Previous Article | Next Article 
Journal of Virology, July 1999, p. 5556-5567, Vol. 73, No. 7
Department of Microbiology, University of
Pennsylvania School of Dental Medicine, Philadelphia, Pennsylvania
19104
Received 9 February 1999/Accepted 15 April 1999
In the immediate-early phase of reactivation or primary infection,
herpesviruses express a small number of genes without requiring prior
viral protein synthesis. Immediate-early genes usually encode regulatory proteins critical for the viral life cycle. Kaposi's sarcoma-associated herpesvirus (KSHV) gene transcription in the immediate-early stage of viral reactivation was examined by using a
chemical induction combined with a gene expression screening method.
RNA transcripts from at least four KSHV genomic loci accumulate when
latently infected B-lymphoma cells are induced for reactivation in the
presence of an inhibitor of protein synthesis (cycloheximide) and thus
represent immediate-early class transcripts. Among them, a 3.6-kb
mRNA encodes three putative open reading frames (ORFs), namely,
ORF50, K8, and K8.2. ORF50 is a homologue of Rta, a transcription activator encoded by Epstein-Barr virus (EBV). The K8 gene codes for a
237-amino-acid protein with a basic-leucine zipper domain near its C
terminus and an acidic domain near its N terminus and which closely
resembles the ZEBRA protein of EBV and Jun/Fos family proteins. Other
immediate-early mRNAs of KSHV include a 1.7-kb mRNA encoding
ORF45, a 2.0-kb mRNA encoding ORF K4.2, and a 4.5-kb mRNA.
Functional roles of products of these KSHV immediate-early transcripts
remain to be studied.
Kaposi's sarcoma-associated
herpesvirus (KSHV) is a newly identified human herpesvirus
(6). It is also designated human herpesvirus 8. Epidemiological studies of KSHV suggest that this virus is an etiologic
agent of Kaposi's sarcoma (KS), the most common AIDS-related
malignancy. For instance, DNA sequences of this virus were consistently
found in KS lesions of all epidemiological forms (i.e., classic,
AIDS-associated, African endemic, and posttransplant KS). Furthermore,
serological assays suggest that KSHV is not ubiquitous but is closely
associated with those at risk for developing KS (reviewed in references
9 and 27). In addition, the KSHV genome is present in several other proliferative lesions including those of primary effusion lymphoma (also known as body cavity-based lymphoma) and multicentric Castleman's disease (4, 28).
The complete nucleotide sequence of one KSHV isolate (BC-1) has been
published (24). Based on sequence analysis, KSHV has been
classified as a member of the gammaherpesvirus 2 subfamily, Rhodinovirus genus. Another member of this viral group found
in primates is herpesvirus saimiri. KSHV is also closely related to
Epstein-Barr virus (EBV). Gammaherpesviruses characteristically establish latent infections in lymphoid cells. In latently infected cells that contain a limited number of herpesvirus genomes, there is no
infectious virus. Latent viral DNA expresses a limited number of genes,
which are referred to as latent genes. In KSHV, four genes that code
for v-cyclin, latency-associated nuclear antigen (LANA), v-FLIP, and
kaposin have been identified as latent genes (11, 17, 20,
26). When latency is disrupted, the virus can switch to a lytic
life cycle. The switch of KSHV in primary effusion lymphoma cells from
latency to lytic replication can be induced by various chemicals, such
as tetradecanoyl phorbol acetate (TPA) and n-butyrate
(14, 21).
The switch between latency and lytic life cycle is a crucial event that
allows for the propagation of viruses. Our interest in the switch
mechanism of KSHV also derives from the notion that the diseases caused
by KSHV may be associated with the reactivation of latent virus. First,
unique among all human herpesviruses, KSHV encodes several cytokines
and a cytokine receptor. These include genes homologous to
interleukin-6 (IL-6), three beta-chemokines, and a CXC cytokine
receptor (reviewed in reference 18). The presence of
cytokine signaling genes in the KSHV genome is intriguing because the
virus is closely associated with a disease (KS) which has long been
known as a cytokine disorder (7, 8). Unlike tumor-associated
genes in other DNA tumor viruses, such as those for EBV-encoded EBNA-2,
EBNA-3, and LMPs, which are latent genes (12), the KSHV
cytokine signaling genes are expressed after the virus is induced to
enter a lytic cycle in primary effusion lymphoma cell lines (16,
34). This raises the possibility that the KSHV lytic life cycle
may be responsible for KS pathogenesis. Second, because KS is an
endothelial neoplasm and latent KSHV infection is established in
lymphocytes well before the onset of KS, it has been proposed that
reactivation of lytic KSHV infection from the latently infected
lymphoid reservoir is a necessary antecedent step in KS development
(12a). Thus, the switch of the virus from latent to lytic
replication appears to be important not only for viral propagation but
also for viral pathogenicity. However, very little is known about the
nature of the switch.
Herpesvirus genes can be classified into four categories: latent genes,
immediate-early (IE) genes, early genes, and late genes. IE genes are
the first class of the viral genes expressed after primary infection or
reactivation. As transcription of IE genes does not require prior viral
protein synthesis, this class of genes is experimentally defined by
their transcription following primary infection or reactivation in the
presence of inhibitors of protein synthesis. IE genes usually encode
regulatory proteins that alter the expression of viral and cellular
genes during the course of infection or reactivation. Therefore,
herpesvirus IE genes play crucial roles in the switch from latency to
lytic life cycle. The purpose of the work described in this paper was
to identify KSHV IE genes so that their roles in the regulation of KSHV
switch from latency to lytic life cycle could be studied. Through the
use of a gene expression screening method which was developed based on
cDNA subtractive selection, several KSHV IE transcripts were
identified and characterized. Identification of KSHV IE transcripts was
the first step in efforts toward understanding mechanisms of the
viral reactivation.
Cell cultures and cosmid DNAs.
BC-1 (5) cells
were purchased from the American Type Culture Collection and grown in
RPMI 1640 medium (Gibco-BRL, Gaithersburg, Md.) supplemented with 15%
fetal bovine serum (Gibco-BRL). BCBL-1 (21) cells were
obtained from the National Institutes of Health AIDS Research and
Reference Reagent Program and grown in RPMI 1640 medium supplemented
with 10% fetal bovine serum. All cultures contained
penicillin-streptomycin (50 U/ml) and amphotericin B (Fungizone) (1.25 µg of amphotericin B per ml and 1.25 µg of sodium desoxycholate per ml).
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Identification of the Immediate-Early Transcripts
of Kaposi's Sarcoma-Associated Herpesvirus
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Chemical induction. BC-1 and BCBL-1 cells were induced with 3 mM sodium butyrate (Sigma, St. Louis, Mo.). When induction was accompanied by inhibition of protein synthesis, cycloheximide (Sigma) was added in the culture to 100 µg/ml 4 h prior to induction.
Subtractive cDNA cloning. Total RNAs were purified with Trizol reagent (Gibco-BRL) from 108 BC-1 cells that had been treated with 3 mM sodium butyrate for 4 h in the presence of 100 µg of cycloheximide per ml, as well as from the same number of cells that had not been treated with sodium butyrate but had been incubated with cycloheximide for 8 h. Poly(A)+ RNAs were purified with the PolyAtract mRNA isolation system (Promega, Madison, Wis.). The double-stranded cDNAs were synthesized with the Universal riboclone cDNA synthesis system (Promega).
The cDNA subtraction procedure was established based on the work of Wang and Brown (31) and Patel and Sive (1) with modifications. The double-stranded cDNAs were digested completely with AluI and then ligated with 0.5 µg of double-stranded linker which was prepared by annealing oligodeoxyribonucleotide Ad-1A (5' GATCCCAGTCACGACGAATTCC 3') and phosphorylated Ad-1B (5' pGGAATTCGTCGTGACTGG 3'). The ligated samples were loaded on a 1.4% low-melting-point agarose gel, and cDNA fragments in the size range of 0.2 to 1 kb were collected. Linker-ligated cDNA fragments were amplified by PCR with oligonucleotide Ad-1A as primer. cDNA fragments prepared from the induced and uninduced cells were amplified by PCR and served as tracer and driver DNAs, respectively. The driver DNA was biotinylated during PCR by incorporating bio-11-dUTP (Enzo Diagnostics, Farmingdale, N.Y.), followed by a complete digestion with EcoRI to cleave the linker. Twenty micrograms of biotinylated driver cDNA(
) (cDNA prepared from noninduced
BC-1 cells) was mixed with 1 to 1.5 µg of nonbiotinylated tracer
cDNA(+) (cDNA prepared from butyrate-induced BC-1 cells) in 10 µl of H2O. The DNA mixture was heated at 100°C for 3 min, and then 10 µl of 2× hybridization buffer (1× buffer is 50 mM
HEPES [pH 7.5], 0.2% sodium dodecyl sulfate, 2 mM EDTA, 500 mM NaCl)
was added. The DNA solution was overlaid with mineral oil and incubated
in a 68°C water bath for 20 h. The hybridization mixture was
diluted with 80 µl of HE buffer (10 mM HEPES, 1 mM EDTA, pH 7.5) to
bring the final NaCl concentration to 100 mM. Twenty microliters of streptavidin (2 mg/ml in 0.15 M NaCl, 10 mM HEPES, 1 mM EDTA, pH
7.5) was mixed with the hybridized DNA solution and incubated at room
temperature for 10 min. The streptavidin and associated DNAs were then
removed from the solution by extraction with an equal volume of phenol.
Streptavidin-phenol extraction was repeated three times. The subtracted
tracer cDNA(+) was mixed with 10 µg of biotinylated driver
cDNA() and coprecipitated with ethanol. The DNAs were denatured
and hybridized as described above, except that the hybridization was
carried out for 2 h. Biotinylated DNAs were removed by using
streptavidin-phenol extraction as described above. The enriched DNAs
were amplified by PCR and used for the next cycle of subtractive hybridization.
