INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Retroviral gag-encoded proteins are synthesized as precursor polyproteins in the cytoplasm of infected cells from unspliced viral mRNA. The human immunodeficiency virus type 1 (HIV-1) Gag polyprotein (Pr55^gag) accumulates at the plasma membrane, where it directs formation and release of nascent virions. The Gag polyprotein is sufficient for the assembly of noninfectious particles, and, in addition, it recruits viral genomic RNA and other viral and cellular proteins into virions (reviewed in reference 76). Upon activation of the viral protease during virion assembly, the HIV-1 Gag polyprotein is processed into its mature products, which include the matrix (MA; p17), capsid (CA; p24), nucleocapsid (NC; p7), and p6 domains. As part of the Gag polyprotein, each of these domains exhibits important functions during virion assembly, while the mature proteins play key roles during the early phases of the viral life cycle.

During virion assembly, the MA domain targets the Gag polyprotein to the plasma membrane (82, 85), where it regulates incorporation of env-encoded proteins onto HIV-1 virions, presumably via interaction with the cytoplasmic tail of gp41 (17, 30, 31, 51, 57, 66). Mature MA seems to play several roles as well. Deletion mutations at the C terminus of MA (81), as well as specific MA point mutations (47), cause a defect at an early step in reverse transcription, prior to import of the preintegration complex into the nucleus. MA then associates with the HIV-1 preintegration complex (23, 34, 61) and may play a role in translocation of the complex to the nucleus (10, 23, 34, 40, 61), although the latter point has been questioned by studies from other groups (27, 29).

Many groups have shown that the CA domain of the Gag polyprotein plays an essential function during the assembly process (for a review, see reference 18). As a mature protein, CA is the major constituent of the virion core and has been shown to play a key role in early events of the viral life cycle (6, 21, 32, 58, 71).

As part of the Gag polyprotein, the NC domain is responsible for incorporation of genomic RNA into virions (4) and is the main domain involved in homomeric interactions between Gag polyprotein monomers (3, 11, 59, 84). In its processed form, NC has been shown to promote primer-tRNA annealing on genomic RNA (43, 50) and formation of RNA dimers in vitro (20, 25).

The p6 portion of the Gag polyprotein is required at a late step in the virion budding process (38). Interestingly, the p6 domain is only required for virion release when the viral protease is active (42).

Viruses, as intracellular parasites, are necessarily dependent upon host cell factors for replication. Therefore, cellular factors may be required for any of the many HIV-1 gag-encoded functions. Indeed, interaction between gag-encoded proteins and cellular proteins has already been reported. The association of the HIV-1 Gag polyprotein with the plasma membrane requires cotranslational modification by the cellular myristyl-S-transferase (8, 39). Though of unknown significance, ubiquitin is incorporated into virions, where a subfraction is covalently attached to p6 (64). Via contacts with the Gag polyprotein (53), the cellular protein cyclophilin A is incorporated into HIV-1 virions (28, 78), where it is hypothesized to promote virion core disassembly by blocking contacts between CA monomers (35, 52). HOX3, a cellular protein with homology to histidyl aminoacyl-tRNA synthetase, associates with virions via the MA domain of the Gag polyprotein (48). HIV-1 Gag interacts with filamentous actin (69), and actin is found within HIV-1 virions (65). More recently, a member of the tetratricopeptide repeat family has been shown to associate with HIV-1 Gag and Vpu and may be involved in the Vpu-mediated enhancement of Gag particle release from the plasma membrane (12).

The mature products obtained after processing of the HIV-1 Gag polyprotein by the viral protease have also been shown to interact with cellular proteins. MA is phosphorylated on tyrosine and serine/threonine residues (13, 44), and these modifications are believed to be required for the MA-mediated nuclear translocation of the preintegration complex (9, 33). Phosphorylation on serine/threonine residues has been shown to be mediated by virion-associated mitogen-activated protein kinase ERK2 (44).

Identification of new cellular factors that interact with a specific domain of HIV-1 Gag might help elucidate the function of that domain in virus replication. To this end, HIV-1 MA was used as bait in a yeast two-hybrid screen of a mammalian cDNA library. An interaction between MA and the translation elongation factor 1-alpha (EF1) was identified. This elongation factor is an essential component of the cellular translational machinery (60). In its GTP-bound form, EF1 delivers aminoacyl-tRNA to ribosomes. Once associated with the ribosome, EF1 hydrolyzes GTP, is released from the tRNA, and leaves the ribosome. EF1 has also been shown to interact with filamentous actin, and it has been hypothesized that this interaction might provide a link between the translation machinery and the cytoskeleton (reviewed in reference 15).

