Previous Article | Next Article 
Journal of Virology, July 1999, p. 5490-5496, Vol. 73, No. 7
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Amelioration of Retroviral Vector Silencing in
Locus Control Region
-Globin-Transgenic Mice and Transduced F9
Embryonic Cells
Cameron S.
Osborne,1
Peter
Pasceri,1
Rakesh
Singal,2,
Tanya
Sukonnik,1
Gordon D.
Ginder,2,3 and
James
Ellis1,4,*
Programs in Developmental Biology and Blood
and Cancer Research, Hospital for Sick Children, Toronto, Ontario,
Canada M5G 1X81; Department of Molecular
and Medical Genetics, University of Toronto, Toronto, Ontario,
Canada4; Department of Medicine,
Division of Medical Oncology, University of Minnesota, Minneapolis,
Minnesota 55455-03622; and Massey Cancer
Center, Virginia Commonwealth University, Richmond, Virginia
23298-00373
Received 17 December 1998/Accepted 9 April 1999
 |
ABSTRACT |
Retroviral vectors are transcriptionally silenced in hematopoietic
stem cells, and this phenomenon must be overcome for effective gene
therapy of blood diseases. The murine stem cell virus (MSCV) vector
completely silences
-globin reporter genes regulated by locus
control region (LCR) elements 5'HS2 to 5'HS4 in seven of eight
transgenic mice. Here, we show that no single known MSCV silencer
element is sufficient for complete LCR
-globin transgene silencing.
However, partial silencing of high-copy transgenes is conveyed by the
MSCV direct repeat and promoter elements. The CpG methylation pattern
of silenced and expressed MSCV promoter transgenes is virtually
identical, demonstrating that silencing does not absolutely correlate
with methylation status. Combined mutations in all four MSCV silencer
elements leads to expression of
-globin in 6 of 10 transgenic mice.
The same mutations incorporated into the HSC1 retrovirus vector direct
neo gene expression in 71% of transduced F9 embryonic
carcinoma cells. These studies demonstrate that combined mutation of
four retroviral silencer elements relieves complete silencing in most
transgenic mice and transduced F9 cells and suggests that novel
silencer elements remain. Enhanced expression of the HSC1 vector in
primitive stem cells is well suited for blood gene therapy applications.
 |
INTRODUCTION |
Transcriptional silencing of
retrovirus vectors in primitive stem cells is a major obstacle to
current gene therapy approaches to the treatment of blood diseases
(5, 50, 52). Due to the difficulty in purifying
hematopoietic stem cells and infecting them with retrovirus vectors
(26), the most widely used models for studying such
silencing are preimplantation mouse embryos and embryonic carcinoma
(EC) cell lines. Studies by Jaenisch and colleagues demonstrated that
silencing of retroviral gene expression in EC cells correlated with de
novo methylation of proviral sequences (23, 47), and this
silencing could be partially rescued with a methylation inhibitor
(47). Taken together with recent studies on embryonic stem
(ES) cells that are null for the dnmt1 methyltransferase (28, 49,
51), these findings suggest the presence of an embryonic-cell-specific de novo methylase activity that is responsible for shutting off retroviral gene expression (22, 56).
Recently, such a family of embryonic-cell-specific de novo methylases
has been identified (35). However, other reports compared
the timing of the establishment of silencing to that of methylation in
EC cells and showed that while silencing of retroviral gene expression occurs within 48 h of infection, methylation is not established until 10 to 15 days postinfection (17, 25, 34). This suggest that other mechanisms are responsible for silencing and that
methylation is a consequence or a secondary step of these mechanisms.
Indeed, silencing of adeno-associated virus vectors can be relieved
with histone deacetylase inhibitors but not with methylation inhibitors (7), suggesting that chromatin modification is involved in the establishment or maintenance of silencing. The mechanism of silencing therefore remains controversial.
There is more agreement on the cis-acting elements that
participate in silencing. These silencers include the negative control region (NCR), the direct repeat (DR) element, and the primer-binding site (PBS) (see Fig. 1A) (3, 9, 14, 21). Molecular
characterization of trans-acting factor-binding sites in
these regions has shown that the NCR is bound by the multifunctional
YY-1 factor (13) that interacts with RPD3 histone
deacetylase (54), the DR is bound by at least six
trans-acting factors (46), and the PBS is bound
by factor A (38). In addition, the retrovirus long terminal
repeat (LTR) promoter fragment contains a cluster of 13 CpG sites in
100 bp that become highly methylated in silenced cell types and can
therefore be considered a fourth potential silencer element.
Combination of mutations in some of these silencer elements in
retrovirus vectors leads to higher levels of viral gene expression in
EC cells, demonstrating that their effects are additive (6, 18,
20, 41). However, silencing is not completely relieved with any
of these vectors. Recently, the MND retrovirus, which contains
alterations in the NCR, DR, and PBS and expresses transgenes in
approximately 43% of infected F9 embryonic cells (6), was
found to evade silencing in over 50% of secondary spleen CFU in mice
that were serially transplanted with transduced marrow (40).
These findings suggest that either all four elements must be
simultaneously removed to completely escape silencing or other
unidentified silencing elements exist.
Examination of retroviral silencing in the above-described
experiments is limited by the requirement to produce infectious virus. This restriction can be avoided by performing silencing assays
with transgenic mice, where silencing also spreads into adjacent
sequences to silence linked mammalian promoters in the transgene
(30). It is important to utilize a strong internal reporter
gene that is expressed reproducibly in the absence of retroviral
sequences. To identify specific retroviral sequences sufficient to
establish silencing, we have combined such a strong reporter gene with
the use of transgenic mice. Human
-globin transgenes regulated by
the locus control region (LCR) are ideal for this purpose.
The
-globin LCR is composed of four DNase I-hypersensitive sites
(15, 48). In transgenic mice, the LCR directs copy
number-dependent, position effect-independent expression (19,
42). All four DNase I-hypersensitive sites (5'HS1 to 5'HS4)
are required for full LCR activity (37); however, only 5'HS3
is capable of reproducibly expressing
-globin at every single-copy
integration site in transgenic mice (12). A 5'HS2
-globin
transgene is completely silenced when linked to the 5' LTR and
gag sequence of Moloney murine leukemia virus (MoMLV)
(30). Indeed, our own findings confirm that a 5'HS2-to-5'HS4
-globin transgene is completely silenced when linked to MoMLV
and show that it is silenced by MSCV to undetectable levels in seven of
eight animals (36). To dissect the silencing activities
within retrovirus vectors, we have used the BGT14 reporter cassette that contains a 3.0-kb LCR (5'HS2 to 5'HS4) linked to the human
-globin gene and directs 16 to 71% expression at all integration sites of transgenic mice (11). This approach
permits us to assess the activity of each silencer element and to
investigate the possible mechanisms that participate in silencing.
Furthermore, by removing components of all known silencing elements
from the retrovirus, we have generated the BGT58 transgene and its
equivalent HSC1 retrovirus vector that directs expression in about 60%
of transgenic mice and infected F9 embryonic cells.
 |
MATERIALS AND METHODS |
Plasmid construction.