After the seventh cycle of subtraction, enriched DNA was used to
prepare 32P-labeled probe for Southern analysis. The DNA
was also digested with EcoRI and cloned into pBluescript at
the EcoRI site. Colonies were screened by hybridization with
32P-labeled KSHV genomic DNA fragments excised from six
cosmids, and the clones that were hybridized detectably were picked up for miniassay and sequencing analysis.
Southern analysis.
Six KSHV cosmid DNAs were digested with
EcoRI, BamHI, or both and separated in 0.8%
agarose gels. DNAs were transferred onto a Nytran membrane (Schleicher
& Schuell, Keene, N.H.) and probed with 32P-labeled probes.
The probes were PCR-amplified total cDNA fragments prepared from
sodium butyrate-induced and uninduced BC-1 cells in the presence of
cycloheximide and the enriched cDNA fragments derived from the
cDNA subtractive selection. These cDNAs were labeled by the
random priming method with [
-32P]dCTP (Amersham,
Arlington Heights, Ill.).
Northern analysis.
Total RNA was isolated from cells with
Trizol reagent, and poly(A)+ mRNA was purified with the
PolyAtract mRNA isolation system. The mRNA was separated by
electrophoresis in a 1% agarose-6% formaldehyde gel in 20 mM
morpholinepropanesulfonic acid (MOPS) buffer, pH 7.0. Each lane was
loaded with mRNA from 2 × 107 cells. The RNA was
transferred to a Nytran membrane and hybridized with a single-stranded
32P-labeled probe. Single-stranded DNA probes were prepared
by asymmetric PCR with linearized plasmid templates and specific
oligonucleotide primers, which were either a plasmid vector primer
(i.e., KS or SK primers in pBluescript) or a primer specific to an
insert sequence. The labeling reactions were performed in 15 µl of
reaction solution (1× Taq polymerase buffer; 16.67 µM
(each) dATP, dGTP, and dTTP; 1.67 µM dCTP; 5 µl of
[-32P]dCTP [800 Ci/mmol; 10 µCi/µl; Amersham];
100 ng of DNA; 20 pmol of primer; 2.5 U of Taq polymerase).
The PCR was initiated with a denaturing step of 2 min at 94°C,
followed by 15 cycles of sequential steps of 1 min at 94°C, 1 min at
50°C, and 3 min at 74°C. Finally, the reaction was extended for 10 min at 74°C. RNA loading equivalence was controlled by probing with
-actin cDNA. An RNA ladder (0.24 to 9.5 kb; Gibco-BRL) was
included in each agarose-formaldehyde gel and detected in Northern
blots by hybridization with labeled 
DNA.
Cloning of IE full-length cDNAs. The full-length cDNAs of IE mRNAs were generated by a PCR-based cDNA amplification strategy. Poly(A)+ RNA was isolated from BC-1 cells that had been treated with sodium butyrate for 4 h. Double-stranded cDNA was synthesized with avian myeloblastosis virus reverse transcriptase and cDNA synthesis primer [a modified lock-docking oligo(dT) primer; Clontech, Palo Alto, Calif.]. After ligation of the cDNAs with an adapter, the 5' portion and 3' portion of each cDNA were obtained by using the Marathon cDNA amplification kit (Clontech). Nested primers designed to clone open reading frame 50 (ORF50) transcript were ORF50-RACE1 (5' CGACCACGACACCTGGTACCTCTTTGGG 3', nucleotides 74178 to 74205), ORF50-RACE2 (5' CATGTTTCAGGGCCCGCTTCGTCTAACA 3', nucleotides 74358 to 74331), ORF50-RACE3 (5' ATGCGCAGAGGCATCCCAAGGCATTATT 3', nucleotides 72859 to 72886), and ORF50-RACE4 (5' CAGCCCGGCGGTATCGTACGTGTTGTAG 3', nucleotides 73117 to 73090). To obtain the 5' rapid-amplification-of-cDNA-end fragment of ORF50 transcript, the cDNA pool was amplified first with ORF50-RACE2 and AP1 from the Marathon cDNA kit. The PCR products were then amplified with ORF50-RACE4 and AP2 from the kit. Similarly, the 3' portion was obtained through two PCRs, ORF50-RACE3 and AP1 being used in the first reaction and ORF50-RACE1 and AP2 being used in the second. DNA fragments of 0.6 and 2.0 kb were obtained in the 5' and 3' rapid-amplification-of-cDNA-end reactions, respectively. The central portion was generated by PCR with ORF50-RACE2 and ORF50-RACE3. These three PCR products were cloned into T/A-type PCR cloning vectors (pCR2.1; Invitrogen, Carlsbad, Calif.) and sequenced.
The full-length cDNAs for ORF45 and ORF K4.2 mRNAs were obtained by the same strategy. Nested primers designed to clone these two transcripts were ORF45-RACE1 (5' GGCGTCCATGGGATGGGTTAGTCAGGAT 3', nucleotides 68097 to 68070), ORF45-RACE2 (5' ACGTCCGGAGAGTTGGAACTGTCATCGC 3', nucleotides 67813 to 67840), ORFK4.2-RACE1 (5' CGACCTTTTCTGGGACCGCAAGTGGATT 3', nucleotides 23029 to 23002), and ORFK4.2-RACE2 (5' CAACTTGACACAGGGGAAACACCAGGGG 3', nucleotides 22806 to 22833).Reverse transcription-PCR (RT-PCR). Poly(A)+ RNA was extracted from BC-1 cells 4 h postinduction with sodium butyrate. RT was performed at 42°C for 60 min with avian myeloblastosis virus reverse transcriptase (Boehringer-Mannheim, Mannheim, Germany) in a 20-µl reaction mixture containing 0.1 µg of poly(A)+ RNA and primed with oligo(dT). A 50-µl PCR mixture containing 20 µmol of primer ORF50-SEQ7 (5' GCACTAAGGCCAAACAGGGCGCAGG 3', nucleotides 75271 to 75295) and primer ORF50-SEQ5 (5' TCGCCGCTAGGAAACATAGTTGTGC 3', nucleotides 75687 to 75663) and 2.5 U of Taq DNA polymerase was added, and PCRs were carried out for 25 cycles (94°C for 30 s, 60°C for 30 s, and 72°C for 1 min). Amplified DNAs were separated on a 2% agarose gel.
Nucleotide sequence accession number. The nucleotide sequence data reported in this article have been submitted to GenBank. The cDNA sequences of ORF45, ORF K4.2, ORF50 type I, ORF50 type II, and ORF50 type III were assigned the accession no. AF091346, AF091347, AF091348, AF091349, and AF091350, respectively.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Experimental design.
The aim of this study was to identify IE
transcripts of KSHV, which typically code for regulatory proteins. We
initiated this study with two strains of KSHV that are harbored in BC-1
and BCBL-1 cell lines. The BC-1 cell line, established from an
AIDS-related primary effusion lymphoma, carries two gammaherpesviruses,
KSHV and EBV (5). In more than 98% of the cells, both
viruses are latent. It was reported by Miller et al. (14)
that the two viruses could be differentially induced to switch to their
lytic cycles by chemicals. EBV can be induced by phorbol ester (TPA),
and KSHV can be activated by sodium butyrate. BCBL-1 was also
established from a primary effusion lymphoma but carries only KSHV. The
latent virus in BCBL-1 cells can be induced to enter lytic replication with TPA and sodium butyrate (12a, 21). To detect KSHV IE
transcripts, BC-1 and BCBL-1 cells were treated with TPA (20 ng/ml)
or sodium butyrate (3 mM), respectively, in the presence of a protein
synthesis inhibitor (cycloheximide) at a concentration of 50 or 100 µg/ml. The expression of a putative KSHV IE gene, ORF50, in BC-1
and BCBL-1 cells under the conditions mentioned above was measured by
Northern analysis. KSHV ORF50 is the homologue of an EBV IE gene,
BRLF1, which encodes a transcription activator. In agreement with the
findings of Miller et al. (14) and Renne et al.
(21), ORF50 mRNA was detected in sodium butyrate-induced
BC-1 cells and TPA- or sodium butyrate-induced BCBL-1 cells in the
absence of cycloheximide starting at 4 h postinduction. In the
presence of cycloheximide at 50 or 100 µg/ml, ORF50 mRNA
could be detected in the induced BC-1 cells; however, the RNA level was
at 30 to 40% of its amount in the BC-1 cells induced in the absence of cycloheximide. In contrast, no mRNA could be detected in BCBL-1 cells in the presence of cycloheximide as judged by Northern
analyses of KSHV mRNAs of different classes (LANA, ORF50, and
ORF59) as well as cellular -actin mRNA, indicating that BCBL-1
cells are very sensitive to the toxicity of cycloheximide. Northern
analysis also revealed that a considerable polyadenylated level of KSHV lytic RNAs (such as ORF50, ORF59, and 1.1-kb nuclear RNA) can be
detected in noninduced BCBL-1 cells, suggesting a relatively high
degree of spontaneous reactivation of the virus in BCBL-1 cells. These
two problems make it difficult to identify IE transcripts of KSHV in
BCBL-1 cells.