Our studies demonstrate that HIV-1 Gag associates both in vitro and in vivo with EF1. In addition to the MA domain, the NC domain provides a second, independent binding site for EF1 on the Gag polyprotein. Fine-mapping studies indicate that basic residues in both domains of Gag promote the interaction. EF1 is specifically incorporated into HIV-1 virions, as evidenced by the fact that it is not incorporated into Moloney murine leukemia virus (M-MuLV) virions. We provide evidence that the Gag-EF1 interaction requires tRNA, and EF1 may contribute to tRNA incorporation into HIV-1 virions. Finally, as an indication of a possible functional consequence of the interaction between Gag and EF1, we show that the portion of MA that interacts with EF1 negatively affects translation in vitro.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Cloning by PCR. Many of the expression constructs used here were engineered by using DNA fragments generated by PCR with Pfu DNA polymerase (Stratagene, La Jolla, Calif.). In each case, the identity of the products was confirmed by dideoxy sequencing. The oligonucleotide primers used in the PCRs described below are listed here (5'-to-3' orientation) and are named sequentially by numbers: 1, GCGCGAATTCATGGGTGCGAGAGCGTC; 2, CGCGCTCGAGTTATTGTGACGAGGGGTCGG; 3, GCGCTCTAGAATGGAAGCCGTCATAAAGG; 4, GCGCGAATTCTTAGCAGGATGTGCCAACGGTT; 5, GCGCTCTAGAATGGGGCAAGAATTAAGCCAG; 6, GCGCGAATTCTTACAGAACTGGGAATCTTTTTGG; 7, GCGCTCTAGAATGGGCCAGACTGTTACCAC; 8, GCGCGAATTCTTAATAAAGGGAGATCGAGGCG; 9, GCGCTCTAGAATGGGCGTGAGAAACTCC; 10, GCGCGAATTCTTAGTAATTTCCTCCTCTGCC; 11, CGCGCCATGGGTGCGAGAGCGTCA; 12, CGCGGGATTCATGATACAGAAAGGCAATTTTAGG; 13, GCGCGTCGACTTAATTAGCCTGTCTCTCAGTAG; 14, GCCCCAGGACTCAGAGACTTTATC; 15, ATGGAAGACGCCAAAAACATAAAG; 16, GCGCCCTAGGGTCGACTTACAATTTGGACTTTCCGCC; 17, GCGCCTGCAGTAATACGACTCACTATAGGTCTCTCTGGTTAGACCAG; 18, CTCTCTCCTTCTAGCCTCCG.

Yeast two-hybrid screen. The yeast two-hybrid system and the HeLa cDNA library used in this study have already been described (41). This system identifies putative bait-interacting proteins by using selection for leucine prototrophy and for a screen for -galactosidase (-Gal) activity in Saccharomyces cerevisiae EGY48 (ura3, his3, trp1, LexAop-leu2). The bait consisted of the entire HIV-1 MA fused at its N terminus to LexA. HIV-1 MA coding sequences were amplified by PCR from the proviral clone NL4-3 (1) by using primers 1 and 2. The product of the PCR was digested with restriction enzymes EcoRI and XhoI and inserted into the same sites of plasmid pEG202 (41). A total of 2 million colonies were screened according to published protocols (41).

Proviral DNAs. Proviral DNAs were obtained as follows: M-MulV proviral DNA (clone NCA) was obtained from Stephen Goff (Columbia University, New York, N.Y.); Mason-Pfizer monkey virus (M-PMV) was obtained from Eric Hunter (University of Alabama, Birmingham), and wild-type Rous sarcoma virus (RSV; pATV-8 clone) and RSV mutant HB12 (amino acids 12 to 18 of RSV MA substituted for by amino acids 25 to 31 of HIV-1 MA [67]) were obtained from Leslie Parent (Pennsylvania State University College of Medicine, Hershey).

Construction of glutathione S-transferase (GST) fusion protein expression plasmids. DNA sequences encoding MA proteins of different retroviruses were PCR amplified from the specific proviral clones listed above with the following primers: RSV, 3 and 4; M-PMV, 5 and 6; M-MuLV, 7 and 8; and simian immunodeficiency virus of macaques 239 (SIV_mac239), 9 and 10. The PCR products were cloned as XbaI-EcoRI fragments in the same sites of the vector pGEX2TKPL. pGEXTKPL is a modification of vector pGEXTK (Promega, Madison, Wis.) with an extended polylinker and was obtained from David Shore (Departement de Biologie Moleculaire, Université de Geneve, Geneva, Switzerland). Sequences encoding the different HIV-1 MA mutants were PCR amplified from the specific proviral clones by using primers 11 and 2, cloned in the vector pBSHA (14) as NcoI-XhoI fragments and then subcloned as XbaI-XhoI fragments in the same sites of vector pGEX2TKPL.

Rev-independent Gag mutants. Coding sequences encompassing gag mutations were introduced into pBS-GagX. In this plasmid, the gag sequence (nucleotides 789 to 2292, according to reference 62) is flanked by an NcoI site at the 5' end and by an XhoI site at the 3' end, as described previously (14). The gag sequence in pBS-GagX contains multiple conservative mutations that act at the RNA level to render gag expression Rev independent (70). Mutations in MA (AAA, dB5, or MA) or NC (M1-2/BR) coding sequences were introduced into the gag sequence by replacing an NcoI-NsiI fragment (nucleotides 789 to 1249) or an SphI-XhoI fragment (nucleotides 1443 to 2292) of pBS-GagX with the corresponding fragment obtained after PCR performed on the specific proviral clone with primers 1 and 13. Double mutants in MA (AAA or dB5) and NC (M1-2/BR) were obtained by replacing the NcoI-NsiI fragment containing the specific MA mutation with the corresponding fragment of pBS-GagX M1-2/BR. Mutant GagNC-p6 was obtained by digesting pBS-GagX with MfeI (nucleotide 1968), filling the ends with Klenow DNA polymerase, and circularizing the plasmid with T4 DNA ligase. This creates a nonsense codon after the first N-terminal 15 amino acids of NC (pBS-GagX NC-p6).