BGT52, BGT53, and BGT56 were made by
ligation of double-stranded oligonucleotides with
NdeI-compatible ends spanning the MSCV PBS (38 bp), NCR (74 bp), and DR (86 bp) elements, respectively, into the NdeI
site 3' of the
-globin gene within BGT14 (11). BGT57 was
constructed by addition of NdeI linkers (New England Biolabs) to the 187-bp XbaI-KpnI MSCV LTR
promoter fragment from MSCVneoEB (20) and ligation into the
NdeI site of BGT14. BGT58 contains the 1.1-kb
SacI-HpaI 5' LTR fragment of MSCVneoEB cloned by
using NdeI linkers into the BGT14 NdeI site. HSC1
was constructed by ligation of the 4.1-kb
ScaI-ClaI 5' LTR MSCVneoEB fragment to a
double-stranded ClaI-SacI HSC5NCR oligonucleotide
and the 2.0-kb SacI-ScaI 3' LTR MSCVneoEB fragment.
Oligonucleotides.
The sequences of oligonucleotides used in
this study were as follows: PBSs,
5'-TATGAGCTCGGAGGTTCCACCGAGATTTGGAGACCCCA-3'; PBSa,
5'-TATGGGGTCTCCAAATCTCGGTGGAACCTCCGAGCTCA-3'; NCRs,
5'-TATGAGCTCAGCTAGCTTAAGTAACGCCATTTTGCAAGGCATGGAAAATACATAACTGAGAATAGAGAAGTTCA-3'; NCRa, 5'-TATGAACTTCTCTATTCTCAGTTATGTATTTTCCATGCCTTGCAAA ATGGCGTTACTTAAGCTAGCTGAGCTCA-3'; DRs,
5'-TATGAGCTCGA CAGCAGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTG CCCCGGCTCAGGGCCAAGAACAGATGGCA-3';
DRa,
5'-TATGCCATCTGT TC T TGGCCC TGAGCCGGGGCAGGAAC TGC T TACCACAGATATCCTGTTTGGCCCATAT TC TGC TG TCGAGC TCA-3';
HSC5NCRs,
5'-CGA TCATATGGATAAAATAAAAGATTTTATTTAGTCTCCAGAAAAAGGG GGGAATGAAAGACCCCACCTGTAGG T T TGGCAAGC TAGGAGCT-3';
HSC5NCRa, 5'-CCTAGCTTGCCAAACCTACAGGTGGGGTCTTTCATTC CCCCCTTTTTCTGGAGACTAAATAAAATCTTTTATTTTATCCATATGA T-3';
LTRPCRF, 5'-TTTGAGTAATAGTTTTTTGATTTT-3'; LTRPCRR,
5'-TCCTACCATTTATAC(A/G)AAAATTAATAAACC-3'; LTRSEQF,
5'-ATATTTTTATTGTTTGTTTTTATGAGAGTG-3'; LTRSEQR,
5'-AAAATAAACCTAACACAAAAAAACAAATAC-3'.
Transgenic mice.
Transgenic mice were produced in FVB
fertilized eggs as previously described (11). BGT52, BGT53,
BGT57, and BGT58 were purified as 7.2-kb EcoRV fragments,
and BGT56 was purified as a 7.2-kb XmnI-NotI
fragment. Day 15.5 postinjection fetal mice were dissected, and DNA was
extracted from head tissue while the fetal liver was saved frozen in
halves for future analyses. Transgenic fetuses were identified by slot
blot hybridization of fetal head DNA with the
ivs2 probe using
standard techniques.
DNA analysis.
Transgene copy number was determined by
digesting transgenic fetal head DNA with either EcoRI or
BamHI, which both cut once within the transgene. Southern
blots were probed with an EcoRI-BamHI 0.9-kb
-globin intron 2 fragment by standard procedures. Copy number
determination was performed by using a Molecular Dynamics PhosphorImager. Transgene mosaicism was determined by digesting fetal
liver DNA with AccI, which cuts twice within the human
-globin gene, and comparison of the band intensity to that of the
single-copy B26 transgenic bred line (11). Percent
transgenicity was determined by using a Molecular Dynamics
PhosphorImager and the formula (Tg H
/Tg mThy-1)/(B26 H
× copy number/B26 mThy-1), where Tg is transgenic, H
is human
-globin, m-Thy-1 is mouse Thy-1, and B26 is one-copy bred line B26.
RNA analysis.
Day 15.5 fetal liver RNA was extracted by
using Trizol Reagent (Gibco BRL). RNA (1 µg) was hybridized to
[
-32P]ATP-labeled double-stranded DNA probes, digested
with 75 U of S1 nuclease (Boehringer Mannheim), and run on a 6%
sequencing gel as previously described (1). The protected
153-nucleotide Hu
and 95-nucleotide Mo
bands were quantitated on
a Molecular Dynamics PhosphorImager, and percent expression was
calculated according to the formula (Hu
/2Mo
) × 100 to
account for the specific activity differences. Percent expression per
transgene copy was calculated as (2 Mo
genes/transgene copy
number) × (% expression/% transgenicity) × 100.
Electrophoretic mobility shift assays.
Methylcytosine
binding protein (MeCP) competition studies were performed as previously
described (45). In brief, the M-CG11 probe was incubated
with HeLa cell nuclear extracts, and MeCP complexes competed with
methylated and unmethylated LTR promoter fragments. The competitor
fragment was prepared by digestion of MSCVneoEB with XbaI
and KpnI and gel purification. Half of this fragment was
then SssI methylase treated (New England Biolabs) and
digested with the methylation-sensitive enzyme HhaI. The
methylated fragment that was uncut by HhaI was gel purified
and used in competition assays along with the unmethylated fragment.
Bisulfite sequencing for determination of DNA methylation.
Bisulfite sequencing was performed as previously described
(45). Briefly, genomic fetal liver DNA was treated with
bisulfite, which converts deoxycytosine but not 5-methylcytosine
residues into uracil. The LTR promoter was then PCR amplified from the bisulfite-treated DNA by using primers LTRPCRF and LTRPCRR. The PCR-amplified products were amplified and sequenced by using nested primers LTRSEQF and LTRSEQR.
Cell lines.
PA317, NIH3T3, and F9 cells were obtained from
the American Type Culture Collection. N2/PA317#14 producer cells were
obtained from J. Dick. F9 cells were cultured in Dulbecco's modified
Eagle's medium with 15% fetal bovine serum and grown on plates coated with 0.1% gelatin. PA317 and NIH 3T3 cells were grown in Dulbecco's modified Eagle's medium with 10% fetal bovine serum. HSC1 and MSCVneoEB PA317 cell producer populations were prepared by transfection using Lipofectamine and Optimem (Gibco-BRL) and selection in G418 (Gibco-BRL) at 500 µg/ml.
Viral titer determination in F9 and 3T3 cells.
Viral
supernatants harvested from confluent PA317 cells producing HSC1,
MSCVneoEB, and N2 virus (2) were spun briefly to remove
intact cells. The viral supernatants were serially diluted, and 2 ml
(plus Polybrene at 8 µg/ml) was added to F9 and NIH 3T3 cells plated
at 105/100-mm2 plate the previous evening.