Induction of the expression of KSHV IE genes. BC-1 cells were induced with sodium butyrate (3 mM) for 4 h in the presence of cycloheximide at the concentration of 100 µg/ml. Total poly(A)+ RNAs were isolated from the induced and noninduced BC-1 cells and converted to cDNAs. cDNAs made from both induced and uninduced cells were used to scan the KSHV genome for transcription as follows. Six overlapping cosmid clones, which represent the whole genome of KSHV (Fig. 1A), were digested with EcoRI, BamHI, or both; electrophoresed through agarose gels; and stained with ethidium bromide (Fig. 1B). These DNAs were transferred onto Nytran membranes and probed respectively with these two pools of radiolabeled cDNAs. The probes represent all viral as well as cellular transcripts in the induced and noninduced BC-1 cells. At first glance, the pattern of major hybridized bands looked simple and similar between the blots probed with two cDNA probes (Fig. 1C and D). The major sequences hybridizing with cosmids 1 and 2 were the polyadenylated nuclear transcript nut-1 (also designated PAN RNA) (29, 32, 33), and the major transcripts originating from KSHV DNA in cosmids 4 and 5 were the mRNAs for the latent protein LANA (the 3-kb EcoRI/BamHI fragments in cosmid 4 or 5), ORF K12 (kaposin), v-FLIP, and v-cyclin (the 8-kb EcoRI/BamHI fragment in cosmid 4). Closely inspecting the blots, we observed a number of minor bands that were present only in the blot hybridized with the cDNA pool from the induced cells (Fig. 1D). Examples included the 2.2-kb EcoRI/BamHI fragment in cosmid 1 (nucleotides 22409 to 24637), the 2.6-kb EcoRI/BamHI fragments in cosmids 2 and 3 (nucleotides 66444 to 69094), the 3.1-kb EcoRI/BamHI fragment in cosmid 2 (nucleotides 47518 to 50637), and the 3.8-kb EcoRI/BamHI fragment in cosmid 3 (nucleotides 69095 to 72888) (Fig. 1D). The transcripts originating from these DNA fragments may correspond to KSHV genes induced by sodium butyrate in the presence of cycloheximide and thus are candidates for the IE mRNAs of KSHV. Some induced transcripts may not be detected by the Southern hybridization if they originated from the same DNA fragments (especially large restriction fragments) to which abundant latent transcripts also hybridized. Therefore, we attempted to identify the IE mRNAs of KSHV by isolating their cDNA from the induced BC-1 cells.
|
Identification of IE transcripts of KSHV by cDNA subtractive
selection.
To isolate the cDNAs of KSHV IE mRNAs from a
complex cDNA pool that contains cellular mRNA sequences and
numerous KSHV sequences that can be from latent viral gene expression
or low-level lytic gene expression (25), we employed a gene
expression screening method which was developed based on cDNA
subtractive hybridization (1, 31). This method was designed
to isolate mRNAs that differ in abundance between two RNA
populations, so that the KSHV transcripts whose amounts were
dramatically increased after induction in the presence of cycloheximide
could be obtained. Figure 2 depicts the strategy used in this study. Basically, cDNA fragment
amplicons were prepared with poly(A)+ RNAs from cells, both
induced and uninduced, as described in Materials and Methods. The
cDNAs from sodium butyrate-induced cells were designated
cDNA(+), and the cDNAs from uninduced cells were designated
cDNA(). The cDNA() were biotinylated and hybridized to the
cDNA(+). After hybridization, the cDNA() and some of the cDNA(+) that hybridized to the cDNA() were removed by
addition of streptavidin, followed by phenol extraction. As a
result, the common sequences present in both cDNA populations were
eliminated and theoretically only unique sequences (sodium
butyrate-induced sequences) in the cDNA(+) pool were retained. The
subtractive selections were repeated several times until a small number
of unique sequences had been greatly enriched.
|
|
Northern analyses of putative IE mRNAs. To characterize the mRNAs corresponding to the isolated cDNAs and determine whether these mRNAs are indeed IE transcripts of KSHV, a series of Northern analyses were performed. Poly(A)+ RNA was prepared from BC-1 cells that had been induced with sodium butyrate for 4 and 20 h in the absence or presence of 100 µg of cycloheximide per ml. Cycloheximide was added 4 h prior to induction. These mRNAs were electrophoresed through denaturing agarose gels and transferred onto Nytran membranes. Radiolabeled single-stranded DNA probes were prepared from cloned plasmids by asymmetric PCR (see Materials and Methods) and used to probe the RNA blots. Using single-stranded probes allows the determination of transcription orientation of relevant genes. The results showed that five cDNA probes detected mRNAs that were induced either in the absence or in the presence of cycloheximide. These mRNAs included (i) two rightward transcripts of 3.6 and 4.3 kb that encompass ORF50 (Fig. 3A), (ii) three leftward transcripts of 1.2, 3.0, and 7.0 kb that are complementary to ORF50 mRNA (Fig. 3B), (iii) a rightward mRNA of 1.7 kb which contains ORF45 (Fig. 3C), (iv) a leftward transcript of 2.0 kb which carries ORF K4.2 (Fig. 3D), and (v) a rightward transcript of 4.5 kb which is partially complementary to ORF29 mRNA (Fig. 3E). These mRNAs have similar transcription patterns. First, their transcriptions were induced to a high level or had reached a plateau at 4 h postinduction in BC-1 cells. Second, their transcription could be induced in the presence of a high concentration of cycloheximide (100 µg/ml) in BC-1 cells. The cycloheximide-resistant mRNAs were detected at 4 h after the induction. They were not detected after 20 h of induction in the presence of cycloheximide due to severe toxicity to the cells after a long incubation time (24 h). According to the extent of their transcription in the presence of cycloheximide, these KSHV transcripts could be classified into two categories. The first category included the 3.6-kb ORF50 mRNA. The transcription of this mRNA in the presence of 100 µg of cycloheximide per ml was at the level of 30 to 40% of that in the absence of cycloheximide. The second category consisted of mRNAs for 4.3-kb ORF50, ORF45, and ORF K4.2 and the 4.5-kb mRNA. The transcription levels of these RNAs in the presence of cycloheximide (100 µg/ml) were between 12 and 20% of their amounts in the cells induced in the absence of cycloheximide.
To ensure that the transcription patterns of these IE mRNA candidates were distinct from those of transcripts from other classes, such as latent and delayed-early, the RNA blots were probed with cDNAs from KSHV mRNAs of known classes. The probes included cDNAs for a latent gene (LANA) and two delayed-early lytic genes (vIL-6 and ORF59). Northern blots of LANA, ORF59, and vIL-6 mRNAs are shown in Fig. 3F to H. As anticipated, the LANA mRNA was expressed constitutively regardless of sodium butyrate induction and cycloheximide treatment. Expression of vIL-6 and ORF59 was not detected at 4 h, only at 20 h postinduction, and their transcription was completely blocked in the presence of cycloheximide (Fig. 3G and H). A-actin probe detected a 1.9-kb mRNA (Fig.
3L), which was used as a control for the integrity of the various RNA
samples and as a marker for host gene transcription.
The extreme sensitivity of BCBL-1 cells to the toxicity of
cycloheximide made it impossible to examine the transcription of these
mRNAs in the absence of de novo protein synthesis in this cell
line. To determine whether these IE mRNAs were expressed in BCBL-1
cells in the same stage as they were in BC-1 cells, kinetics of the
transcription of these mRNAs were compared between these two cell
lines by Northern analysis. Total RNAs were isolated from BC-1 and
BCBL-1 cells after 4, 6, 8, 12, 24, and 48 h of treatment with
sodium butyrate and from untreated cells. The Northern blots of these
RNAs were hybridized with cDNA probes complementary to mRNAs
for ORF50, ORF45, and ORF K4.2 and the 4.5-kb mRNA. Identical blots
were also hybridized with a cDNA for ORF59, which is known to be a
delayed-early gene and to be activated by ORF50 (12a). The
results are shown in Fig. 4. ORF50
mRNAs of 3.6 and 4.3 kb were induced by sodium butyrate and reached
a plateau at 4 h postinduction in both BC-1 and BCBL-1 cells. The
transcription patterns of ORF50 mRNAs in BC-1 and BCBL-1 cells were
similar except that the mRNAs could be detected at a high level in
untreated BCBL-1 cells but not in untreated BC-1 cells (Fig. 4A). The
induction of an ORF45 mRNA of 1.7 kb could be observed at 4 h
postinduction in BC-1 and BCBL-1 cells. The mRNA level appeared to
increase with time in both cell lines (Fig. 4B). The transcription of a
K4.2 mRNA of 2.0 kb was induced and reached a peak at 4 h
postinduction in both BC-1 and BCBL-1 cells. After 8 h, the amount
of K4.2 mRNA appeared to decline with time (Fig. 4C). With the
decrease in the transcription of K4.2 mRNA, a 1.7-kb mRNA that
carries ORFs K4.1 and K4 began to accumulate in BC-1 and BCBL-1 cells
(Fig. 4C). The 1.7-kb K4.1 mRNA is a delayed-early transcript and
can be activated by ORF50 (data not shown). The transcription of the ORF K4.1 gene initiates at or near nucleotide 22908 on the KSHV genome
in BC-1 cells. The 4.5-kb mRNA was induced by sodium butyrate and
reached a plateau at 4 h postinduction in both BC-1 and BCBL-1 cells. However, the transcription level of this mRNA species
appeared lower in BCBL-1 cells (Fig. 4D). Overall, the transcription
patterns of these mRNAs are similar between BC-1 and BCBL-1 cells.
In both cell lines, the time of their first appearance is earlier
than that of delayed-early mRNAs such as ORF59 (Fig. 4E). The
kinetics data, together with induction of their transcription in
the presence of cycloheximide in BC-1 cells, suggest that the mRNAs
for ORF50, ORF45, and ORF K4.2 and the 4.5-kb mRNA are IE
transcripts of KSHV.
|
Structure of the IE mRNA of ORF50. Hybridization of 32P-labeled single-stranded ORF50 cDNA to Northern blots of the induced mRNA displayed two major transcripts of 3.6 and 4.3 kb (Fig. 3A and 4A). Although both of them could be detected in the cells which were induced in the presence of cycloheximide, the 3.6-kb transcript was expressed to a higher level than was the 4.3-kb mRNA and was more resistant to cycloheximide treatment. The full-length cDNAs for the 3.6-kb IE mRNA of ORF50 were obtained by a PCR-based cDNA amplification procedure and then cloned and sequenced. Sequencing analysis revealed that the 5' end of the mRNA is at or near nucleotide 71513 (numbering as in reference 24), and the 3' poly(A) tail begins at nucleotide 76737 (Fig. 5A). The sequences of different cDNA clones revealed that the ORF50 IE mRNAs (~3.6 kb) actually consist of three splice variants ranging from 3.6 to 3.8 kb. As illustrated in Fig. 5A, type I mRNA is composed of five exons, and in type II mRNA, intron 3 was not removed, while the type III mRNA contained both intron 2 and intron 3. To confirm the existence of three splice variants, semiquantitative RT-PCR was performed with two primers adjacent to introns 2 and 3 and mRNA isolated from BC-1 cells induced with sodium butyrate for 4 h. The results showed that the majority of 3.6- to 3.8-kb ORF50 mRNA is type I and that types II and III are minor species (Fig. 6). Based on the frequency of isolation of the cDNA clones for each type of ORF50 mRNA as well as the result of the semiquantitative RT-PCR assay, the type I mRNA accounts for approximately 70% of the 3.6- to 3.8-kb ORF50 mRNAs and types II and III together compose 30%.
|
|
, , and 
) as a result of alternative splicing (Fig. 5A). The
ORF50 is located in the first two exons. The encoded protein shows
significant sequence homology with Rta of EBV. The overall homology
between KSHV ORF50 and EBV Rta is 20% identity in amino acid sequence.