Eukaryotic gag expression plasmids. Rev-independent gag coding sequences containing the MA mutation (AAA), NC mutation (M1-2/BR), or a combination of both mutations (AAA M1-2/BR) were released from the specific pBS-GagX plasmids described above by digestion with XbaI and XhoI. The fragments were blunted by treatment with the Klenow fragment of DNA polymerase and ligated into an SR expression plasmid (7), linearized with EcoRI and XhoI, and blunted by treatment with the Klenow fragment. Expression of gag coding sequences is driven by an SR promoter (77).

Construction of EF1 bacterial expression plasmids. All of the EF1-encoding fragments were cloned into the vector pSE420 (Invitrogen) for bacterial expression. To produce an N-terminal hemagglutinin (HA)-tagged version of EF1, a JG4-5 two-hybrid clone containing the full-length EF1 cDNA plus 30 nucleotides of the 5' untranslated region and around 500 nucleotides of the 3' untranslated region (for a total of 2 kb) was digested with EcoRI and XhoI and subcloned into pBS-HA (14) digested with the same enzymes (pBS-HAEF1). The cDNA encoding HA-EF1 was then transferred as an NcoI-XhoI fragment from pBS-HAEF1 into the plasmid pSE420.

Translation reporter constructs. The firefly luciferase cDNA was amplified by PCR from the vector pGL-2 basic (Promega) by using primers 15 and 16 and cloned into the EcoRV site of pBluescript KS (Stratagene). The orientation of the cDNA was such that it could be transcribed from the T7 promoter (pBS-luciferase). A fragment encompassing the HIV-1 leader region (nucleotides 455 to 788) was amplified by PCR from the proviral clone NL4-3 by using primers 18 and 17 (providing a T7 promoter) and cloned into the SmaI site of the plasmid pGL-2 basic. The resulting plasmid allows transcription from the synthetic T7 promoter of an mRNA that contains the HIV-1 leader sequence upstream of the firefly luciferase cDNA (pGL-leader-luciferase).

Production of proteins. Cellular lysate obtained from human 293T fibroblasts was used as a source of EF1. Typically, 10⁷ cells were lysed at 4°C in 1 ml of binding buffer (20 mM HEPES [pH 6.8], 150 mM KOAc, 2 mM MgOAc, 2 mM dithiothreitol, 0.1% Casamino Acids, 1% Tween 20, 1 mM phenylmethylsulfonyl fluoride). The lysate was cleared of insoluble matter by centrifugation at 90,000 rpm in a TL100.1 rotor (Beckman) for 15 min and stored at 80°C with a final glycerol concentration of 20%. Aliquots corresponding to lysate from 5 × 10⁵ cells were used in each binding reaction.

In vitro binding experiments. GST fusion proteins were immobilized onto glutathione-agarose beads (Sigma) in binding buffer (20 µl, 50% slurry) for 30 min and washed three times in binding buffer. Beads were then incubated with crude lysates expressing native or recombinant EF1 for 1 h at 4°C in a final volume of 200 µl and then washed three times in binding buffer. Bound proteins were boiled and subjected to SDS-PAGE and Western blotting.

Antibodies and Western blot analysis. Murine monoclonal anti-EF1 antibody was purchased from Upstate Biotechnology, Inc. (Lake Placid, N.Y.). Murine monoclonal anti-HIV-1 CA and rabbit polyclonal anti-HIV-1 gp120 antibodies were purchased from Intracel (Cambridge, Mass.). Goat polyclonal anti-M-MuLV CA antibody was a gift from Stephen Goff (Columbia University, New York, N.Y.). Murine monoclonal anti-HA antibody was purchased from Berkeley Antibody Company (Berkeley, Calif.). Western blot analysis was performed essentially as described previously (53).

Immunoprecipitation. Human 293T fibroblasts were maintained in complete Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum. Rev-independent Gag polyproteins were expressed by calcium phosphate transfection (19) of 293T cells by using the SR expression plasmids described above. Cells were lysed 72 h posttransfection in binding buffer, and the lysate was cleared by centrifugation at 14,000 rpm in an Eppendorf microcentrifuge for 20 min at 4°C. The lysate was preincubated with 100 µl of protein A-Sepharose beads (Sigma; 10% slurry) for 1 h at 4°C. Supernatant was removed from the beads and incubated with rabbit polyclonal anti-HIV-1 CA antibody (obtained from Louis Henderson, Frederick Cancer Research and Development Center, Frederick, Mass.) for 2 h at 4°C. Protein A-Sepharose beads (100 µl) were then added for 1 h at 4°C. Beads were washed three times in binding buffer, and proteins bound to the beads were analyzed by Western blotting.

Virion purification. 293T cells were transfected by calcium phosphate with Gag expression plasmids or with complete proviral DNAs. Seventy-two hours posttransfection, culture supernatant was syringe filtered (0.45-µm-pore-size filter) and purified through a two-step sucrose gradient. Typically 8 to 10 ml of supernatant was layered on 2 ml each of 45 and 25% sucrose. After centrifugation for 2 h at 80,000 × g, the interface between the 45 and the 25% sucrose was collected, diluted in phosphate-buffered saline (PBS), and laid upon 2 ml of 25% sucrose for an additional 2-h centrifugation step at 80,000 × g. Virions were resuspended in loading buffer and analyzed by SDS-PAGE and Western blotting.