After 2 h, 8 ml of growth medium was added. Twenty-four hours
later, G418 (500 µg/ml)-containing medium was added and cells were
cultured for 10 days, after which time no colonies were seen in
uninfected cultures. G418-resistant colonies were revealed by staining
with 0.33% methylene blue-0.11% basic fuchsin in methanol. Titers
are reported as percentages of F9 cell colonies relative to NIH 3T3
cell colonies. Average relative titrations are reported with standard errors.
Viral titer determination by RNA dot blot assay.
Individual
PA317 colonies transfected with HSC1 virus were picked, and high-titer
producer clones were identified by viral RNA dot blot assay as
previously described (32). Briefly, viral RNA was extracted
from 0.4 ml of viral supernatant by using Trizol LS (Gibco-BRL) and
transferred to a nitrocellulose membrane. The membrane was hybridized
with a 1-kb neo probe in Express Hyb solution (Clontech,
Palo Alto, Calif.). As a titration control, 0.4 ml of isolated N2 viral
RNA was blotted neat and at 1/10 and 1/100 dilutions.
 |
RESULTS |
Murine stem cell virus (MSCV) is a variant form of MoMLV that
contains a mutation within the PBS, lacks one of two DR elements (Fig.
1A), and was designed for optimal
expression in hematopoietic and ES cells (20). However, MSCV
also contains the wild-type NCR and LTR promoter elements. Between the
NCR and DR, MSCV has no embryonal LTR-binding protein site and contains
a novel Sp1 activator-binding site (20). We have shown that
the MSCV 5' LTR and flanking gag sequence are sufficient to
completely silence the BGT14 transgene in seven of eight transgenic
animals (36). It is not clear whether any single retroviral
silencer element is sufficient to establish this transgene silencing,
and this information is important for construction of nonsilenced
retroviral vectors.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic diagram of retroviral sequences and transgene
(Tg) constructs. (A) Locations of the NCR, DR, and PBS elements in the
MoMLV 5' LTR. The drawing is not to scale. The differences between
MoMLV and MSCV are shown at the bottom. The boxed elements within MSCV
indicate elements used in transgenic constructs. Y, YY-1-binding site;
E, embryonal LTR-binding protein binding site; S, Sp1-binding site;
Pro, wild-type proline tRNA-binding site; Gln, mutant glutamine
tRNA-binding site. Dots represent all of the CpG dinucleotides present
in the LTR. (B) Schematic diagram of transgenic constructs containing
retroviral silencer elements linked to the BGT14 LCR -globin
transgene. Black boxes, -globin gene introns; P815, 815-bp human
-globin gene promoter (PROM); E, human -globin gene enhancer; 1, primer LTRPCRF; 2, primer LTRPCRR; 3, primer LTRSEQF; 4, primer
LTRSEQR. (C) Schematic diagram of the HSC1 retrovirus construct.
|
|
Individual silencer elements in transgenic mice.
To determine
whether the individual silencer elements in MSCV are sufficient to
silence the
-globin LCR, we linked oligonucleotides spanning the PBS
(38 bp), NCR (74 bp), and DR (86 bp) regions of MSCV to the antisense
BGT14 transgene to create transgene constructs BGT52, BGT53, and BGT56,
respectively (Fig. 1B). BGT14 is expressed at 16 to 71% per transgene
copy and at all integration sites (11) and therefore is an
excellent reporter for silencing activity. The antisense orientation is
preferred in
-globin retrovirus vectors in order to preserve the
introns during retrovirus replication (27, 43). In addition
to the PBS, NCR, and DR silencing elements, the LTR promoter region
contains multiple CpG sites which are potential sites of methylation.
We therefore linked the 187-bp XbaI-KpnI LTR
promoter to the BGT14 transgene to generate transgene BGT57. Transgenic
mice were generated as previously described (11). Embryonic
day 15.5 founder animals for these individual silencer constructs were
analyzed for transgene copy number and intactness by Southern blotting.
Transgene mosaicism in the fetal livers of these founder animals was
calculated by comparison of their signal intensity with that of the
single-copy B26 bred line. Analysis of founder animals excludes passage
of the transgene through the germ line and is an accurate model of
somatic gene therapy, since patients will also be mosaic for the transgene.
Transgene expression was analyzed by S1 nuclease assays on fetal liver
RNA, and expression levels were calculated to take
into account the
level of transgene mosaicism and copy number.
Mouse

-globin
transgenes alone, in the absence of the LCR, express
up to 2% of the
endogenous mouse

major globin gene per copy
(
39,
42).
This level of expression indicates that the LCR
is not functional and
hence that partial silencing has occurred.
Complete silencing is
defined as absence of detectable transgene
expression. Expression of
human

-globin mRNA from BGT52 transgenes
ranged from 32 to 123% per
copy, suggesting that the mutant PBS
in MSCV is not sufficient to
convey transgene silencing at a low
copy number (Fig.
2). The BGT53 transgene also expressed
human

-globin in all transgenic mice at levels between 6 and 137%
per
copy (Fig.
2). Therefore, the wild-type NCR present in MSCV is
not
sufficient to convey transgene silencing at copy numbers of
seven or
lower.

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 2.
Expression of globin mRNA in transgenic mice containing
the BGT52 and -53 transgenes. S1 nuclease analysis of globin expression
in RNA of 15.5-day fetal livers showing that the mutant PBS and NCR
(respectively) of the MSCV retrovirus are not sufficient to silence LCR
-globin transgenes in mice. Transgene (Tg) copy number and percent
transgenicity in the liver are shown at the top, and transgene
expression is shown at the bottom. Hu , human -globin protected
probe fragment; Mo , mouse major protected probe fragment; Ntg,
nontransgenic; µD; one-copy µD14 microlocus transgenic line. The
sizes of the protected fragments for the Hu and Mo probes are
shown below. nt, nucleotides.
|
|
In contrast to the above-described PBS and NCR constructs, very high
copy numbers were obtained with the BGT56 and BGT57 transgenes.
Full
expression from such high-copy transgenes would be expected
to cause
fatal thalassemia, and therefore it was likely that these
constructs
were silenced. S1 analysis of BGT56 fetal liver RNA
showed that
transgene copy numbers of greater than 25 result in
significant human

-globin expression, but per-copy expression
is extremely low,
consistent with a partial-silencing phenotype
(Fig.
3A). At lower copy numbers, BGT56 was
expressed at 3 to
77% per copy. Similarly, the BGT57 transgene was
partially silenced
at copy numbers of greater than 15 (Fig.
3B).
Although the range
of expression at low copy numbers is greater than
expected, these
data show that at higher copy numbers the DR and LTR
promoter
from MSCV are sufficient to convey partial transgene silencing
and suggest that their removal from the vector would improve expression
in primitive cell types.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 3.
Expression of globin mRNA in transgenic mice containing
transgene (Tg) BGT56 and transgene BGT57. (A) S1 nuclease analysis of
globin expression in RNA of 15.5-day fetal livers showing that the DR
element in high-copy BGT56 transgenic animals partially silences LCR
-globin transgenes. (B) S1 nuclease analysis of globin expression in
RNA of 15.5-day fetal livers showing that the LTR promoter element in
high-copy BGT57 transgenic animals partially silences LCR -globin
transgenes. Abbreviations are as in Fig. 2.
|
|
Methylation studies on the LTR promoter fragment.