It has been shown that ORF50 activates some viral early and late genes
(12a, 30).
Three forms of ORF K8 result from alternative splicing and usage of
different stop codons. First, two intron sequences in K8 were doubly
removed in K8, singly spliced out in K8, and not spliced in
K8. Second, the stop codon used for K8 and K8 is located in
intron 3. This stop codon has been spliced in type I mRNA so that
K8 is predicted to be translated through most of exon 4 (Fig. 5A).
Interestingly, the unique sequence near the carboxy terminus of K8
contains a perfect basic-leucine zipper (bZip) structure (residues 169 and 218), which is absent in the and forms (Fig. 5B). In
addition, an acidic domain (12 of 42 residues [28.6%]) could be
discerned between residues 6 and 47 (Fig. 5B). This suggests that K8
is a transcription factor of the bZip family. Amino acid sequence
analysis revealed significant similarities between ORF K8 and the
ZEBRA protein of EBV, a transactivator responsible for the switch of
EBV from latency to lytic life cycle. The overall sequence homology
between K8 and ZEBRA is 21.6% identity at the amino acid level with
gaps. Similarities were also seen between K8 and the c-Jun
proto-oncogene product (20% identity).
The putative ORF K8.2 was not identified before, and the predicted
amino acid sequence is shown in Fig. 5C.
Northern analysis with a single-stranded DNA probe corresponding to
ORF50 mRNA strand detected three transcripts in the absence and
presence of cycloheximide. These RNAs are transcribed from the right to
the left in the KSHV genome and can serve as antisense RNAs to ORF50
messenger (Fig. 3B).
Structures of the IE mRNAs of ORF45 and K4.2. The cDNAs for ORF45 and K4.2 IE mRNAs were also obtained. Both of these mRNAs are unspliced. The 1.7-kb ORF45 mRNA encodes a putative peptide of 407 amino acid residues (the sequence is available in GenBank under accession no. AF091346). The predicted amino acid sequence of ORF45 has unique features. It has sequence similarity to nuclear proteins and transcription factors. Between amino acids 90 and 115, there is an extended acidic domain, which is glutamic acid and aspartic acid rich, typical for transcription activators. This type of acidic region is often found in nuclear proteins and transcription factors, including YY-1, yeast origin recognition complex protein subunit 1, nucleolin, and UBF-1; the latter two are responsible for rRNA synthesis. In addition, ORF45 is predicted to be a nuclear protein based on analysis with PSORT, a program designed to predict the subcellular localization sites of proteins.
The 2.0-kb IE mRNA for ORF K4.2 was synthesized in the leftward direction. The cDNA sequences showed that this mRNA encodes three putative ORFs, namely, K4.2, K4.1, and K4 (the cDNA sequence is available in GenBank under accession no. AF091347). ORFs K4 and K4.1 are predicted to encode two cytokine-like proteins, both closely resembling cellular MIP-1. The peptide encoded by K4, designated v-MIP-II, has been shown to preserve the functions predicted by its homology (16). For instance, v-MIP-II can bind to cytokine receptors CCR-3 and CCR-5 and block human immunodeficiency virus type 1 from using these receptors to enter CD4+ cells. v-MIP-II also demonstrated angiogenic activity (3). However, sequence analysis with GCG Blast could not identify any similarity of ORF K4.2 to any known protein. Kyte-Doolittle hydrophilicity prediction revealed hydrophobic domains at the N terminus and near the C terminus of ORF K4.2, suggesting that it is a membrane protein. In addition to the tricistronic transcript, K4 and K4.1 are also transcribed individually with two downstream promoters in the delayed-early phase of the lytic life cycle (16). A delayed-early ORF K4.1 mRNA of 1.7 kb can be detected on Northern blots hybridized with K4.2 cDNA probe because the 5' end of ORF K4.1 mRNA is within the K4.2 ORF (Fig. 3D and 4C). The ORF K4.1 mRNA of 1.7 kb cannot be detected in the presence of cycloheximide (Fig. 3D). The structures of the 4.5-kb IE mRNAs and three ORF50 antisense transcripts are under investigation.mRNAs for ORF57, K3, and K5 of KSHV are delayed-early transcripts. Three other KSHV ORFs were previously predicted to encode IE proteins based on their homology to IE proteins of other herpesviruses. ORFs K3 and K5 were found to have sequence similarity near the amino terminus with the major IE gene encoded by bovine herpesvirus 4. The region of similarity includes a newly recognized PHD/LAP class of zinc finger motif (19). KSHV ORF57 was referred to as an IE protein homologue because it has homology with EBV BMLF1 and herpes simplex virus type 1 (HSV-1) ICP27 (24). However, no cDNA for ORF57, K3, or K5 was detected in our cDNA subtractive selection. To clarify whether these three genes are IE genes in the KSHV genome, Northern analysis was performed with labeled cDNAs of these three mRNAs as probes. The results showed that a 1.3-kb K5 mRNA and 1.5-kb ORF57 mRNA were detected at 20 h after induction with sodium butyrate (Fig. 3J and 3K). A K3 cDNA probe detected two major transcripts of 1.5 and 2.0 kb at 20 h postinduction (Fig. 3I). The transcriptions of these three genes were completely blocked in the presence of cycloheximide (100 µg/ml) (Fig. 3I to K). It is suggested that ORF57, K3, and K5 are not IE genes in the KSHV genome in BC-1 cells.
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
IE genes of herpesviruses.
Reactivation of latent
herpesviruses or infection of permissive cells by the viruses in the
presence of protein synthesis inhibitors leads to restricted
transcription of the viral genome. The genes that are expressed under
these conditions are usually the first ones expressed after
reactivation or after primary infection and are referred to as the IE
viral genes. In many herpesviruses, such as HSVs and cytomegalovirus,
IE genes are usually defined by their transcription after primary
infection of permissive cells in the presence of complete inhibition of
de novo protein synthesis. However, this criterion cannot be applied to
KSHV, at least at the present time, because establishment of a
permissive cell system for KSHV lytic infection has been problematic
(22). KSHV infection in vitro so far can be studied only by
induction of permissivity in B cells that are latently infected. In
this study, IE genes of KSHV are defined as those that are activated
and expressed during chemical-induced viral reactivation in the
presence of complete inhibition of de novo protein synthesis. By this
definition, KSHV IE mRNAs were identified in BC-1 cells that were
induced with sodium butyrate in the presence of cycloheximide through the use of a cDNA subtraction-based gene expression screening method. These IE messengers originated from four regions in the KSHV
genome, which we refer to as KIE-1 to KIE-4 (Table
1).
|
genes) of HSV-1 were identified. Most HSV-1 IE genes encode
transcription activators (ICP0, ICP4, ICP22, and ICP27) regulating
viral and gene expression and viral DNA replication
(23). The product of the other gene, ICP47, was shown to
modulate the host defense mechanism by blocking presentation of viral
peptides to major histocompatibility complex class I-restricted cells
(10). Similarly, human cytomegalovirus IE proteins
originating from five genomic loci are involved in the regulation of
viral and cellular gene activation, viral DNA replication (i.e., IE1, IE2, UL36 to -38, and TRS1/IRS1), and modulation of the host immune system (i.e., US3, which impairs maturation and transport of major histocompatibility complex class I heavy chains) (15). In
EBV, which is a member of the gammaherpesvirus family like KSHV, two IE
genes, namely, BZLF1 and BRLF1, have been identified and studied intensively (2). These two genes encode two transcription
activators, ZEBRA and Rta, which activate viral lytic genes in a
synergistic manner (13). Identification of KSHV IE genes
opens avenues for studying the mechanism of viral reactivation and
infection and the accompanying expression of viral cytokine signaling
genes that have been thought of as crucial components in the
pathogenesis of KSHV-associated diseases.
ORF50 and K8 IE mRNAs. Among the IE mRNAs of KSHV identified in this study, ORF50 is the only one that has been previously predicted to encode an IE regulatory protein based on its homology to EBV Rta. A previous study showed that KSHV ORF50 can activate early lytic genes including virus-encoded IL-6 and polyadenylated nuclear RNA (nut-1) and a late gene coding for a small viral capsid antigen (30).
In EBV, the product of the BZLF1 gene, known as ZEBRA, is capable of driving the entire lytic cycle in B cells and in epithelial cells, while Rta synergizes with ZEBRA to activate early genes in B cells and the lytic cascade in epithelial cells (12, 13). Homologues of EBV BZLF1 have not been found in other members of the gammaherpesvirus family. In this study, we found that the 3.6-kb IE mRNA, which encodes ORF50, also carries two additional ORFs, K8 and K8.2. A highly spliced form of ORF K8 (K8) shows significant
similarity to the ZEBRA protein of EBV. In addition to significant
homology of amino acid sequence between K8 and ZEBRA (21.6%
identity), the predicted K8 protein has a typical bZip domain near
the carboxyl terminus and an acidic domain near the amino terminus,
closely resembling ZEBRA and c-Jun proteins in structure (Fig. 5B).
However, the unspliced and singly spliced forms of K8 ( and )
lack the bZip domain. Furthermore, aside from the 3.6- to 3.8-kb
tricistronic mRNAs, the ORF K8 sequence was found to be transcribed
as a 0.9-kb delayed-early mRNA by Northern analysis with a K8 probe
(data not shown). The role(s) played by the K8 proteins in viral
infection, reactivation, and pathogenesis as well as the functional
relationship among these three forms of K8 protein is very intriguing
and is under investigation.