Linear sucrose density gradient analysis of virions. Virions obtained by calcium phosphate transfection of 293T cells with either the HIV-1 proviral clone NL4-3 or the M-MuLV clone NCA were concentrated by centrifugation through 25% sucrose as described above. The pellet was resuspended in 200 µl of DMEM for 4 h on ice and then layered onto a linear sucrose density gradient (20 to 60% [wt/vol]). After 24 h of centrifugation at 80,000 × g, 12 fractions were collected. Each fraction was precipitated with 10% trichloroacetic acid and analyzed by SDS-PAGE and Western blotting.

Subtilisin digestion. Virions, purified and pelleted through a two-step sucrose gradient as described above, were resuspended in 20 mM Tris-Cl (pH 8.0)-2 mM CaCl₂ for 4 h on ice. The solution containing the virions was divided and treated with different concentrations of the protease subtilisin (Boehringer Mannheim) for 18 h at room temperature. Typically, a concentration of 0.1 to 1 mg of protease per ml (stock solution: 100 mg/ml in 20 mM Tris-Cl [pH 8.0] plus 2 mM CaCl₂, freshly made) was sufficient to provide efficient digestion of the envelope protein gp120. The reaction was stopped by addition of 5 µM phenylmethylsulfonyl fluoride, and virion-associated proteins were purified by centrifugation through a 25% sucrose cushion prior to analysis by SDS-PAGE and Western blotting.

Metabolic labeling. HeLa cells maintained in DMEM supplemented with 10% fetal bovine serum were transfected by calcium phosphate with NL4-3 proviral DNAs in 35-mm-diameter plates. Forty-eight hours posttransfection, cells were incubated for 1 h at 37°C with 2 ml of DMEM lacking methionine and cysteine prior to a 45-min pulse with 100 µCi of [³⁵S]Met-Cys, (Translabel; ICN). Cells were washed with PBS and incubated with complete DMEM. Cells were lysed 0, 1, 3, and 6 h later in radioimmunoprecipitation assay (RIPA) buffer (150 mM NaCl, 1% Nonidet P-40, 0.5% deoxycholate, 0.1% SDS, 50 mM Tris-Cl [pH 8.0]), and immunoprecipitation was carried out as described above. Metabolically labeled virions were purified from the supernatant by ultracentrifugation through 25% sucrose as described above, resuspended in RIPA buffer, and immunoprecipitated with AIDS patient sera (obtained through the AIDS Research and Reference Reagent Program, catalog no. 3957).

tRNA dot blot on immunoprecipitated Gag polyproteins. The amount of tRNA₃^Lys or tRNA^Phe in Gag immunoprecipitates was determined by dot blot analysis with end-labeled ³²P primers and under conditions previously described (54). Immunoprecipitations were carried out as described above, except that the protein A-Sepharose beads were divided into two aliquots after the last washing step. One aliquot was analyzed by Western blotting for the normalization of the Gag polyproteins and the presence of EF1, and the other aliquot was analyzed by dot blotting. The aliquots were resuspended in the necessary loading buffer according to their final use. The total tRNA fraction was obtained from 293T cell total RNA by a previously described procedure (54). Total yeast tRNA was purchased from Sigma.

In vitro translation assay. Increasing amounts of purified GST proteins were first incubated with 2 mg of rabbit reticulocyte lysate (RRL; Promega) for 1 h at 4°C. After this incubation, luciferase-encoding mRNA (250 ng) was added to the reaction mixture and translated according to the manufacturer's instructions (Promega). Capped mRNA was made according to the manufacturer (mMESSAGE-mMACHINE; Ambion) by using either pBS-luciferase or pGL-HIV-1 leader-luciferase as a template for T7 in vitro transcription. Uncapped mRNA encoding the firefly luciferase gene was purchased from Promega. Luciferase activity was measured according to standard protocols. The peptide encompassing the HIV-1 MA basic region was purchased from Intracel (catalog no. 279010; amino acid sequence, LRPGGKKKYKLKHIV), and the peptide encompassing the T-antigen NLS was purchased from Sigma (catalog no. C4547; amino acid sequence, CGYGPKKKRKVGG).

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Identification of the interaction between HIV-1 MA and EF1. HIV-1 MA was used as bait in a yeast two-hybrid screen (41) to identify interacting proteins encoded by a cDNA library derived from HeLa cells. The cDNAs were expressed as C-terminal fusions with the B42 acid patch activation domain. MA was expressed as a LexA fusion protein in a yeast strain (EGY48) bearing Leu2 and lacZ genes downstream of multimerized LexA-binding sites. Two million transformants with the cDNA expression library were screened, and 16 clones were identified in which both the ability to grow on leucine-deficient media and high-level -Gal activity were dependent upon MA. cDNA expression plasmids were isolated from the seven clones displaying the strongest -Gal activity. The cDNA inserts from these clones were sequenced, and all were found to encode the full-length EF1 protein. Of the seven EF1 cDNA clones, two were identical. The other clones differed from each other in the amount of 5' untranslated sequence present in the fusion with the B42 activation domain.