Silencing by
the DR is likely to be established by the trans-acting
factors that bind to it, but the presence of a cluster of 13 CpG sites
in the LTR promoter suggests that methylation is involved in silencing
mediated by this region. For example, if these CpG sites were
methylated, they could be bound by MeCP1 or MeCP2 (10, 29,
53). To test whether a methylated LTR promoter fragment can bind
an MeCP-like protein, we performed gel retardation competition assays
(45). In the assay shown in Fig.
4A, the M-CG11 probe is bound by an MeCP
complex present in HeLa extracts and the MeCP complex is competed with
the highest efficiency by in vitro-methylated
XbaI-KpnI LTR promoter fragments. These data
suggest that a methylated LTR promoter could bind MeCPs in vivo.

View larger version (84K):
[in this window]
[in a new window]
|
FIG. 4.
Methylation analysis of the LTR promoter. (A)
Competition for MeCP complexes by an in vitro-methylated MSCV LTR
promoter fragment. This mobility shift assay for MeCP complexes binding
to methylated probe M-CG 11 shows that a methylated
XbaI-KpnI MSCV LTR promoter fragment competes for
binding better than an unmethylated LTR fragment. UM, unmethylated; M,
methylated; MeCPC, methylcytosine-binding protein complex. (B)
Methylation of CpG sites within the MSCV LTR. Bisulfite sequencing of
the LTR promoter region from an animal not expressing BGT57 (BB5) and
an animal expressing BGT57 (BB73) is shown. Unmethylated cytosines have
been converted to thymidines. Restriction enzyme sites are indicated.
Dots represent CpG dinucleotides.
|
|
As MeCP factors bind only to methylated CpG sites, the methylation
status of the LTR promoter may be critical for silencing.
To determine
whether there is any correlation between methylation
of the LTR
promoter and transgene silencing, we bisulfite sequenced
this region
from two BGT57 animals; founder 73 had two concatemeric
transgene
copies and expressed the transgene highly, whereas founder
5 had 35 transgene copies and expression was silenced to only
0.4% per copy
(Fig.
3B). Figure
4B shows that both founders 5
and 73 are strongly
methylated throughout the LTR promoter, indicating
that methylation of
the LTR promoter does not absolutely correlate
with silencing of the
linked

-globin
promoter.
Partial relief of silencing by multiple mutations.
The finding
that no single known silencer element tested in MSCV was sufficient to
silence the reporter transgene at all integration sites suggests that
multiple silencers cooperate to impose complete silencing on linked
genes. Therefore, we wished to test whether removal of multiple
silencing elements could alleviate transgene silencing. We truncated
the LTR sequence 5' of the SacI site in MSCV to remove the
NCR, the DR element, and approximately half of the CpG sites within the
LTR promoter. The resulting fragment contains the mutant PBS and was
linked to the antisense BGT14 transgene to create the BGT58 construct
(Fig. 1B). Six of 10 BGT58 transgenic animals expressed the transgene
at 2 to 74% per copy (Fig. 5), showing
that the truncated LTR construct can escape complete silencing at many
integration sites and is superior to the MSCV vector in this regard.
Moreover, these data confirm that removal of multiple elements
alleviates silencing most effectively (6, 18, 20, 41) and
also show that silencers remain in BGT58.

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 5.
Expression of globin mRNA in transgenic mice containing
the BGT58 transgene. S1 nuclease analysis of globin expression in RNA
of 15.5-day fetal livers shows that 60% of the transgenic animals
escaped complete silencing. Abbreviations are as in Fig. 2.
|
|
HSC1 retrovirus vector generation.
Finally, we determined
whether the truncated LTR in BGT58 could be used to generate an
infectious retroviral vector. Sequences between the NheI and
SacI sites were removed from the 3' LTR of the MSCVneoEB
vector (Fig. 1C). The resulting HSC1 vector was transfected into PA317
packaging cells to produce retrovirus stocks for titration on F9 EC
cells and NIH 3T3 fibroblasts (Table 1). F9 cells silence MoMLV-based retrovirus vectors, as shown by the 0.4% ± 0.1% relative titer of N2 virus (2) on F9 cells compared to NIH 3T3 cells. The relative titer of MSCV was 43% ± 14%, whereas HSC1 expressed neo in 71% ± 15% of infected F9 cells.
These findings demonstrate that the HSC1 retrovirus is infectious,
efficiently transfers genes into mammalian cells, and effectively
escapes silencing in most transgenic mice and infected F9 cells.
The HSC1 titer from the producer populations is too low for efficient
gene transfer into bone marrow. To identify a high-titer
clone, HSC1
producer colonies were isolated from freshly transfected
PA317 cells
and its titer was determined by a viral RNA dot blot
assay
(
32). As shown in Fig.
6, this
assay rapidly identified
five potentially high-titer producer clones.
Virus from these
clones was subjected to biological titration on NIH
3T3 cells
and found to have titers of up to 3 × 10
6
G418
r CFU/ml that directly correlated with the RNA dot blot
signal
intensity. Such high titers and improved expression levels from
HSC1 vectors are well suited for gene therapy of stem cells.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 6.
Determination of the virus titers of individual clones
of HSC1-producing PA317 packaging cells. Shown is a viral RNA dot blot
assay with a neo probe done to identify high-titer HSC1
producer clones. The biological titers of five highly producing clones
in NIH 3T3 cells are shown at the bottom. Serial dilutions of N2 virus
are shown in the top row.
|
|
 |
DISCUSSION |
Successful gene therapy of blood diseases in hematopoietic stem
cells will require the development of nonsilenced retrovirus vectors
(5, 50, 52). To this end, we found that no single known
element in the MSCV vector is sufficient for complete silencing in
transgenic mice, that the DR and LTR promoter elements partially silence high-copy transgenes, and that methylation of the LTR promoter
does not correlate with silencing. Finally, we mutated all four
silencer elements to create the HSC1 retrovirus vector, which escapes
silencing in about 60% of transgenic mice and transduced F9 cells.
Individual PBS and NCR elements fail to silence transgenes.
The BGT52 construct expresses human
-globin in all transgenic mice,
showing that the 38-bp mutant PBS element is not sufficient for
silencing. This is not surprising, since the mutant PBS element is
unable to bind factor A, which has been implicated in silencing (38). The 74-bp NCR element in BGT53 is wild type and binds the multifunctional YY-1 factor but is also unable to silence expression in our transgenic assay, suggesting that recruitment of the
RPD3 histone deacetylase by YY-1 (54) is not sufficient to
establish silencing. If such putative RPD3 recruitment occurs in vivo
and is important for silencing, then it must also require additional
retrovirus sequences for this function. As such, the NCR behaves in a
manner similar to the Drosophila engrailed silencer element,
which contains a consensus YY-1 site that is bound by the YY-1 homolog
pleiohomeotic (PHO), a member of the polycomb group of factors
(4). In Drosophila spp., multiple copies of engrailed silencer YY-1 sites are not sufficient for
polycomb-dependent silencing, indicating that surrounding sequences are
also important in this system. We have examined a series of other
potential YY-1 consensus sites (55) in MSCV by using gel
retardation assays but found that only the NCR site bound the YY-1
factor in vitro (data not shown).
