: D431-D435
[Abstract]
[Full Text]
-
Dinwiddie, D. L., Harrod, K. S.
(2008). Human Metapneumovirus Inhibits IFN-{alpha} Signaling through Inhibition of STAT1 Phosphorylation. Am. J. Respir. Cell Mol. Bio.
38: 661-670
[Abstract]
[Full Text]
-
Wang, J. T., McElvain, L. E., Whelan, S. P. J.
(2007). Vesicular Stomatitis Virus mRNA Capping Machinery Requires Specific cis-Acting Signals in the RNA. J. Virol.
81: 11499-11506
[Abstract]
[Full Text]
-
Belshaw, R., Pybus, O. G., Rambaut, A.
(2007). The evolution of genome compression and genomic novelty in RNA viruses. Genome Res
17: 1496-1504
[Abstract]
[Full Text]
-
Biacchesi, S., Murphy, B. R., Collins, P. L., Buchholz, U. J.
(2007). Frequent Frameshift and Point Mutations in the SH Gene of Human Metapneumovirus Passaged In Vitro. J. Virol.
81: 6057-6067
[Abstract]
[Full Text]
-
Wierzchoslawski, R., Bujarski, J. J.
(2006). Efficient In Vitro System of Homologous Recombination in Brome Mosaic Bromovirus.. J. Virol.
80: 6182-6187
[Abstract]
[Full Text]
-
Kolakofsky, D., Roux, L., Garcin, D., Ruigrok, R. W. H.
(2005). Paramyxovirus mRNA editing, the 'rule of six' and error catastrophe: a hypothesis. J. Gen. Virol.
86: 1869-1877
[Abstract]
[Full Text]
-
Meng, Q., Turnbough, C. L. Jr., Switzer, R. L.
(2004). Attenuation control of pyrG expression in Bacillus subtilis is mediated by CTP-sensitive reiterative transcription. Proc. Natl. Acad. Sci. USA
101: 10943-10948
[Abstract]
[Full Text]
-
Kurath, G., Batts, W. N., Ahne, W., Winton, J. R.
(2004). Complete Genome Sequence of Fer-de-Lance Virus Reveals a Novel Gene in Reptilian Paramyxoviruses. J. Virol.
78: 2045-2056
[Abstract]
[Full Text]
-
Mebatsion, T., de Vaan, L. T. C., de Haas, N., Romer-Oberdorfer, A., Braber, M.
(2003). Identification of a Mutation in Editing of Defective Newcastle Disease Virus Recombinants That Modulates P-Gene mRNA Editing and Restores Virus Replication and Pathogenicity in Chicken Embryos. J. Virol.
77: 9259-9265
[Abstract]
[Full Text]
-
Huang, Z., Krishnamurthy, S., Panda, A., Samal, S. K.
(2003). Newcastle Disease Virus V Protein Is Associated with Viral Pathogenesis and Functions as an Alpha Interferon Antagonist. J. Virol.
77: 8676-8685
[Abstract]
[Full Text]
-
Cartee, T. L., Megaw, A. G., Oomens, A. G. P., Wertz, G. W.
(2003). Identification of a Single Amino Acid Change in the Human Respiratory Syncytial Virus L Protein That Affects Transcriptional Termination. J. Virol.
77: 7352-7360
[Abstract]
[Full Text]
-
Le Mercier, P., Garcin, D., Hausmann, S., Kolakofsky, D.
(2002). Ambisense Sendai Viruses Are Inherently Unstable but Are Useful To Study Viral RNA Synthesis. J. Virol.
76: 5492-5502
[Abstract]
[Full Text]
-
Shmulevitz, M., Yameen, Z., Dawe, S., Shou, J., O'Hara, D., Holmes, I., Duncan, R.
(2002). Sequential Partially Overlapping Gene Arrangement in the Tricistronic S1 Genome Segments of Avian Reovirus and Nelson Bay Reovirus: Implications for Translation Initiation. J. Virol.
76: 609-618
[Abstract]
[Full Text]
-
Gubbay, O., Curran, J., Kolakofsky, D.
(2001). Sendai virus genome synthesis and assembly are coupled: a possible mechanism to promote viral RNA polymerase processivity. J. Gen. Virol.
82: 2895-2903
[Abstract]
[Full Text]
-
Barr, J. N., Wertz, G. W.
(2001). Polymerase Slippage at Vesicular Stomatitis Virus Gene Junctions To Generate Poly(A) Is Regulated by the Upstream 3'-AUAC-5' Tetranucleotide: Implications for the Mechanism of Transcription Termination. J. Virol.
75: 6901-6913
[Abstract]
[Full Text]
-
Harmon, S. B., Megaw, A. G., Wertz, G. W.
(2001). RNA Sequences Involved in Transcriptional Termination of Respiratory Syncytial Virus. J. Virol.
75: 36-44
[Abstract]
[Full Text]
-
Cheng, Y., Dylla, S. M., Turnbough, C. L. Jr.
(2001). A Long T {middle dot} A Tract in the upp Initially Transcribed Region Is Required for Regulation of upp Expression by UTP-Dependent Reiterative Transcription in Escherichia coli. J. Bacteriol.
183: 221-228
[Abstract]
[Full Text]
-
George, J., Raju, R.
(2000). Alphavirus RNA Genome Repair and Evolution: Molecular Characterization of Infectious Sindbis Virus Isolates Lacking a Known Conserved Motif at the 3' End of the Genome. J. Virol.
74: 9776-9785
[Abstract]
[Full Text]
-
Chua, K. B., Bellini, W. J., Rota, P. A., Harcourt, B. H., Tamin, A., Lam, S. K., Ksiazek, T. G., Rollin, P. E., Zaki, S. R., Shieh, W., Goldsmith, C. S., Gubler, D. J., Roehrig, J. T., Eaton, B., Gould, A. R., Olson, J., Field, H., Daniels, P., Ling, A. E., Peters, C. J., Anderson, L. J., Mahy, B. W.
(2000). Nipah Virus: A Recently Emergent Deadly Paramyxovirus. Science
288: 1432-1435
[Abstract]
[Full Text]