EF1 binds in vitro to MA proteins encoded by primate lentiviruses. To confirm and extend our observations on the interaction between EF1 and MA in the two-hybrid system, in vitro binding assays were performed with recombinant proteins expressed in bacteria. In addition, the specificity of the interaction was tested by determining if MA proteins encoded by retroviruses other than HIV-1 also associate with EF1. MA proteins from HIV-1_NL4-3, SIV_mac239, M-PMV, M-MuLV, and RSV were expressed in bacteria as GST fusion proteins. The GST fusion proteins were immobilized on glutathione-agarose beads, washed, and assayed for the ability to bind EF1 obtained from the soluble lysate of 293T cells. The beads were washed again, and any protein still associated with the beads was boiled in SDS and processed by SDS-PAGE. The ability of EF1 to remain associated with each of the fusion proteins was assayed by Western blotting with a mouse monoclonal anti-EF1 antibody (Fig. 1, top panels). EF1 bound to HIV-1_NL4-3 (Fig. 1, lanes 3 and 4) and SIV_mac239 (lane 2) GST-MA fusion proteins. In lane 9, 10% of the 293T cell lysate input into each binding reaction is shown. From the signal intensity, the amount of EF1 that remained associated with HIV-1 GST-MA was estimated to be 4 to 8% of the total input under the binding conditions shown here (compare lanes 4 and 9 in Fig. 1). In contrast, EF1 binding to GST (Fig. 1, lanes 1 and 8) or GST-MA fusion proteins from RSV, M-MuLV or M-PMV (lanes 5, 6 and 7, respectively) was undetectable. The inability to detect interaction between EF1 and the nonlentiviral MA proteins was not explained by a failure to express them as GST fusion proteins, since these proteins were expressed at the same level as HIV-1 and SIV-derived proteins (Fig. 1, bottom panels). These results demonstrate that the interaction between HIV-1 GST-MA and EF1 occurs in vitro and appears to be specific for lentivirus MA.

View larger version (40K): [in this window] [in a new window]   FIG. 1.   EF1 binds in vitro to MA proteins encoded by primate lentiviruses. The MA proteins of the indicated retroviruses were produced as GST fusion proteins, bound to glutathione-agarose beads, and assayed for the ability to interact with EF1 provided by a lysate of 293T cells. After washing, the proteins that remained associated with the beads were analyzed by Western blotting with an anti-EF1 antibody (top panels). The position of EF1 is indicated by the arrow on the right. The amount of GST fusion protein present in each binding reaction mixture was determined by Coomassie staining (lower panels). Lane 9 shows 10% of the total 293T cellular lysate input used in the binding reactions. The positions of migration of molecular mass markers (in kilodaltons) are indicated on the left. The expected position of the M-MuLV GST-MA fusion protein is shown by an asterisk in lane 6.

View larger version (32K): [in this window] [in a new window]   FIG. 2.   Determination of the region of EF1 involved in binding to HIV-1 MA. A schematic diagram of EF1 mutants expressed in bacteria as HA-tagged fusion proteins is presented in panel A. The names of the mutants are shown to the left of the figure; numbers refer to the amino acid residues retained by the deletion mutants. The bacterial expression status and the in vitro binding results obtained for these mutants are reported qualitatively as + or  to the right of the figure. NA, not applicable; WT, wild type. (B) EF1 mutants were assayed for their ability to bind either GST-HIV-1 MA (lanes 3 and 4) or GST (lanes 5 and 6) as described in the legend to Fig. 1. Samples were analyzed by Western blotting with an anti-HA antibody (top panels) or were Coomassie stained after SDS-PAGE (bottom panels). The positions of the wild type (WT) and the EF1 1-74 mutant are indicated by arrows. Lanes 1 and 2 represent 10% of total input of HA-tagged wild type and the EF1 1-74 mutant, respectively.

Determination of the region of EF1 involved in binding to HIV-1 MA. To determine which portion of EF1 is responsible for association with HIV-1 MA, deletion mutants were engineered within the cDNA encoding EF1. Each mutant protein was expressed in bacteria with an HA epitope fused at its N terminus. Lysates from bacteria expressing the HA-tagged EF1 mutants were used in binding reactions with GST-HIV-1 MA. The deletion mutants analyzed are shown in the schematic diagram of Fig. 2A. In addition to the deletion mutants, the H95L mutant was tested; the analogous mutation has been shown to dramatically reduce the GTPase activity of EF-Tu, the EF1 homologue in bacteria (83).

Determination of the region of HIV-1 MA involved in binding to EF1. To define the region of HIV-1 MA responsible for binding to EF1, different portions of MA were produced as GST fusion proteins and assayed for the ability to associate in vitro with EF1. The N-terminal 50 amino acids of MA were found to be sufficient for interaction with EF1 (Fig. 3B, lane 4). This region contains a cluster of basic residues that have been shown to be important for targeting and binding of the Gag polyprotein to the plasma membrane (82, 85). A role in nuclear translocation of the preintegration complex has also been proposed for this basic region (10, 23, 34, 40, 61), although others failed to detect this activity (27, 29).

View larger version (30K): [in this window] [in a new window]   FIG. 3.   Determination of the region of HIV-1 MA involved in binding to EF1. (A) Amino acid sequences of the mutants used here. In the top portion, HIV-1 mutants are compared with the wild-type (WT) HIV-1 MA sequence. In the lower portion, an RSV-HIV-1 chimera is compared to the wild-type RSV MA sequence. HIV-1 dB5 has a deletion from amino acids 21 to 31 that encompasses the MA basic region. HIV-1 mutants of the MA basic region include B5, AAA, and TT, which have five, three, or two basic residues substituted as indicated, respectively. RSV HB12 has four residues substituted that recreate the sequence KKKYKL of HIV-1 MA (amino acids 25 to 30 of HIV-1 [compare with the top sequence]). In the amino acid alignment, black dots indicate that a residue was deleted, and dashes indicate that the residue is identical to that in the wild type. The MA mutants shown in panel A, as well as one additional mutant that includes the first 50 amino acids of MA (HIV-1 1-50), were expressed as GST fusion proteins and assayed for their ability to associate in vitro with EF1 as described in the legend of Fig. 1. Samples were analyzed by Western blotting probed with an anti-EF1 antibody (B and C, top panels) or by Coomassie staining (B and C, bottom panels) after SDS-PAGE. The position of EF1 is indicated by the arrows on the right, and the positions of molecular mass markers (in kilodaltons) are indicated to the left of each panel.