DR and LTR promoter elements partially silence high-copy
transgenes.
The BGT56 construct is able to partially silence the
LCR
-globin reporter at greater than 25 transgene copies, but
low-copy transgenes were expressed. These data demonstrate that the
86-bp DR element in BGT56 is sufficient for partial silencing at a high copy number, suggesting that DR elements interact with each other for
this function. Similar silencing at high copy numbers has been observed
with lacZ reporter transgenes (16). At a lower copy number, the DR has little effect on transgene expression but may
functionally interact with other silencer elements in an intact
single-copy retrovirus vector. Given this concern, the DR element
should be removed from gene therapy vectors. Multiple trans-acting factors bind through the DR region
(46), and it is not clear from our analysis which sequences
are involved in silencing. However, the DR elements have previously
been deleted in self-inactivating retrovirus vectors and therefore are
dispensable (57).
The LTR promoter element present in BGT57 is also sufficient for
partial silencing at greater than 15 transgene copies, suggesting
an
interaction between multiple promoter elements. The specific
sequences
responsible for silencing have not been precisely fine
mapped, but the
13 CpG sites clustered within the fragment where
methylation occurs are
good candidates for mediators of silencing
activity. Examination of
methylation by bisulfite genomic sequencing
revealed no major
difference between expressed low-copy and silenced
high-copy BGT57
transgenes. This indicates that methylation does
not absolutely
correlate with silencing of C-type retroviruses
in mammals, although a
threshold of greater than 15 methylated
elements may be sufficient for
partial silencing. This finding
agrees with recent data suggesting that
methylation does not correlate
with silencing of retrotransposons in
the invertebrate chordate
Ciona intestinalis (
44)
but contrasts with data supporting a
role for methylation in the
silencing of murine IAP-type retroviruses
(
51).
A methylated LTR promoter fragment was able to compete in binding
assays for MeCP complexes. These experiments suggest that
MeCP complex
binding in vivo distinguishes the silenced from the
expressed
transgenes and functions by recruiting mSin3a corepressor-histone
deactylase complexes, as has recently been described for MeCP2
(
24,
33). In this scenario, MeCP complex binding would not
be entirely dependent on the presence of methylation alone and
may
require a threshold number of methylated elements. Since MeCP
complexes
are barely detectable in F9 cells (
31), the probability
of
MeCP binding in embryonic cells would be greater when multiple
methylated LTR promoter elements are present. Regardless of the
specific mechanism, prudence suggests that the LTR promoter be
removed
from the vector in a way that permits retrovirus
replication.
Multiple elements influence silencing.
It has previously been
shown that combined mutations in some of the known retrovirus silencers
lead to improved gene expression in primitive ES cells (6, 18, 20,
41). To examine whether combined mutations in all four elements
relieve silencing in transgenic mice, we created the BGT58 construct.
This transgene resulted from a truncation of sequences 5' of the
SacI site in the middle of the LTR promoter that also
removed the NCR and DR elements. The remaining sequences in the LTR
promoter include the TATA box, and this is coupled to the mutant PBS
and gag sequences of MSCV. An MoMLV vector backbone
containing the equivalent deletion and the wild-type PBS completely
silences a 5'HS2
-globin transgene in mice (30). However,
6 of 10 transgenic mice generated with the BGT58 construct expressed
the transgene at between 2 and 74% per copy. These data show that
combined mutations of all four of the silencer elements relieve
complete silencing in most transgenic mice and are a large improvement
over the undetectable expression from intact MSCV sequences. However, 4 of 10 BGT58 transgenic mice were completely silenced, indicating that
functional silencer elements remain in the construct. Given that no
individual MSCV silencer element is sufficient for complete silencing
in transgenic mice, we propose that silencing may require multiple
pathways which act on different elements.
HSC1 virus generation.
The BGT58 construct escapes complete
silencing in most transgenic mice, but it is unclear whether infectious
retrovirus stocks could be made with a similarly large deletion from
the NheI site 5' of the NCR to the SacI site near
the TATA box in the LTR promoter. A precedent does exist for deletion
of the NCR (6, 41) and deletion from the DR to the
SacI site (57). Therefore, we created the HSC1
deletion in the 3' LTR of MSCV and generated retrovirus stocks from
PA317 packaging cell populations. Infection of F9 and NIH 3T3 cells
demonstrated that 71% of the F9 cells expressed this neo
vector, in contrast to the 43% relative titer of the parental MSCV
vector and the 0.4% of the MoMLV-based N2 vector (2). These
results show that expression by HSC1 is superior to expression by MSCV
in F9 cells. Furthermore, individual HSC1 clones could be isolated from
packaging cell populations that have infectious virus titers of up to
3 × 106 G418r colonies/ml.
Future vector development.
The HSC1 vector is a clear
improvement on the MSCV vector and is the only retrovirus vector that
contains mutations in all four known silencer elements. It also has the
added safety of being self-inactivating, which reduces the likelihood
of a recombination event that could generate a replication-competent
retrovirus (58). It may therefore prove to be suitable for
use in blood gene therapy applications. Nevertheless, there is room for
further improvement, as 30 to 40% of the BGT58 transgenic mice and
HSC1-transduced F9 cells failed to express the transgene. We conclude
that either the remaining half of the LTR promoter contains silencing
activity or novel silencer elements exist in the U5 and
gag sequences. These sequences can be tested individually in
the transgenic assay or can be mutated within the context of the BGT58 construct.
Alternatively, the residual silencing may be due to a promoter
interference effect in which transcription from the LTR prevents
expression of the internal

-globin promoter. Reverse
transcription-PCR
experiments with fetal liver RNA from MSCV-silenced
transgenic
mice failed to provide any evidence of such LTR expression
across
the junction from
gag to the 3'

-globin sequences
(data not shown),
and the HSC1 promoter would be predicted to be
exceptionally weak
in nonsilenced cell types, as it merely contains a
TATA box. Efforts
are in progress to overcome the residual silencing
activity through
the development of more powerful LCR

-globin
transgenes that
are routinely expressed at near endogenous levels in
single-copy
animals (
37) and by testing of the ability of
insulator elements
(
8) to limit the spread of silencing from
the retrovirus vector
sequences into the internally located

-globin
promoter. A better
understanding of the mechanism of retrovirus
silencing will also
facilitate efforts to develop pharmacological
inhibitors of silencing
for use in conjunction with gene therapy
vectors.
 |
ACKNOWLEDGMENTS |
This work was supported by grants from the Bayer/CRCS Research
and Development Fund and the Medical Research Council of Canada to
J.E.; NIH grant R37-DK29902 and a grant from the Masonic Cancer Center
Fund, Inc., to G.D.G.; and an Ontario Thalassemia Foundation Fellowship
to C.S.O.
We thank P. Leboulch for the p141 plasmid, R. Hawley for the MSCVneoEB
plasmid, and J. Dick for N2/PA317#14 cells. We are indebted to P.B.