Recently, Lukac et al. reported the structure of a 3.4-kb ORF50
mRNA which carries ORF50, K8, and K8.1 (12a). That
structure seems different from those of the ORF50 mRNAs described
above. In all three types of mRNAs that we characterized, the ORF
K8.1 has been spliced out.
ORF45 IE mRNA. The 1.7-kb mRNA coding for ORF45 is a major IE mRNA induced in BC-1 cells. Twenty percent of the KSHV cDNA clones in our subtracted cDNA library contained sequences originating from this mRNA. This observation, together with the results of a Northern analysis (Fig. 3C), reflects the abundance of the mRNA in BC-1 cells in the IE time. ORF45 has unique features, including an extended acidic domain, which is mainly composed of glutamic acid and aspartic acid. The glutamic acid-aspartic acid-rich domain is often found in nuclear proteins and transcription factors. In the KSHV genome, such a glutamic acid-aspartic acid-rich domain is also seen in LANA, a latent nuclear protein of KSHV. Although the overall ORF45 is conserved among the gammaherpesvirus family members, the glutamic acid-aspartic acid-rich domain is not found in the herpesvirus saimiri and EBV homologues, suggesting that it may be a unique feature for KSHV ORF45. Due to its nuclear protein features, ORF45 is likely to play a role in regulating gene expression or lytic DNA replication.
K4.2 IE mRNA. Although the 2.0-kb K4.2 IE transcript encodes three ORFs, we do not know if the second and third frames, i.e., K4.1 and K4, are translatable in this tricistronic messenger. The transcription pattern of the gene for ORF K4.2 is distinct from that of the other KSHV IE genes because of its transient expression period. Like other KSHV IE mRNAs, the ORF K4.2 mRNA accumulates at a considerable level at 4 h postinduction in BC-1 and BCBL-1 cells. However, the amount of ORF K4.2 mRNA begins to decline at 8 h postinduction. Kyte-Doolittle hydrophilicity prediction revealed a small hydrophobic domain at the N terminus and a large hydrophobic domain near the C terminus of ORF K4.2. These regions may serve as a signal peptide and a transmembrane domain, respectively, predicting that K4.2 may be a type I cell receptor.
| |
ACKNOWLEDGMENTS |
|---|
We are grateful to Ren Sun and George Miller (Yale University) for providing the cosmid clones of KSHV. We thank Gary Cohen, Robert Ricciardi (University of Pennsylvania), Tonia Symensma, and Ren Sun (UCLA) for critical reading of the manuscript and helpful discussion.
The work presented in this paper was partially supported by a University of Pennsylvania Cancer Center pilot project program grant.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology, School of Dental Medicine, University of Pennsylvania, 4010 Locust St., Philadelphia, PA 19104. Phone: (215) 573-7556. Fax: (215) 898-8385. E-mail: yuan2{at}pobox.upenn.edu.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. | Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 1996. Current protocols in molecular biology, p. 5.9.1-5.9.20. Greene Publishing Associates and Wiley Interscience, New York, N.Y. |
| 2. |
Biggin, M.,
M. Bodescot,
M. Perricaudet, and P. Farrell.
1987.
Epstein-Barr virus gene expression in P3HR1-superinfected Raji cells.
J. Virol.
61:3120-3132 |
| 3. |
Boshoff, C.,
Y. Endo,
P. D. Collins,
Y. Takeuchi,
J. D. Reeves,
V. L. Schweickart,
M. A. Siani,
T. Sasaki,
T. J. Williams,
P. W. Gray,
P. S. Moore,
Y. Chang, and R. A. Weiss.
1997.
Angiogenic and HIV-inhibitory functions of KSHV-encoded chemokines.
Science
278:290-294 |
| 4. |
Cesarman, E.,
Y. Chang,
P. S. Moore,
J. W. Said, and D. M. Knowles.
1995.
Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas.
N. Engl. J. Med.
332:1186-1191 |
| 5. |
Cesarman, E.,
P. S. Moore,
P. H. Rao,
G. Inghirami,
D. M. Knowles, and Y. Chang.
1995.
In vitro establishment and characterization of two acquired immunodeficiency syndrome-related lymphoma cell lines (BC-1 and BC-2) containing Kaposi's sarcoma-associated herpesvirus-like (KSHV) DNA sequences.
Blood
86:2708-2714 |
| 6. |
Chang, Y.,
E. Cesarman,
M. S. Pessin,
F. Lee,
J. Culpepper,
D. M. Knowles, and P. S. Moore.
1994.
Identification of herpesvirus-like DNA sequences in AIDS associated Kaposi's sarcoma.
Science
266:1865-1869 |
| 7. | Ensoli, B., R. Gendelman, P. Markham, V. Fiorelli, S. Colombini, M. Raffeld, A. Cafaro, H. K. Chang, J. N. Brady, and R. C. Gallo. 1994. Synergy between basic fibroblast growth factor and HIV-1 Tat protein in induction of Kaposi's sarcoma. Nature 371:674-680[Medline]. |
| 8. |
Ensoli, B.,
S. Nakamura,
S. Z. Salahuddin,
P. Biberfeld,
L. Larsson,
B. Beaver,
F. Wong-Staal, and R. C. Gallo.
1989.
AIDS-Kaposi's sarcoma-derived cells express cytokines with autocrine and paracrine growth effects.
Science
243:223-226 |
| 9. | Ganem, D. 1996. Human herpesvirus 8 and the biology of Kaposi's sarcoma. Semin. Virol. 7:325-332. |
| 10. | Hill, A., P. Jugovic, I. York, G. Russ, J. Bennink, J. Yewdell, H. Ploegh, and D. Johnson. 1995. Herpes simplex virus turns off the TAP to evade host immunity. Nature 374:411-415. |
| 11. | Kedes, D. H., M. Lagunoff, R. Renne, and D. Ganem. 1997. Identification of the gene encoding the major latency-associated nuclear antigen of the Kaposi's sarcoma-associated herpesvirus. J. Clin. Investig. 100:2606-2610[Medline]. |
| 12. | Kieff, E. 1996. Epstein-Barr virus and its replication, p. 2343-2396. In B. N. Fields, P. M. Howley, D. M. Knipe, R. M. Channock, J. L. Melnick, T. P. Monath, and B. Roizman (ed.), Fields' virology, vol. 3. Lippincott-Raven, Philadelphia, Pa. |
| 12a. | Lukac, D. M., R. Renne, J. R. Kirshner, and D. Ganem. 1998. Reactivation of Kaposi's sarcoma-associated herpesvirus infection from latency by expression of the ORF 50 transactivator, a homolog of the EBV R protein. Virology 252:304-312[Medline]. |
| 13. | Miller, G. 1990. The switch between latency and replication of Epstein-Barr virus. J. Infect. Dis. 161:833-844[Medline]. |
| 14. | Miller, G., L. Heston, E. Grogan, L. Gradoville, M. Rigsby, R. Sun, D. Shedd, V. M. Kushnaryov, S. Grossberg, and Y. Chang. 1997. Selective switch between latency and lytic replication of Kaposi's sarcoma-associated herpesvirus and Epstein-Barr virus in dually infected body cavity lymphoma cells. J. Virol. 71:314-324[Abstract]. |
| 15. | Mocarski, E. 1996. Cytomegaloviruses and their replication, p. 2447-2492. In B. N. Fields, P. M. Howley, D. M. Knipe, R. M. Channock, J. L. Melnick, T. P. Monath, and B. Roizman (ed.), Fields' virology, vol. 3. Lippincott-Raven, Philadelphia, Pa. |
| 16. |
Moore, P. S.,
C. Boshoff,
R. A. Weiss, and Y. Chang.
1996.
Molecular mimicry of human cytokine and cytokine response pathway genes by KSHV.
Science
274:1739-1744 |
| 17. |
Muralidhar, S.,
A. M. Pumfery,
M. Hassani,
M. R. Sadaie,
N. Azumi,
M. Kishishita,
J. N. Brady,
J. Doniger,
P. Medveczky, and L. J. Rosenthal.
1998.
Identification of kaposin (open reading frame K12) as a human herpesvirus 8 (Kaposi's sarcoma-associated herpesvirus) transforming gene.
J. Virol.
72:4980-4988 |
| 18. | Neipel, F., J.-C. Albrecht, and B. Fleckenstein. 1997. Cell-homologous genes in the Kaposi's sarcoma-associated rhadinovirus human herpesvirus 8: determinants of its pathogenicity? J. Virol. 71:4187-4192[Medline]. |
| 19. | Nicholas, J., V. Ruvolo, J. Zong, D. Ciufo, H. G. Guo, M. S. Reitz, and G. S. Hayward. 1997. A single 13-kilobase divergent locus in the Kaposi sarcoma-associated herpesvirus (human herpesvirus 8) genome contains nine open reading frames that are homologous to or related to cellular proteins. J. Virol. 71:1963-1974[Abstract]. |
| 20. | Rainbow, L., G. M. Platt, G. R. Simpson, R. Sarid, S.-J. Gao, H. Stoiber, C. S. Herrington, P. S. Moore, and T. F. Schulz. 1997. The 222- to 234-kilodalton latent nuclear protein (LNA) of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) is encoded by orf73 and is a component of the latency-associated nuclear antigen. J. Virol. 71:5915-5921[Abstract]. |
| 21. | Renne, R., W. Zhong, B. Herndier, M. McGrath, N. Abbey, D. Kedes, and D. Ganem. 1996. Lytic growth of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in culture. Nat. Med. 2:342-346[Medline]. |
| 22. |
Renne, R.,
D. Blackbourn,
D. Whitby,
J. Levy, and D. Ganem.
1998.
Limited transmission of Kaposi's sarcoma-associated herpesvirus in cultured cells.
