Previous Article | Next Article 
Journal of Virology, June 1999, p. 5162-5165, Vol. 73, No. 6
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
A Single Amino Acid Substitution in the
Phosphoprotein of Respiratory Syncytial Virus Confers Thermosensitivity
in a Reconstituted RNA Polymerase System
Anthony C.
Marriott,*
Steven D.
Wilson,
Jaspal S.
Randhawa, and
Andrew J.
Easton
Department of Biological Sciences, University
of Warwick, Coventry CV4 7AL, United Kingdom
Received 28 December 1998/Accepted 23 February 1999
 |
ABSTRACT |
The single amino acid change Gly172 to Ser in the phosphoprotein
(P) of respiratory syncytial virus (RSV) has previously been shown to
be responsible for the thermosensitivity and protein-negative phenotype
of tsN19, a mutant of the B subgroup RSN-2 strain. This single change was inserted into the P gene of the A subgroup virus RSS-2, and the resulting phenotype was observed in a plasmid-driven reconstituted RSV RNA polymerase system. Expression from a genome analogue containing two reporter genes was thermosensitive when directed by plasmids containing the N, L, M2, and mutant P genes cloned
under the control of T7 promoters. Analysis of RNA synthesis showed
that mutant P protein was unable to produce genome, antigenome, or mRNA
at the restrictive temperature. At a semipermissive temperature, genome, antigenome, and mRNA synthesis were all reduced, 6- to 30-fold,
relative to synthesis directed by a wild-type P plasmid. Binding of the
mutant P protein to N protein in the absence of other viral proteins
was unaffected by temperature, indicating that the lesion did not
produce a large enough structural change to disrupt this binding. These
data suggest that the plasmid rescue system is suitable for
investigation of the role of thermosensitive mutations in RSV
polymerase components in RNA synthesis.
| |
TEXT |
The minimal RNA polymerase
requirements of respiratory syncytial virus (RSV) have been defined
from in vivo polymerase reconstitution experiments (i.e., a
plasmid-driven rescue system) to be the ribonucleoprotein (RNA
complexed with nucleoprotein [N]), the phosphoprotein (P), and the
large protein (L) (11, 25). In combination with a genomic
RNA analogue (minigenome) containing the terminal leader and trailer
sequences, as well as gene start and gene end signals, these three
proteins direct both replication and transcription of the synthetic
minigenome. However, transcription is greatly enhanced by the presence
of a further viral protein, M2 (also known as the 22K protein
[2, 12]). The M2 gene (with two open reading frames
[ORFs], M2-1 and M2-2) is unique to the genus Pneumovirus,
but the functions of the N, P, and L proteins are believed to be
equivalent to those of the other members of the Paramyxoviridae and of the members of the
Rhabdoviridae. The L protein contains the sequence motifs
for RNA-dependent RNA polymerase activity and is presumed to be
responsible for capping and polyadenylation of mRNAs (22). P
protein interacts with soluble N protein principally via the
carboxyl-terminal 20 residues of P (9, 21) and is a
component of purified nucleocapsids along with N and L proteins. An
essential role for the P protein in RNA synthesis was suggested by the
properties of the thermosensitive (ts) mutant
tsN19. This mutant was isolated from the B subgroup strain
RSN-2 following chemical mutagenesis (6) and was assigned to
complementation group E (10). tsN19 is highly
ts at 39°C (efficiency of plating, 7 × 10
8) and less so at 37°C (efficiency of plating, 2 × 106); it was observed to be protein negative (defined
as having undetectable levels of antigen and intracellular viral
polypeptides [1, 18]) at 39°C (18). P
protein made by this mutant at the permissive temperature was not
degraded at the restrictive temperature, suggesting that the
ts defect did not involve thermolability of the P protein. Sequence analysis of the P genes of RSN-2, tsN19, and a
revertant virus, ts+R3/6, identified the amino
acid change Gly172 to Ser (G172S) as correlating with the ts
phenotype, and the authors suggested that the mutation led to a defect
in mRNA synthesis (1). It was noted that Gly at position 172 of the P protein is conserved in both A and B subgroups of human RSV
and in bovine RSV (14).
In this report we describe the introduction of the G172S mutation into
a subgroup A RSV background and show that the ts phenotype is expressed in a plasmid-driven minigenome RNA
transcription-replication assay and hence that the single point
mutation in the P protein alone is sufficient to abolish RNA synthesis.
Temperature dependence of the minigenome replication assay.