Robbins for helpful discussions, R. Hawley and J. Dick for reading the
manuscript, D. Tran for technical assistance, and F. Posteraro for
secretarial assistance.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Program in
Developmental Biology, Hospital for Sick Children, 555 University Ave., Toronto, Ontario, Canada M5G 1X8. Phone: (416) 813-7295. Fax: (416)
813-8883. E-mail: jellis{at}sickkids.on.ca.
Present address: Section of Hematology and Medical Oncology, LSU
Medical Center, Shreveport, LA 71130-3932.
 |
REFERENCES |
| 1.
|
Antoniou, M.,
E. deBoer,
G. Habets, and F. Grosveld.
1988.
The human beta-globin gene contains multiple regulatory regions: identification of one promoter and two downstream enhancers.
EMBO J.
7:377-384[Medline].
|
| 2.
|
Armentano, D.,
S. F. Yu,
P. W. Kantoff,
T. von Ruden,
W. F. Anderson, and E. Gilboa.
1987.
Effect of internal viral sequences on the utility of retroviral vectors.
J. Virol.
61:1647-1650[Abstract/Free Full Text].
|
| 3.
|
Barklis, E.,
R. C. Mulligan, and R. Jaenisch.
1986.
Chromosomal position or virus mutation permits retrovirus expression in embryonal carcinoma cells.
Cell
47:391-399[Medline].
|
| 4.
|
Brown, J. L.,
D. Mucci,
M. Whiteley,
M.-L. Dirksen, and J. A. Kassis.
1998.
The Drosophila polycomb group gene pleiohomeotic encodes a DNA binding protein with homology to the transcription factor YY1.
Mol. Cell
1:1057-1064[Medline].
|
| 5.
|
Challita, P. M., and D. B. Kohn.
1994.
Lack of expression from a retroviral vector after transduction of murine hematopoietic stem cells is associated with methylation in vivo.
Proc. Natl. Acad. Sci. USA
91:2567-2571[Abstract/Free Full Text].
|
| 6.
|
Challita, P.-M.,
D. Skelton,
A. el-Khoueiry,
X.-J. Yu,
K. Weinberg, and D. B. Kohn.
1995.
Multiple modifications in cis elements of the long terminal repeat of retroviral vectors lead to increased expression and decreased DNA methylation in embryonic carcinoma cells.
J. Virol.
69:748-755[Abstract].
|
| 7.
|
Chen, W. Y.,
E. C. Bailey,
S. L. McCune,
J. Y. Dong, and T. M. Townes.
1997.
Reactivation of silenced, virally transduced genes by inhibitors of histone deacetylase.
Proc. Natl. Acad. Sci. USA
94:5798-5803[Abstract/Free Full Text].
|
| 8.
|
Chung, J. H.,
M. Whiteley, and G. Felsenfeld.
1993.
A 5' element of the chicken beta-globin domain serves as an insulator in human erythroid cells and protects against position effect in Drosophila.
Cell
74:505-514[Medline].
|
| 9.
|
Colicelli, J., and S. P. Goff.
1986.
Isolation of a recombinant murine leukemia virus utilizing a new primer tRNA.
J. Virol.
57:37-45[Abstract/Free Full Text].
|
| 10.
|
Cross, S. H.,
R. R. Meehan,
X. Nan, and A. Bird.
1997.
A component of the transcriptional repressor MeCP1 shares a motif with DNA methyltransferase and HRX proteins.
Nat. Genet.
16:256-259[Medline].
|
| 11.
|
Ellis, J.,
P. Pasceri,
K. C. Tan-Un,
X. Wu,
A. Harper,
P. Fraser, and F. Grosveld.
1997.
Evaluation of beta-globin gene therapy constructs in single copy transgenic mice.
Nucleic Acids Res.
25:1296-1302[Abstract/Free Full Text].
|
| 12.
|
Ellis, J.,
K. C. Tan-Un,
A. Harper,
D. Michalovich,
N. Yannoutsos,
S. Philipsen, and F. Grosveld.
1996.
A dominant chromatin-opening activity in 5' hypersensitive site 3 of the human beta-globin locus control region.
EMBO J.
15:562-568[Medline].
|
| 13.
|
Flanagan, J. R.,
K. G. Becker,
D. L. Ennist,
S. L. Gleason,
P. H. Driggers,
B. Z. Levi,
E. Appella, and K. Ozato.
1992.
Cloning of a negative transcription factor that binds to the upstream conserved region of Moloney murine leukemia virus.
Mol. Cell. Biol.
12:38-44[Abstract/Free Full Text].
|
| 14.
|
Flanagan, J. R.,
A. M. Krieg,
E. E. Max, and A. S. Khan.
1989.
Negative control region at the 5' end of murine leukemia virus long terminal repeats.
Mol. Cell. Biol.
9:739-746[Abstract/Free Full Text].
|
| 15.
|
Forrester, W. C.,
C. Thompson,
J. T. Elder, and M. Groudine.
1986.
A developmentally stable chromatin structure in the human beta-globin gene cluster.
Proc. Natl. Acad. Sci. USA
83:1359-1363[Abstract/Free Full Text].
|
| 16.
|
Garrick, D.,
S. Fiering,
D. I. Martin, and E. Whitelaw.
1998.
Repeat-induced gene silencing in mammals.
Nat Genet.
18:56-59[Medline].
|
| 17.
|
Gautsch, J. W., and M. C. Wilson.
1983.
Delayed de novo methylation in teratocarcinoma suggests additional tissue-specific mechanisms for controlling gene expression.
Nature
301:32-37[Medline].
|
| 18.
|
Grez, M.,
E. Akgun,
F. Hilberg, and W. Ostertag.
1990.
Embryonic stem cell virus, a recombinant murine retrovirus with expression in embryonic stem cells.
Proc. Natl. Acad. Sci. USA
87:9202-9206[Abstract/Free Full Text].
|
| 19.
|
Grosveld, F.,
G. B. van Assendelft,
D. R. Greaves, and G. Kollias.
1987.
Position-independent, high-level expression of the human beta-globin gene in transgenic mice.
Cell
51:975-985[Medline].
|
| 20.
|
Hawley, R. G.,
F. H. Lieu,
A. Z. Fong, and T. S. Hawley.
1994.
Versatile retroviral vectors for potential use in gene therapy.
Gene Ther.
1:136-138[Medline].
|
| 21.
|
Hilberg, F.,
C. Stocking,
W. Ostertag, and M. Grez.
1987.
Functional analysis of a retroviral host-range mutant: altered long terminal repeat sequences allow expression in embryonal carcinoma cells.
Proc. Natl. Acad. Sci. USA
84:5232-5236[Abstract/Free Full Text].
|
| 22.
|
Jaenisch, R.
1997.
DNA methylation and imprinting: why bother?
Trends Genet.
13:323-329[Medline].
|
| 23.
|
Jahner, D.,
H. Stuhlmann,
C. L. Stewart,
K. Harbers,
J. Lohler,
I. Simon, and R. Jaenisch.
1982.
De novo methylation and expression of retroviral genomes during mouse embryogenesis.
Nature
298:623-628[Medline].
|
| 24.
|
Jones, P. L.,
G. J. C. Veenstra,
P. A. Wade,
D. Vermaak,
S. U. Kass,
N. Landsberger,
J. Strouboulis, and A. P. Wolffe.
1998.