J. Virol.
72:5182-5188 |
| 23. | Roizman, B., and A. E. Sears. 1996. Herpes simplex viruses and their replication, p. 2231-2295. In B. N. Fields, P. M. Howley, D. M. Knipe, R. M. Channock, J. L. Melnick, T. P. Monath, and B. Roizman (ed.), Fields' virology, vol. 3. Lippincott-Raven, Philadelphia, Pa. |
| 24. | Russo, J. J., R. A. Bohenzky, M.-C. Chien, J. Chen, M. Yan, D. Maddalena, J. P. Parry, D. Peruzzi, I. S. Edelman, Y. Chang, and P. S. Moore. 1996. Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8). Proc. Natl. Acad. Sci. USA 91:14862-14867. |
| 25. |
Sarid, R.,
O. Flore,
R. A. Bohenzky,
Y. Chang, and P. S. Moore.
1998.
Transcription mapping of the Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) genome in a body cavity-based lymphoma cell line (BC-1).
J. Virol.
72:1005-1012 |
| 26. |
Sarid, R.,
J. S. Wiezorek,
P. S. Moore, and Y. Chang.
1999.
Characterization and cell cycle regulation of the major Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) latent genes and their promoter.
J. Virol.
73:1438-1446 |
| 27. | Schulz, T. F. 1998. Kaposi's sarcoma-associated herpesvirus (human herpesvirus-8). J. Gen. Virol. 79:1573-1591[Medline]. |
| 28. |
Soulier, J.,
L. Grollet,
E. Oksenhendler,
P. Cacoub,
D. Cazals-Hatem,
P. Babinet,
M. F. d'Agay,
J. P. Clauvel,
M. Raphael,
L. Degos, and F. Sigaux.
1995.
Kaposi's sarcoma-associated herpesvirus-like DNA sequences in multicentric Castleman's disease.
Blood
86:1276-1280 |
| 29. |
Sun, R.,
S.-F. Lin,
L. Gradoville, and G. Miller.
1996.
Polyadenylated nuclear RNA encoded by Kaposi sarcoma-associated herpesvirus.
Proc. Natl. Acad. Sci. USA
93:11883-11888 |
| 30. |
Sun, R.,
S.-F. Lin,
L. Gradoville,
F. X. Zhu,
Y. Yuan, and G. Miller.
1998.
A viral gene that activates lytic cycle expression of Kaposi's sarcoma associated herpesvirus.
Proc. Natl. Acad. Sci. USA
95:10866-10871 |
| 31. |
Wang, Z., and D. D. Brown.
1991.
A gene expression screen.
Proc. Natl. Acad. Sci. USA
88:11505-11509 |
| 32. |
Zhong, W.,
H. Wang,
B. Herndier, and D. Ganem.
1996.
Restricted expression of Kaposi sarcoma-associated herpesvirus (human herpesvirus 8) genes in Kaposi sarcoma.
Proc. Natl. Acad. Sci. USA
93:6641-6646 |
| 33. | Zhong, W., and D. Ganem. 1997. Characterization of ribonucleoprotein complexes containing an abundant polyadenylated nuclear RNA encoded by Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8). J. Virol. 71:1207-1212[Abstract]. |
| 34. | Zhu, F. X., and Y. Yuan. 1998. Unpublished data. |
Journal of Virology, July 1999, p. 5556-5567, Vol. 73, No. 7
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Gould, F., Harrison, S. M., Hewitt, E. W., Whitehouse, A.
(2009). Kaposi's Sarcoma-Associated Herpesvirus RTA Promotes Degradation of the Hey1 Repressor Protein through the Ubiquitin Proteasome Pathway. J. Virol.
83: 6727-6738
[Abstract] [Full Text] -
Kuang, E., Wu, F., Zhu, F.
(2009). Mechanism of Sustained Activation of Ribosomal S6 Kinase (RSK) and ERK by Kaposi Sarcoma-associated Herpesvirus ORF45: MULTIPROTEIN COMPLEXES RETAIN ACTIVE PHOSPHORYLATED ERK AND RSK AND PROTECT THEM FROM DEPHOSPHORYLATION. J. Biol. Chem.
284: 13958-13968
[Abstract] [Full Text] -
Li, X., Zhu, F.
(2009). Identification of the Nuclear Export and Adjacent Nuclear Localization Signals for ORF45 of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
83: 2531-2539
[Abstract] [Full Text] -
Bu, W., Palmeri, D., Krishnan, R., Marin, R., Aris, V. M., Soteropoulos, P., Lukac, D. M.
(2008). Identification of Direct Transcriptional Targets of the Kaposi's Sarcoma-Associated Herpesvirus Rta Lytic Switch Protein by Conditional Nuclear Localization. J. Virol.
82: 10709-10723
[Abstract] [Full Text] -
Rozen, R., Sathish, N., Li, Y., Yuan, Y.
(2008). Virion-Wide Protein Interactions of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
82: 4742-4750
[Abstract] [Full Text] -
Abada, R., Dreyfuss-Grossman, T., Herman-Bachinsky, Y., Geva, H., Masa, S.-R., Sarid, R.
(2008). SIAH-1 Interacts with the Kaposi's Sarcoma-Associated Herpesvirus-Encoded ORF45 Protein and Promotes Its Ubiquitylation and Proteasomal Degradation. J. Virol.
82: 2230-2240
[Abstract] [Full Text] -
Kuang, E., Tang, Q., Maul, G. G., Zhu, F.
(2008). Activation of p90 Ribosomal S6 Kinase by ORF45 of Kaposi's Sarcoma-Associated Herpesvirus and Its Role in Viral Lytic Replication. J. Virol.
82: 1838-1850
[Abstract] [Full Text] -
Cai, Q., Murakami, M., Si, H., Robertson, E. S.
(2007). A Potential {alpha}-Helix Motif in the Amino Terminus of LANA Encoded by Kaposi's Sarcoma-Associated Herpesvirus Is Critical for Nuclear Accumulation of HIF-1{alpha} in Normoxia. J. Virol.
81: 10413-10423
[Abstract] [Full Text] -
Ye, J., Gradoville, L., Daigle, D., Miller, G.
(2007). De Novo Protein Synthesis Is Required for Lytic Cycle Reactivation of Epstein-Barr Virus, but Not Kaposi's Sarcoma-Associated Herpesvirus, in Response to Histone Deacetylase Inhibitors and Protein Kinase C Agonists. J. Virol.
81: 9279-9291
[Abstract] [Full Text] -
Xu, D., Coleman, T., Zhang, J., Fagot, A., Kotalik, C., Zhao, L., Trivedi, P., Jones, C., Zhang, L.
(2007). Epstein-Barr Virus Inhibits Kaposi's Sarcoma-Associated Herpesvirus Lytic Replication in Primary Effusion Lymphomas. J. Virol.
81: 6068-6078
[Abstract] [Full Text] -
Majerciak, V., Pripuzova, N., McCoy, J. P., Gao, S.-J., Zheng, Z.-M.
(2007). Targeted Disruption of Kaposi's Sarcoma-Associated Herpesvirus ORF57 in the Viral Genome Is Detrimental for the Expression of ORF59, K8{alpha}, and K8.1 and the Production of Infectious Virus. J. Virol.
81: 1062-1071
[Abstract] [Full Text] -
Zhu, F. X., Li, X., Zhou, F., Gao, S.-J., Yuan, Y.
(2006). Functional Characterization of Kaposi's Sarcoma-Associated Herpesvirus ORF45 by Bacterial Artificial Chromosome-Based Mutagenesis. J. Virol.
80: 12187-12196
[Abstract] [Full Text] -
Cai, Q., Lan, K., Verma, S. C., Si, H., Lin, D., Robertson, E. S.
(2006). Kaposi's Sarcoma-Associated Herpesvirus Latent Protein LANA Interacts with HIF-1{alpha} To Upregulate RTA Expression during Hypoxia: Latency Control under Low Oxygen Conditions.. J. Virol.
80: 7965-7975
[Abstract] [Full Text] -
Han, Z., Swaminathan, S.
(2006). Kaposi's Sarcoma-Associated Herpesvirus Lytic Gene ORF57 Is Essential for Infectious Virion Production.. J. Virol.
80: 5251-5260
[Abstract] [Full Text] -
Lu, F., Day, L., Gao, S.-J., Lieberman, P. M.
(2006). Acetylation of the Latency-Associated Nuclear Antigen Regulates Repression of Kaposi's Sarcoma-Associated Herpesvirus Lytic Transcription.. J. Virol.
80: 5273-5282
[Abstract] [Full Text] -
Cohen, A., Brodie, C., Sarid, R.
(2006). An essential role of ERK signalling in TPA-induced reactivation of Kaposi's sarcoma-associated herpesvirus.. J. Gen. Virol.
87: 795-802
[Abstract] [Full Text] -
Wong, E. L., Damania, B.
(2006). Transcriptional Regulation of the Kaposi's Sarcoma-Associated Herpesvirus K15 Gene. J. Virol.
80: 1385-1392
[Abstract] [Full Text] -
Yamanegi, K., Tang, S., Zheng, Z.-M.
(2005). Kaposi's Sarcoma-Associated Herpesvirus K8{beta} Is Derived from a Spliced Intermediate of K8 Pre-mRNA and Antagonizes K8{alpha} (K-bZIP) To Induce p21 and p53 and Blocks K8{alpha}-CDK2 Interaction. J. Virol.
79: 14207-14221
[Abstract] [Full Text] -
Wang, P., Day, L., Dheekollu, J., Lieberman, P. M.
(2005). A Redox-Sensitive Cysteine in Zta Is Required for Epstein-Barr Virus Lytic Cycle DNA Replication. J. Virol.
79: 13298-13309
[Abstract] [Full Text] -
Chang, P.-J., Shedd, D., Miller, G.
(2005). Two Subclasses of Kaposi's Sarcoma-Associated Herpesvirus Lytic Cycle Promoters Distinguished by Open Reading Frame 50 Mutant Proteins That Are Deficient in Binding to DNA. J. Virol.
79: 8750-8763
[Abstract] [Full Text] -
Dittmer, D. P., Gonzalez, C. M., Vahrson, W., DeWire, S. M., Hines-Boykin, R., Damania, B.