The NC domain provides a second binding site on HIV-1 Gag for EF1. MA is translated as part of the Gag polyprotein. Experiments were therefore performed to determine if EF1 binds the HIV-1 Gag polyprotein. Using the yeast two-hybrid system, it was determined that full-length Gag polyproteins encoded by HIV-1 and SIV_mac239 interact with EF1; no EF1 interaction was detected with the Gag polyproteins of M-MuLV or MPMV (data not shown). These results concur with the previous finding (Fig. 1) that EF1 interacts with MA proteins encoded by lentiviruses but not by other retroviruses.

View larger version (40K): [in this window] [in a new window]   FIG. 4.   NC provides a second binding site for EF1 on the HIV-1 Gag polyprotein. (A) Deletion mutants of the HIV-1 Gag polyprotein were expressed as GST fusion proteins and assayed for their ability to associate with EF1 in vitro as described in the legend to Fig. 1. Samples were analyzed by Western blotting and probed with an anti-EF1 antibody (top panels) or by Coomassie staining (bottom panels). The position of EF1 is indicated by an arrow on the right. Binding of EF1 to GST or wild-type (WT) GST-Gag is shown in lanes 1 and 2, respectively. Binding of EF1 to GST-Gag deletion mutants is as indicated: MA is GST-Gag with the majority of MA deleted (lane 3); NC-p6 is GST-Gag with p6 and most of NC deleted (lane 4); dB5 is GST-Gag with an 11-amino-acid deletion encompassing the MA basic region (lane 5); dB5NC-p6 is GST-Gag with deletion of both the basic region of MA and the NC/p6 regions (lane 6). (B) GST-NC (lane 3) and GST-SP-p6 (lane 4) fusion proteins were used to better define the second EF1-binding site in Gag. Binding to GST and GST-HIV-1 MA is shown in lanes 2 and 1, respectively. (C) Amino acid sequence alignment showing wild-type HIV-1 NC and the NC mutants used in (D and E). Underlined sequences indicate residues involved in the two Cys-His boxes; dashes indicate amino acid residues identical to those of the wild type. Mutants were produced as GST fusion proteins and assayed for the ability to interact with EF1 as described above. (D) Mutants in the zinc fingers of NC. (E) Mutants in the basic amino acid residues of NC.

Basic amino acid residues in NC are necessary for binding to EF1. HIV-1 NC is rich in basic residues and contains two zinc fingers. Both of these features have been demonstrated to be important for packaging the viral RNA genome into virions (22, 68). To determine if either of these features is necessary for NC binding to EF1, a panel of NC mutants (Fig. 4C) was produced as GST fusion proteins and assayed for the ability to bind EF1 in vitro (Fig. 4D). Mutants predicted to significantly disrupt the function of the first zinc finger (F16A, lane 4), the second zinc finger (C36S, lane 2), or both zinc fingers (C15S/C36S, lane 3) were tested for EF1-binding activity. None of these mutants had a significant effect on NC's interaction with EF1, indicating that the zinc fingers are dispensable for this activity.

HIV-1 Gag associates with EF1 in vivo. To confirm that the interaction between Gag and EF1 occurs in vivo, attempts were made to immunoprecipitate a Gag-EF1 complex. To express the HIV-1 Gag polyprotein in the absence of other viral proteins, 293T cells were transfected with a plasmid in which gag coding sequences contain multiple, conservative mutations that act at the RNA level to render gag expression Rev independent (70). Seventy-two hours posttransfection, the cellular lysate was immunoprecipitated with a rabbit polyclonal anti-CA antibody. The proteins in the precipitate were then analyzed by Western blotting for the presence of bound Gag and EF1. As shown in the top panel of Fig. 5A, EF1 coimmunoprecipitated with wild-type Gag polyprotein (lane 3), but not with the double MA and NC mutant AAA M1-2/BR Gag (lane 2) nor with a mock-transfected control (lane 1). The inability to detect EF1 associated with the AAA M1-2/BR Gag mutant was not explained by a failure of the rabbit polyclonal anti-CA antibody to immunoprecipitate the mutant Gag polyprotein (Fig. 5A, second panel from the top, compare lanes 2 and 3). Similar amounts of EF1 and Gag proteins were also present in the cellular lysates prior to the immunoprecipitation (lower panels, as indicated). The anti-EF1 antibody did not function in immunoprecipitation, so it was not possible to perform the reciprocal coimmunoprecipitation experiment. These results nonetheless indicate that the interaction between Gag and EF1 occurs in vivo and that it requires the MA and NC domains as defined in our in vitro binding assays.