Methylated DNA and MeCP2 recruit histone deacetylase to repress transcription.
Nat. Genet.
19:188-191.
|
| 25.
|
Kempler, G.,
B. Freitag,
B. Berwin,
O. Nanassy, and E. Barklis.
1993.
Characterization of the Moloney murine leukemia virus stem cell-specific repressor binding site.
Virology
193:690-699[Medline].
|
| 26.
|
Larochelle, A.,
J. Vormoor,
H. Hanenberg,
J. C. Wang,
M. Bhatia,
T. Lapidot,
T. Moritz,
B. Murdoch,
X. L. Xiao,
I. Kato,
D. A. Williams, and J. E. Dick.
1996.
Identification of primitive human hematopoietic cells capable of repopulating NOD/SCID mouse bone marrow: implications for gene therapy.
Nat. Med.
2:1329-1337[Medline].
|
| 27.
|
Leboulch, P.,
G. M. Huang,
R. K. Humphries,
Y. H. Oh,
C. J. Eaves,
D. Y. Tuan, and I. M. London.
1994.
Mutagenesis of retroviral vectors transducing human beta-globin gene and beta-globin locus control region derivatives results in stable transmission of an active transcriptional structure.
EMBO J.
13:3065-3076[Medline].
|
| 28.
|
Lei, H.,
S. P. Oh,
M. Okano,
R. Juttermann,
K. A. Goss,
R. Jaenisch, and E. Li.
1996.
De novo DNA cytosine methyltransferase activities in mouse embryonic stem cells.
Development
122:3195-3205[Abstract].
|
| 29.
|
Lewis, J. D.,
R. R. Meehan,
W. J. Henzel,
I. Maurer-Fogy,
P. Jeppesen,
F. Klein, and A. Bird.
1992.
Purification, sequence, and cellular localization of a novel chromosomal protein that binds to methylated DNA.
Cell
69:905-914[Medline].
|
| 30.
|
McCune, S. L., and T. M. Townes.
1994.
Retroviral vector sequences inhibit human beta-globin gene expression in transgenic mice.
Nucleic Acids Res.
22:4477-4481[Abstract/Free Full Text].
|
| 31.
|
Meehan, R. R.,
J. D. Lewis,
S. McKay,
E. L. Kleiner, and A. P. Bird.
1989.
Identification of a mammalian protein that binds specifically to DNA containing methylated CpGs.
Cell
58:499-507[Medline].
|
| 32.
|
Murdoch, B.,
D. S. Pereira,
X. Wu,
J. E. Dick, and J. Ellis.
1997.
A rapid screening procedure for the identification of high-titer retrovirus packaging clones.
Gene Ther.
4:744-749[Medline].
|
| 33.
|
Nan, X.,
H.-H. Ng,
C. A. Johnson,
C. D. Laherty,
B. M. Turner,
R. N. Eisenman, and A. Bird.
1998.
Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex.
Nature
393:386-389[Medline].
|
| 34.
|
Niwa, O.,
Y. Yokota,
H. Ishida, and T. Sugahara.
1983.
Independent mechanisms involved in suppression of the Moloney leukemia virus genome during differentiation of murine teratocarcinoma cells.
Cell
32:1105-1113[Medline].
|
| 35.
|
Okano, M.,
S. Xie, and E. Li.
1998.
Cloning and characterization of a family of novel mammalian DNA (cytosine-5) methyltransferases.
Nat. Genet.
19:219-220[Medline].
|
| 36.
| Pannell, D., C. S. Osborne, P. Pasceri, A. Karaiskakis, H. D. Lipshitz, and J. Ellis. Submitted for
publication.
|
| 37.
|
Pasceri, P.,
D. Pannell,
X. Wu, and J. Ellis.
1998.
Full activity from human beta-globin locus control region transgenes requires 5'HS1, distal beta-globin promoter and 3' beta-globin sequences.
Blood
92:653-663[Abstract/Free Full Text].
|
| 38.
|
Petersen, R.,
G. Kempler, and E. Barklis.
1991.
A stem cell-specific silencer in the primer-binding site of a retrovirus.
Mol. Cell. Biol.
11:1214-21[Abstract/Free Full Text].
|
| 39.
|
Philipsen, S.,
S. Pruzina, and F. Grosveld.
1993.
The minimal requirements for activity in transgenic mice of hypersensitive site 3 of the beta globin locus control region.
EMBO J.
12:1077-1085[Medline].
|
| 40.
|
Robbins, P. B.,
D. C. Skelton,
X. J. Yu,
S. Halene,
E. H. Leonard, and D. B. Kohn.
1998.
Consistent, persistent expression from modified retroviral vectors in murine hematopoietic stem cells.
Proc. Natl. Acad. Sci. USA
95:10182-10187[Abstract/Free Full Text].
|
| 41.
|
Robbins, P. B.,
X. J. Yu,
D. M. Skelton,
K. A. Pepper,
R. M. Wasserman,
L. Zhu, and D. B. Kohn.
1997.
Increased probability of expression from modified retroviral vectors in embryonal stem cells and embryonal carcinoma cells.
J. Virol.
71:9466-9474[Abstract].
|
| 42.
|
Ryan, T. M.,
R. R. Behringer,
N. C. Martin,
T. M. Townes,
R. D. Palmiter, and R. L. Brinster.
1989.
A single erythroid-specific DNase I super-hypersensitive site activates high levels of human beta-globin gene expression in transgenic mice.
Genes Dev.
3:314-323[Abstract/Free Full Text].
|
| 43.
|
Sadelain, M.,
C. H. Wang,
M. Antoniou,
F. Grosveld, and R. C. Mulligan.
1995.
Generation of a high-titer retroviral vector capable of expressing high levels of the human beta-globin gene.
Proc. Natl. Acad. Sci. USA
92:6728-6732[Abstract/Free Full Text].
|
| 44.
|
Simmen, M. W.,
S. Leitgeb,
J. Charlton,
S. J. Jones,
B. R. Harris,
V. H. Clark, and A. Bird.
1999.
Nonmethylated transposable elements and methylated genes in a chordate genome.
Science
283:1164-1167[Abstract/Free Full Text].
|
| 45.
|
Singal, R.,
R. Ferris,
J. A. Little,
S. Z. Wang, and G. D. Ginder.
1997.
Methylation of the minimal promoter of an embryonic globin gene silences transcription in primary erythroid cells.
Proc. Natl. Acad. Sci. USA
94:13724-13729[Abstract/Free Full Text].
|
| 46.
|
Speck, N. A., and D. Baltimore.
1987.
Six distinct nuclear factors interact with the 75-base-pair repeat of the Moloney murine leukemia virus enhancer.
Mol. Cell. Biol.
7:1101-1110[Abstract/Free Full Text].
|
| 47.
|
Stewart, C. L.,
H. Stuhlmann,
D. Jahner, and R. Jaenisch.
1982.
De novo methylation, expression, and infectivity of retroviral genomes introduced into embryonal carcinoma cells.
Proc. Natl. Acad. Sci. USA
79:4098-4102[Abstract/Free Full Text].
|
| 48.
|
Tuan, D.,
W. Solomon,
Q. Li, and I. M. London.
1985.