(2005). Whole-Genome Transcription Profiling of Rhesus Monkey Rhadinovirus. J. Virol.
79: 8637-8650
[Abstract] [Full Text] -
Lan, K., Kuppers, D. A., Verma, S. C., Sharma, N., Murakami, M., Robertson, E. S.
(2005). Induction of Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen by the Lytic Transactivator RTA: a Novel Mechanism for Establishment of Latency. J. Virol.
79: 7453-7465
[Abstract] [Full Text] -
Al Mehairi, S., Cerasoli, E., Sinclair, A. J.
(2005). Investigation of the Multimerization Region of the Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Protein K-bZIP: the Proposed Leucine Zipper Region Encodes a Multimerization Domain with an Unusual Structure. J. Virol.
79: 7905-7910
[Abstract] [Full Text] -
Zhang, J., Wang, J., Wood, C., Xu, D., Zhang, L.
(2005). Kaposi's Sarcoma-Associated Herpesvirus/Human Herpesvirus 8 Replication and Transcription Activator Regulates Viral and Cellular Genes via Interferon-Stimulated Response Elements. J. Virol.
79: 5640-5652
[Abstract] [Full Text] -
Jia, Q., Chernishof, V., Bortz, E., Mchardy, I., Wu, T.-T., Liao, H.-I, Sun, R.
(2005). Murine Gammaherpesvirus 68 Open Reading Frame 45 Plays an Essential Role during the Immediate-Early Phase of Viral Replication. J. Virol.
79: 5129-5141
[Abstract] [Full Text] -
Ye, J., Shedd, D., Miller, G.
(2005). An Sp1 Response Element in the Kaposi's Sarcoma-Associated Herpesvirus Open Reading Frame 50 Promoter Mediates Lytic Cycle Induction by Butyrate. J. Virol.
79: 1397-1408
[Abstract] [Full Text] -
Lu, M., Suen, J., Frias, C., Pfeiffer, R., Tsai, M.-H., Chuang, E., Zeichner, S. L.
(2004). Dissection of the Kaposi's Sarcoma-Associated Herpesvirus Gene Expression Program by Using the Viral DNA Replication Inhibitor Cidofovir. J. Virol.
78: 13637-13652
[Abstract] [Full Text] -
Deng, J.-H., Zhang, Y.-J., Wang, X.-P., Gao, S.-J.
(2004). Lytic Replication-Defective Kaposi's Sarcoma-Associated Herpesvirus: Potential Role in Infection and Malignant Transformation. J. Virol.
78: 11108-11120
[Abstract] [Full Text] -
Deutsch, E., Cohen, A., Kazimirsky, G., Dovrat, S., Rubinfeld, H., Brodie, C., Sarid, R.
(2004). Role of Protein Kinase C {delta} in Reactivation of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
78: 10187-10192
[Abstract] [Full Text] -
Malik, P., Blackbourn, D. J., Cheng, M. F., Hayward, G. S., Clements, J. B.
(2004). Functional co-operation between the Kaposi's sarcoma-associated herpesvirus ORF57 and ORF50 regulatory proteins. J. Gen. Virol.
85: 2155-2166
[Abstract] [Full Text] -
Lan, K., Kuppers, D. A., Verma, S. C., Robertson, E. S.
(2004). Kaposi's Sarcoma-Associated Herpesvirus-Encoded Latency-Associated Nuclear Antigen Inhibits Lytic Replication by Targeting Rta: a Potential Mechanism for Virus-Mediated Control of Latency. J. Virol.
78: 6585-6594
[Abstract] [Full Text] -
Damania, B., Jeong, J. H., Bowser, B. S., DeWire, S. M., Staudt, M. R., Dittmer, D. P.
(2004). Comparison of the Rta/Orf50 Transactivator Proteins of Gamma-2-Herpesviruses. J. Virol.
78: 5491-5499
[Abstract] [Full Text] -
Jeong, J. H., Orvis, J., Kim, J. W., McMurtrey, C. P., Renne, R., Dittmer, D. P.
(2004). Regulation and Autoregulation of the Promoter for the Latency-associated Nuclear Antigen of Kaposi's Sarcoma-associated Herpesvirus. J. Biol. Chem.
279: 16822-16831
[Abstract] [Full Text] -
Wang, S. E., Wu, F. Y., Chen, H., Shamay, M., Zheng, Q., Hayward, G. S.
(2004). Early Activation of the Kaposi's Sarcoma-Associated Herpesvirus RTA, RAP, and MTA Promoters by the Tetradecanoyl Phorbol Acetate-Induced AP1 Pathway. J. Virol.
78: 4248-4267
[Abstract] [Full Text] -
Bortz, E., Whitelegge, J. P., Jia, Q., Zhou, Z. H., Stewart, J. P., Wu, T.-T., Sun, R.
(2003). Identification of Proteins Associated with Murine Gammaherpesvirus 68 Virions. J. Virol.
77: 13425-13432
[Abstract] [Full Text] -
Lu, F., Zhou, J., Wiedmer, A., Madden, K., Yuan, Y., Lieberman, P. M.
(2003). Chromatin Remodeling of the Kaposi's Sarcoma-Associated Herpesvirus ORF50 Promoter Correlates with Reactivation from Latency. J. Virol.
77: 11425-11435
[Abstract] [Full Text] -
Wang, S. E., Wu, F. Y., Yu, Y., Hayward, G. S.
(2003). CCAAT/Enhancer-Binding Protein-{alpha} Is Induced during the Early Stages of Kaposi's Sarcoma-Associated Herpesvirus (KSHV) Lytic Cycle Reactivation and Together with the KSHV Replication and Transcription Activator (RTA) Cooperatively Stimulates the Viral RTA, MTA, and PAN Promoters. J. Virol.
77: 9590-9612
[Abstract] [Full Text] -
Izumiya, Y., Lin, S.-F., Ellison, T. J., Levy, A. M., Mayeur, G. L., Izumiya, C., Kung, H.-J.
(2003). Cell Cycle Regulation by Kaposi's Sarcoma-Associated Herpesvirus K-bZIP: Direct Interaction with Cyclin-CDK2 and Induction of G1 Growth Arrest. J. Virol.
77: 9652-9661
[Abstract] [Full Text] -
Wu, F. Y., Wang, S. E., Tang, Q.-Q., Fujimuro, M., Chiou, C.-J., Zheng, Q., Chen, H., Hayward, S. D., Lane, M. D., Hayward, G. S.
(2003). Cell Cycle Arrest by Kaposi's Sarcoma-Associated Herpesvirus Replication-Associated Protein Is Mediated at both the Transcriptional and Posttranslational Levels by Binding to CCAAT/Enhancer-Binding Protein {alpha} and p21CIP-1. J. Virol.
77: 8893-8914
[Abstract] [Full Text] -
Sinclair, A. J.
(2003). bZIP proteins of human gammaherpesviruses. J. Gen. Virol.
84: 1941-1949
[Abstract] [Full Text] -
Dourmishev, L. A., Dourmishev, A. L., Palmeri, D., Schwartz, R. A., Lukac, D. M.
(2003). Molecular Genetics of Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Epidemiology and Pathogenesis. Microbiol. Mol. Biol. Rev.
67: 175-212
[Abstract] [Full Text] -
Lin, C. L., Li, H., Wang, Y., Zhu, F. X., Kudchodkar, S., Yuan, Y.
(2003). Kaposi's Sarcoma-Associated Herpesvirus Lytic Origin (ori-Lyt)-Dependent DNA Replication: Identification of the ori-Lyt and Association of K8 bZip Protein with the Origin. J. Virol.
77: 5578-5588
[Abstract] [Full Text] -
Nakamura, H., Lu, M., Gwack, Y., Souvlis, J., Zeichner, S. L., Jung, J. U.
(2003). Global Changes in Kaposi's Sarcoma-Associated Virus Gene Expression Patterns following Expression of a Tetracycline-Inducible Rta Transactivator. J. Virol.
77: 4205-4220
[Abstract] [Full Text] -
Zhu, F. X., Yuan, Y.
(2003). The ORF45 Protein of Kaposi's Sarcoma-Associated Herpesvirus Is Associated with Purified Virions. J. Virol.
77: 4221-4230
[Abstract] [Full Text] -
Hwang, S., Lee, D., Gwack, Y., Min, H., Choe, J.
(2003). Kaposi's sarcoma-associated herpesvirus K8 protein interacts with hSNF5. J. Gen. Virol.
84: 665-676
[Abstract] [Full Text] -
Jia, Q., Sun, R.
(2003). Inhibition of Gammaherpesvirus Replication by RNA Interference. J. Virol.
77: 3301-3306
[Abstract] [Full Text] -
Izumiya, Y., Lin, S.-F., Ellison, T., Chen, L.-Y., Izumiya, C., Luciw, P., Kung, H.-J.
(2002). Kaposi's Sarcoma-Associated Herpesvirus K-bZIP Is a Coregulator of K-Rta: Physical Association and Promoter-Dependent Transcriptional Repression. J. Virol.
77: 1441-1451
[Abstract] [Full Text] -
Wang, S. E., Wu, F. Y., Fujimuro, M., Zong, J., Hayward, S. D., Hayward, G. S.
(2002). Role of CCAAT/Enhancer-Binding Protein Alpha (C/EBP{alpha}) in Activation of the Kaposi's Sarcoma-Associated Herpesvirus (KSHV) Lytic-Cycle Replication-Associated Protein (RAP) Promoter in Cooperation with the KSHV Replication and Transcription Activator (RTA) and RAP. J. Virol.
77: 600-623
[Abstract] [Full Text] -
Lee, B.-S., Paulose-Murphy, M., Chung, Y.-H., Connlole, M., Zeichner, S., Jung, J. U.
(2002). Suppression of Tetradecanoyl Phorbol Acetate-Induced Lytic Reactivation of Kaposi's Sarcoma-Associated Herpesvirus by K1 Signal Transduction. J. Virol.
76: 12185-12199
[Abstract] [Full Text] -
DeWire, S. M., McVoy, M. A., Damania, B.