View larger version (24K): [in this window] [in a new window]   FIG. 5.   Effect of MA and NC mutations on HIV-1 Gag's ability to associate with EF1 in vivo. (A) Anti-CA antibody was used to immunoprecipitate (IP) wild-type (WT) (lane 3) or AAA M1-2/BR double mutant (lane 2) Gag polyproteins from transfected 293T cell lysates. Immunoprecipitated proteins were analyzed by Western blotting with anti-EF1 and anti-CA antibodies for associated EF1 and for immunoprecipitated Gag (upper panels, as indicated). The same lysates used in the immunoprecipitation were analyzed directly in Western blots with an anti-CA and with an anti-EF1 antibody (lower panels, as indicated). Lane 1 shows results from mock-transfected cells. (B) Gag virions were produced by transfection of 293T cells with plasmids expressing myristylation-deficient (Myc) Gag (lane 1), wild-type Gag (lane 2), MA mutant Gag AAA (lane 3), NC mutant Gag M1-2/BR (lane 4) or MA and NC double mutant Gag AAA M1-2/BR (lane 5). See Fig. 2 and 6 for the amino acid sequences of the AAA and M1-2/BR mutations. Virions were purified by centrifugation onto a sucrose step gradient (25 to 45%). The interface was harvested and then layered onto a 25% sucrose cushion for a final centrifugation step. Samples were analyzed by Western blotting for the presence of EF1 (top panel) and for the presence of Gag (lower panel). The positions of the EF1 and Gag proteins are indicated by arrows to the right of the figure.

EF1 associates with virions produced by a replication-competent HIV-1 provirus. Experiments were performed to determine if EF1 associates with complete infectious HIV-1 virions. Virions produced by transfection of the infectious proviral clone NL4-3 into 293T cells were concentrated by centrifugation through a 25% sucrose cushion, resuspended, and layered onto a linear sucrose density gradient (20 to 60%). Following centrifugation, the gradient was harvested in 12 fractions. The proteins in each fraction were precipitated with trichloroacetic acid and analyzed by Western blotting for the presence of EF1 and CA proteins. EF1 comigrated in the gradient with the CA protein of HIV-1 (compare the top and bottom panels of Fig. 6A). A faster-mobility band reacting with the anti-EF1 antibody was also observed to migrate with the CA protein in the sucrose gradient (Fig. 6A). The identity of this band was further characterized in subsequent experiments.

View larger version (46K): [in this window] [in a new window]   FIG. 6.   EF1 associates specifically with HIV-1 virions. Virions were produced by transfection of 293T cells with HIV-1 (A) or M-MuLV (B) proviral DNAs. Virions were purified and concentrated from the supernatant by being pelleted through 25% sucrose and then were layered onto a linear sucrose gradient (20 by 60%). After centrifugation, fractions were collected from the top of the gradient and numbered from 1 to 12. Samples 3 to 12 are shown as indicated. Samples were analyzed by Western blotting and probed with an anti-EF1 antibody (A and B, top panels), with an anti-HIV-1 CA antibody (A, bottom panel) or with an anti-M-MLV CA antibody (B, bottom panel). The position and identity of the proteins are indicated by arrows on the right. The Western blot of the HIV-1 virion-associated proteins (A, top panel) shows the presence of a truncated form in addition to the full-length EF1.

Virion-associated EF1 is protected from subtilisin digestion and is processed by the viral protease. To determine if EF1 is incorporated within the HIV-1 virion membrane, the resistance of virion-associated EF1 to exogenously added protease was examined. Protease protection assays have been used for many years by cell biologists to determine the orientation of membrane proteins (2) and, more recently, to show that HIV-1-associated proteins are contained within the viral membrane (65).

View larger version (29K): [in this window] [in a new window]   FIG. 7.   EF1 is incorporated within the HIV-1 virion membrane and is processed by the viral protease. (A) HIV-1 virions were purified by centrifugation onto a sucrose step gradient (25 to 45%). The interface was harvested and then layered onto a 25% sucrose cushion for a final centrifugation step. The virions thus obtained were mock treated (lane 1) or treated with 1 or 0.1 mg of subtilisin per ml (lanes 2 and 3, respectively). Samples were analyzed by Western blotting with antibodies against EF1, gp120 (SU), and CA. The position of these proteins is indicated on the right; the positions of molecular mass markers (in kilodaltons) are indicated on the left. Note again that the anti-EF1 antibody detects two bands. (B) HIV-1 virions produced by a provirus with a functional protease (lane 2) or by a provirus bearing the protease-inactivating mutation D25R (lane 1) were purified as described for panel A and analyzed by Western blotting with anti-EF1 (top panels) or anti-CA (bottom panels) antibodies. The positions of migration of full-length and viral protease-processed forms of EF1, as well as the positions of unprocessed Gag polyprotein (p55) and CA protein (p24), are indicated by arrows on the right. The positions of molecular mass markers (in kilodaltons) are indicated on the left.

The interaction between HIV-1 Gag and EF1 is disrupted by RNase. Both EF1 and Gag bind RNA. EF1 binds aminoacyl-tRNA, which it delivers to the ribosome during translation elongation (60). Gag binds and packages HIV-1 genomic mRNA into virions (4). Since basic amino acid residues are found in RNA-binding motifs, and basic amino acid residues in Gag are required for binding to EF1, experiments were performed to determine if RNA is required for the association between these two proteins. Bacterial lysates expressing GST-Gag and EF1 were treated with RNase A before mixing them together in a typical binding reaction. Samples were then analyzed by Western blotting for the presence of EF1 in association with GST-Gag. With increasing concentrations of RNase A, decreasing amounts of EF1 remained associated with GST-Gag (Fig. 8, middle panel, bound EF1; compare lane 2 with lanes 3 to 5). Treatment of the lysates with RNase A didn't affect the stability of EF1 (Fig. 8, top panel, input EF1) nor that of GST-Gag (bottom panel). These results suggest that the in vitro interaction between Gag and EF1 requires RNA.