The "beta-like-globin" gene domain in human erythroid cells.
Proc. Natl. Acad. Sci. USA
82:6384-6388[Abstract/Free Full Text].
|
| 49.
|
Tucker, K. L.,
C. Beard,
J. Dausmann,
L. Jackson-Grusby,
P. W. Laird,
H. Lei,
E. Li, and R. Jaenisch.
1996.
Germ-line passage is required for establishment of methylation and expression patterns of imprinted but not of nonimprinted genes.
Genes Dev.
10:1008-1020[Abstract/Free Full Text].
|
| 50.
|
Verma, I. M., and N. Somia.
1997.
Gene therapy promises, problems and prospects.
Nature
389:239-242[Medline].
|
| 51.
|
Walsh, C. P., and T. H. Bestor.
1999.
Cytosine methylation and mammalian development.
Genes Dev.
13:112-124[Abstract/Free Full Text].
|
| 52.
|
Weinberg, K. I., and D. B. Kohn.
1998.
Gene therapy for congenital lymphoid immunodeficiency diseases.
Semin. Hematol.
35:354-366[Medline].
|
| 53.
|
Weitzel, J. M.,
H. Buhrmester, and W. H. Stratling.
1997.
Chicken MAR-binding protein ARBP is homologous to rat methyl-CpG-binding protein MeCP2.
Mol. Cell. Biol.
17:5656-5666[Abstract].
|
| 54.
|
Yang, W. M.,
C. Inouye,
Y. Zeng,
D. Bearss, and E. Seto.
1996.
Transcriptional repression by YY1 is mediated by interaction with a mammalian homolog of the yeast global regulator RPD3.
Proc. Natl. Acad. Sci. USA
93:12845-50[Abstract/Free Full Text].
|
| 55.
|
Yant, S. R.,
W. Zhu,
D. Millinoff,
J. L. Slightom,
M. Goodman, and D. L. Gumucio.
1995.
High affinity YY1 binding motifs: identification of two core types (ACAT and CCAT) and distribution of potential binding sites within the human beta globin cluster.
Nucleic Acids Res.
23:4353-4362[Abstract/Free Full Text].
|
| 56.
|
Yoder, J. A.,
C. P. Walsh, and T. H. Bestor.
1997.
Cytosine methylation and the ecology of intragenomic parasites.
Trends Genet.
13:335-340[Medline].
|
| 57.
|
Yu, S. F.,
T. von Ruden,
P. W. Kantoff,
C. Garber,
M. Seiberg,
U. Ruther,
W. F. Anderson,
E. F. Wagner, and E. Gilboa.
1986.
Self-inactivating retroviral vectors designed for transfer of whole genes into mammalian cells.
Proc. Natl. Acad. Sci. USA
83:3194-8[Abstract/Free Full Text].
|
| 58.
|
Zufferey, R.,
T. Dull,
R. J. Mandel,
A. Bukovsky,
D. Quiroz,
L. Naldini, and D. Trono.
1998.
Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery.
J. Virol.
72:9873-9880[Abstract/Free Full Text].
|
Journal of Virology, July 1999, p. 5490-5496, Vol. 73, No. 7
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Swindle, C. S., Kim, H. G., Klug, C. A.
(2004). Mutation of CpGs in the Murine Stem Cell Virus Retroviral Vector Long Terminal Repeat Represses Silencing in Embryonic Stem Cells. J. Biol. Chem.
279: 34-41
[Abstract]
[Full Text]
-
Yao, S., Osborne, C. S., Bharadwaj, R. R., Pasceri, P., Sukonnik, T., Pannell, D., Recillas-Targa, F., West, A. G., Ellis, J.
(2003). Retrovirus silencer blocking by the cHS4 insulator is CTCF independent. Nucleic Acids Res
31: 5317-5323
[Abstract]
[Full Text]
-
Haas, D. L., Lutzko, C., Logan, A. C., Cho, G. J., Skelton, D., Jin Yu, X., Pepper, K. A., Kohn, D. B.
(2003). The Moloney Murine Leukemia Virus Repressor Binding Site Represses Expression in Murine and Human Hematopoietic Stem Cells. J. Virol.
77: 9439-9450
[Abstract]
[Full Text]
-
Staplin, W. R., Knezetic, J. A.
(2003). BVL-1-like VL30 promoter sustains long-term expression in erythroid progenitor cells. Blood
101: 1798-1800
[Abstract]
[Full Text]
-
Leimig, T., Mann, L., Martin, M. d. P., Bonten, E., Persons, D., Knowles, J., Allay, J. A., Cunningham, J., Nienhuis, A. W., Smeyne, R., d'Azzo, A.
(2002). Functional amelioration of murine galactosialidosis by genetically modified bone marrow hematopoietic progenitor cells. Blood
99: 3169-3178
[Abstract]
[Full Text]
-
Shayakhmetov, D. M., Carlson, C. A., Stecher, H., Li, Q., Stamatoyannopoulos, G., Lieber, A.
(2002). A High-Capacity, Capsid-Modified Hybrid Adenovirus/Adeno-Associated Virus Vector for Stable Transduction of Human Hematopoietic Cells. J. Virol.
76: 1135-1143
[Abstract]
[Full Text]
-
Indraccolo, S., Minuzzo, S., Roccaforte, F., Zamarchi, R., Habeler, W., Stievano, L., Tosello, V., Klein, D., Gunzburg, W. H., Basso, G., Chieco-Bianchi, L., Amadori, A.
(2001). Effects of CD2 locus control region sequences on gene expression by retroviral and lentiviral vectors. Blood
98: 3607-3617
[Abstract]
[Full Text]
-
Wolfgang, M. J., Eisele, S. G., Browne, M. A., Schotzko, M. L., Garthwaite, M. A., Durning, M., Ramezani, A., Hawley, R. G., Thomson, J. A., Golos, T. G.
(2001). Rhesus monkey placental transgene expression after lentiviral gene transfer into preimplantation embryos. Proc. Natl. Acad. Sci. USA
98: 10728-10732
[Abstract]
[Full Text]
-
Schübeler, D., Lorincz, M. C., Cimbora, D. M., Telling, A., Feng, Y.-Q., Bouhassira, E. E., Groudine, M.
(2000). Genomic Targeting of Methylated DNA: Influence of Methylation on Transcription, Replication, Chromatin Structure, and Histone Acetylation. Mol. Cell. Biol.
20: 9103-9112
[Abstract]
[Full Text]
-
Zheng, H., Palese, P., García-Sastre, A.
(2000). Antitumor Properties of Influenza Virus Vectors. Cancer Res.
60: 6972-6976
[Abstract]
[Full Text]
-
Kalberer, C. P., Pawliuk, R., Imren, S., Bachelot, T., Takekoshi, K. J., Fabry, M., Eaves, C. J., London, I. M., Humphries, R. K., Leboulch, P.
(2000). From the Cover: Preselection of retrovirally transduced bone marrow avoids subsequent stem cell gene silencing and age-dependent extinction of expression of human beta -globin in engrafted mice. Proc. Natl. Acad. Sci. USA
97: 5411-5415
[Abstract]
[Full Text]