(2002). Kinetics of Expression of Rhesus Monkey Rhadinovirus (RRV) and Identification and Characterization of a Polycistronic Transcript Encoding the RRV Orf50/Rta, RRV R8, and R8.1 Genes. J. Virol.
76: 9819-9831
[Abstract] [Full Text] -
Tang, S., Zheng, Z.-M.
(2002). Kaposi's Sarcoma-associated Herpesvirus K8 Exon 3 Contains Three 5'-Splice Sites and Harbors a K8.1 Transcription Start Site. J. Biol. Chem.
277: 14547-14556
[Abstract] [Full Text] -
Zhu, F. X., King, S. M., Smith, E. J., Levy, D. E., Yuan, Y.
(2002). A Kaposi's sarcoma-associated herpesviral protein inhibits virus-mediated induction of type I interferon by blocking IRF-7 phosphorylation and nuclear accumulation. Proc. Natl. Acad. Sci. USA
99: 5573-5578
[Abstract] [Full Text] -
Chang, P.-J., Shedd, D., Gradoville, L., Cho, M.-S., Chen, L.-W., Chang, J., Miller, G.
(2002). Open Reading Frame 50 Protein of Kaposi's Sarcoma-Associated Herpesvirus Directly Activates the Viral PAN and K12 Genes by Binding to Related Response Elements. J. Virol.
76: 3168-3178
[Abstract] [Full Text] -
Gwack, Y., Hwang, S., Lim, C., Won, Y. S., Lee, C. H., Choe, J.
(2002). Kaposi's Sarcoma-associated Herpesvirus Open Reading Frame 50 Stimulates the Transcriptional Activity of STAT3. J. Biol. Chem.
277: 6438-6442
[Abstract] [Full Text] -
Wang, S., Liu, S., Wu, M.-H., Geng, Y., Wood, C.
(2001). Identification of a Cellular Protein That Interacts and Synergizes with the RTA (ORF50) Protein of Kaposi's Sarcoma-Associated Herpesvirus in Transcriptional Activation. J. Virol.
75: 11961-11973
[Abstract] [Full Text] -
Hwang, S., Gwack, Y., Byun, H., Lim, C., Choe, J.
(2001). The Kaposi's Sarcoma-Associated Herpesvirus K8 Protein Interacts with CREB-Binding Protein (CBP) and Represses CBP-Mediated Transcription. J. Virol.
75: 9509-9516
[Abstract] [Full Text] -
Rimessi, P., Bonaccorsi, A., Sturzl, M., Fabris, M., Brocca-Cofano, E., Caputo, A., Melucci-Vigo, G., Falchi, M., Cafaro, A., Cassai, E., Ensoli, B., Monini, P.
(2001). Transcription Pattern of Human Herpesvirus 8 Open Reading Frame K3 in Primary Effusion Lymphoma and Kaposi's Sarcoma. J. Virol.
75: 7161-7174
[Abstract] [Full Text] -
Gwack, Y., Hwang, S., Byun, H., Lim, C., Kim, J. W., Choi, E.-J., Choe, J.
(2001). Kaposi's Sarcoma-Associated Herpesvirus Open Reading Frame 50 Represses p53-Induced Transcriptional Activity and Apoptosis. J. Virol.
75: 6245-6248
[Abstract] [Full Text] -
Ciufo, D. M., Cannon, J. S., Poole, L. J., Wu, F. Y., Murray, P., Ambinder, R. F., Hayward, G. S.
(2001). Spindle Cell Conversion by Kaposi's Sarcoma-Associated Herpesvirus: Formation of Colonies and Plaques with Mixed Lytic and Latent Gene Expression in Infected Primary Dermal Microvascular Endothelial Cell Cultures. J. Virol.
75: 5614-5626
[Abstract] [Full Text] -
Paulose-Murphy, M., Ha, N.-K., Xiang, C., Chen, Y., Gillim, L., Yarchoan, R., Meltzer, P., Bittner, M., Trent, J., Zeichner, S.
(2001). Transcription Program of Human Herpesvirus 8 (Kaposi's Sarcoma-Associated Herpesvirus). J. Virol.
75: 4843-4853
[Abstract] [Full Text] -
Goodwin, D. J., Walters, M. S., Smith, P. G., Thurau, M., Fickenscher, H., Whitehouse, A.
(2001). Herpesvirus Saimiri Open Reading Frame 50 (Rta) Protein Reactivates the Lytic Replication Cycle in a Persistently Infected A549 Cell Line. J. Virol.
75: 4008-4013
[Abstract] [Full Text] -
Song, M. J., Brown, H. J., Wu, T.-T., Sun, R.
(2001). Transcription Activation of Polyadenylated Nuclear RNA by Rta in Human Herpesvirus 8/Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
75: 3129-3140
[Abstract] [Full Text] -
Jeong, J., Papin, J., Dittmer, D.
(2001). Differential Regulation of the Overlapping Kaposi's Sarcoma-Associated Herpesvirus vGCR (orf74) and LANA (orf73) Promoters. J. Virol.
75: 1798-1807
[Abstract] [Full Text] -
Gwack, Y., Byun, H., Hwang, S., Lim, C., Choe, J.
(2001). CREB-Binding Protein and Histone Deacetylase Regulate the Transcriptional Activity of Kaposi's Sarcoma-Associated Herpesvirus Open Reading Frame 50. J. Virol.
75: 1909-1917
[Abstract] [Full Text] -
Wu, F. Y., Ahn, J.-H., Alcendor, D. J., Jang, W.-J., Xiao, J., Hayward, S. D., Hayward, G. S.
(2001). Origin-Independent Assembly of Kaposi's Sarcoma-Associated Herpesvirus DNA Replication Compartments in Transient Cotransfection Assays and Association with the ORF-K8 Protein and Cellular PML. J. Virol.
75: 1487-1506
[Abstract] [Full Text] -
Jenner, R. G., Albà, M. M., Boshoff, C., Kellam, P.
(2001). Kaposi's Sarcoma-Associated Herpesvirus Latent and Lytic Gene Expression as Revealed by DNA Arrays. J. Virol.
75: 891-902
[Abstract] [Full Text] -
Deng, H., Young, A., Sun, R.
(2000). Auto-activation of the rta gene of human herpesvirus-8/Kaposi's sarcoma-associated herpesvirus. J. Gen. Virol.
81: 3043-3048
[Abstract] [Full Text] -
Nicholas, J
(2000). Evolutionary aspects of oncogenic herpesviruses. Mol. Pathol.
53: 222-237
[Abstract] [Full Text] -
Chen, J., Ueda, K., Sakakibara, S., Okuno, T., Yamanishi, K.
(2000). Transcriptional Regulation of the Kaposi's Sarcoma-Associated Herpesvirus Viral Interferon Regulatory Factor Gene. J. Virol.
74: 8623-8634
[Abstract] [Full Text] -
Gradoville, L., Gerlach, J., Grogan, E., Shedd, D., Nikiforow, S., Metroka, C., Miller, G.
(2000). Kaposi's Sarcoma-Associated Herpesvirus Open Reading Frame 50/Rta Protein Activates the Entire Viral Lytic Cycle in the HH-B2 Primary Effusion Lymphoma Cell Line. J. Virol.
74: 6207-6212
[Abstract] [Full Text] -
Kirshner, J. R., Lukac, D. M., Chang, J., Ganem, D.
(2000). Kaposi's Sarcoma-Associated Herpesvirus Open Reading Frame 57 Encodes a Posttranscriptional Regulator with Multiple Distinct Activities. J. Virol.
74: 3586-3597
[Abstract] [Full Text] -
Wu, T.-T., Usherwood, E. J., Stewart, J. P., Nash, A. A., Sun, R.
(2000). Rta of Murine Gammaherpesvirus 68 Reactivates the Complete Lytic Cycle from Latency. J. Virol.
74: 3659-3667
[Abstract] [Full Text] -
Alexander, L., Denekamp, L., Knapp, A., Auerbach, M. R., Damania, B., Desrosiers, R. C.
(2000). The Primary Sequence of Rhesus Monkey Rhadinovirus Isolate 26-95: Sequence Similarities to Kaposi's Sarcoma-Associated Herpesvirus and Rhesus Monkey Rhadinovirus Isolate 17577. J. Virol.
74: 3388-3398
[Abstract] [Full Text] -
Haque, M., Chen, J., Ueda, K., Mori, Y., Nakano, K., Hirata, Y., Kanamori, S., Uchiyama, Y., Inagi, R., Okuno, T., Yamanishi, K.
(2000). Identification and Analysis of the K5 Gene of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
74: 2867-2875
[Abstract] [Full Text] -
Gupta, A. K., Ruvolo, V., Patterson, C., Swaminathan, S.
(2000). The Human Herpesvirus 8 Homolog of Epstein-Barr Virus SM Protein (KS-SM) Is a Posttranscriptional Activator of Gene Expression. J. Virol.
74: 1038-1044
[Abstract] [Full Text] -
Lukac, D. M., Kirshner, J. R., Ganem, D.
(1999). Transcriptional Activation by the Product of Open Reading Frame 50 of Kaposi's Sarcoma-Associated Herpesvirus Is Required for Lytic Viral Reactivation in B Cells. J. Virol.
73: 9348-9361
[Abstract] [Full Text] -
Huang, L.-M., Chao, M.-F., Chen, M.-Y., Shih, H.-m., Chiang, Y.-P., Chuang, C.-Y., Lee, C.-Y.
(2001). Reciprocal Regulatory Interaction between Human Herpesvirus 8 and Human Immunodeficiency Virus Type 1. J. Biol. Chem.
276: 13427-13432
[Abstract] [Full Text] -
Zhu, F. X., King, S. M., Smith, E. J., Levy, D. E., Yuan, Y.
(2002). A Kaposi's sarcoma-associated herpesviral protein inhibits virus-mediated induction of type I interferon by blocking IRF-7 phosphorylation and nuclear accumulation. Proc. Natl. Acad. Sci. USA
99: 5573-5578
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»