View larger version (35K): [in this window] [in a new window]   FIG. 8.   The interaction between HIV-1 Gag and EF1 is disrupted by RNase A. Bacterial lysate expressing GST-Gag and 293T lysate used as a source of EF1 were each treated separately with increasing amounts of RNase A (lanes 3 to 5). Samples were then used in a typical binding reaction with glutathione-agarose beads as in Fig. 1. Proteins that remained associated with the beads at the conclusion of the binding experiment were analyzed by Western blotting for the presence of EF1 (bound EF1, middle panel) and by Coomassie blue staining after SDS-PAGE (lower panel). Ten percent of the total EF1 input for each sample was loaded on a Western blot (input EF1, top panel). Lane 1 shows binding to GST (RNase A untreated). Lanes 2 through 5 show binding to GST-Gag treated with 0, 1, 10, and 50 µg of RNase A, respectively.

Effect on virion assembly of a Gag mutant that doesn't bind EF1. To obtain evidence that the interaction between Gag and EF1 is functionally relevant, several experimental approaches were tried. In the first approach, EF1 mutants EF1 1-74 and H95L (Fig. 2A) were expressed in cells along with HIV-1 proviral DNA. Both of these EF1 mutants associate with Gag and therefore might compete with wild-type EF1 for binding to Gag. Since the first mutant is severely truncated and the second disrupts EF1's GTPase activity, either mutant might inhibit an EF1-dependent Gag function in trans. No effect on virion yield or on virion assembly kinetics (pulse-chase experiments) was observed with either mutant (data not shown). In addition, no effect was seen on virion infectivity, as assessed by semiquantitative PCR of reverse transcription products within 8 h postinfection or by MAGI (multinuclear activation of a galactosidase indicator) assay (data not shown). The mutant proteins were expressed with two different high-level promoters (SR and EF1), but the interpretation of these experiments must be tempered by the fact that EF1 is one of the most abundant proteins in the cell (72), and it may not be possible to express the mutant proteins at levels sufficient for inhibition in trans.

View larger version (65K): [in this window] [in a new window]   FIG. 9.   A Gag mutant that disrupts interaction with EF1 impairs virion assembly and Gag's ability to bind tRNA. HeLa cells transfected with wild-type (WT) (A) and AAA M1-2/BR (B) NL4-3 were labeled with [35S]Met-Cys for 45 min and chased for 0, 1, 3, or 6 h, as indicated. MW, molecular mass markers. Virion-associated proteins were purified by ultracentrifugation through 25% sucrose. Virion and cell-associated viral proteins were immunoprecipitated with an HIV-1 antiserum and analyzed by SDS-PAGE. (C) Controls for quantitative dot blot assays specific for either human tRNAPhe or human tRNA3Lys. Increasing amounts of purified total human and yeast tRNAs (as indicated on the left of the panels) were immobilized on a nylon membrane and probed with a tRNAPhe probe (upper panel) or with a tRNA3Lys probe (lower panel). The amount of total tRNA loaded onto each spot is indicated on the top of the figure. (D) Wild-type and AAA M1-2/BR Gag polyproteins were expressed by transfection of 293T cells (lanes 1 and 2) and immunoprecipitated with an anti-CA antibody. A fraction of the samples were analyzed by Western blotting and probed with anti-CA or anti-EF1 antibodies (lower two panels, as indicated). A second aliquot of the samples was analyzed by dot blotting and probed with either tRNAPhe or tRNA3Lys-specific probes (upper two panels, as indicated). Lane 3, mock-transfected cells.

A Gag mutant that doesn't interact with EF1 is impaired in its ability to bind tRNA. Virions with the AAA M1-2/BR mutation are impaired in assembly (Fig. 9B). Therefore, effects that this mutation might have on other steps of the HIV-1 life cycle could not be studied. To better characterize the interaction between Gag and EF1, experiments were performed to determine if there is a correlation between Gag's ability to bind EF1 and its ability to bind RNA. These experiments were suggested by the fact that RNase A disrupts the interaction between Gag and EF1 in vitro (Fig. 8) and that EF1 is a major tRNA binding protein (60). NC has also been shown to bind tRNA (4, 46).

HIV-1 MA inhibits in vitro translation. EF1 is an essential translation factor (60). Since Gag binds EF1, the effect of Gag on translation efficiency in an RRL system was examined. For technical reasons related to protein purification and quantification, recombinant MA was used in these experiments rather than the complete Gag polyprotein. GST-MA was purified from bacterial lysate by affinity chromatography. As a control, GST was prepared in the same way, as well as GST-MA dB5, which contains a deletion encompassing the basic region of MA (Fig. 3A). The purity of the three proteins was assayed by SDS-PAGE with Coomassie staining (Fig. 10A), and concentrations were determined by Bradford assay. Increasing amounts of each purified GST fusion protein were added to a constant amount of RRL. Firefly luciferase encoded by an in vitro-synthesized, capped mRNA was used as a translation reporter. After incubation of the RRL with the GST fusion proteins at 4°C, reporter mRNA and amino acids were added, and translation was allowed to proceed by shifting the temperature to 30°C. In pilot experiments, the amount of luciferase activity recovered in the lysate correlated perfectly with the amount of luciferase protein produced in the RRL, as determined by metabolic labeling (data not shown). Therefore, in all subsequent experiments, the luciferase activity produced in the samples was used as a measure of translation efficiency.