The assay used for transcription and replication was similar to that
used previously for RSV and other members of the
Paramyxoviridae (11; reviewed in
reference 15). Recombinant vaccinia virus vTF7-3
(8) was used to supply T7 RNA polymerase (T7 pol) in the
cytoplasm of transfected cells to transcribe both the minigenome analogue and the four protein components of the RSV replication complex. The N, P, L, and M2 ORFs of RSV strain RSS-2 (23)
were cloned under the control of T7 promoters in vectors pTM1
(16) (T7-N, T7-L, and T7-M2) or pBluescribe (Stratagene)
(T7-P). The dicistronic minigenome analogue, pCAT-Luc, contained, in
the following order, the hepatitis delta virus ribozyme
(17); the 3'-most 98 nucleotides (nt) of the RSS-2 genome,
comprising the leader and NS1 gene start and 5' untranslated region;
the chloramphenicol acetyltransferase (CAT) ORF; the NS1 gene end, 6-nt
intergenic region, and N gene start; the luciferase (Luc) ORF from
vector pGL3-control (Promega); the 5'-most 166 nt of the RSS-2 genome, comprising the L gene end and trailer; and the T7 pol promoter. Transcription by T7 pol resulted in a 2,654-nt transcript of genomic (
) polarity, after autocleavage by the ribozyme to generate the correct 3' end. Mixtures of plasmids were transfected into subconfluent monolayers of HEp-2 cells previously infected with vTF7-3 at
a multiplicity of infection of 1 PFU per cell by using
Lipofectace (Gibco-BRL Life Technologies). Typically, 0.2 µg of
pCAT-Luc, 0.4 µg of T7-N, 0.8 µg of T7-P, 0.1 µg of T7-L,
and 50 ng of T7-M2 were mixed with 4 µl of Lipofectace and used
to transfect 5 × 105 vaccinia virus-infected cells.
These amounts of plasmids had previously been determined to be the
optimum amounts as judged by maximal reporter protein production. After
incubation at the appropriate temperature, the cells were harvested for
lysis and reporter assay. CAT gene expression was determined as total
protein by an antigen capture enzyme-linked immunosorbent assay
(Boehringer-Mannheim) with purified CAT protein as the standard. Luc
was determined with luciferase assay reagent (Promega) in a Labsystems
Luminoskan luminometer and was expressed as relative light units (RLU).
In both cases, the values were expressed as yield per 5 × 105 cells.
The optimal temperature for vTF7-3 is 37°C; however, we wished to
test the expression of reporter gene activity at the permissive and
restrictive temperatures of tsN19 virus, namely, 33 and
39°C. Time courses of pCAT-Luc rescue at 33, 37, and 39°C showed
that the optimum yields of CAT and Luc were obtained after 72 to 96, 48 to 72, and 48 h, respectively (data not shown). At the relatively low multiplicity of infection used, the cells were still alive, although exhibiting cytopathic effect, after 96 h at 33°C. For subsequent experiments, cells were harvested after 48 h (37 and 39°C) or 72 h (33°C). Levels of CAT and Luc expression were
typically 100- to 200-fold above background. For wild-type
(wt) P plasmid, the yields of CAT and Luc were essentially
the same when rescue was performed at 33°C (72-h harvest) or 37°C
(48-h harvest). At 39°C, CAT protein expression was reduced to 14%
and Luc expression was reduced to 17% of the values at 33°C (these
are not significantly different [P = 0.82]). Since
wt RSV replicates well at 39°C (efficiency of plating at
39°C/37°C = 1.0 [6]), this suggests that the supply of T7 pol is reduced at the higher temperature. To avoid this
complication, we compared ts P to wt P separately
at each temperature.
Thermosensitivity of mutant P in reporter gene rescue.
The
G172S mutation was introduced into the wt T7-P plasmid by
PCR with the mutagenic primer RSS2PGS (5'
GATGCCATGGTTAGTTTAAGAGAAGAAATGAT 3') and
the reverse sequencing primer (5' TTGTGAGCGGATAACAATTTC 3').
The NcoI site in RSS2PGS is underlined, and the
mutagenic nucleotide is shown in bold type. After PCR with
Taq DNA polymerase, the product was used to replace the
equivalent HindIII-NcoI fragment of T7-P to
produce T7-tsN19P. Expression of CAT and Luc gene activities by the T7-tsN19P plasmid was compared to those by T7-P,
along with pCAT-Luc, T7-N, T7-L, and T7-M2 plasmids, at 33, 37, and 39°C (Fig. 1). At 33°C,
T7-tsN19P is clearly functional, rescuing 57 to 68% of
reporter gene activity compared to the levels seen with the
wt protein expressed from T7-P. This reduction from the wt level may be due to insertion of the mutation into a
heterologous background or to slight temperature sensitivity, since the
permissive temperature was originally defined as 31°C (6).
It is also possible that the mutation has a slight effect on the
function of P protein even at the fully permissive temperature.
View larger version (31K):
[in this window]
[in a new window]
|
FIG. 1.
Reporter gene rescue by T7-tsN19P at
permissive and restrictive temperatures. The values for
T7-tsN19P were normalized to those for T7-P at each
temperature, as were the values obtained when P plasmid was omitted.
Error bars show the standard deviation of four replicate experiments.
|
|
At 37°C, the activity of T7-
tsN19P is clearly reduced
relative to that at 33°C; the CAT and Luc activities are 3 and 11%
of
the
wt values, respectively. The more marked inhibition
of CAT
than of Luc was significant (
P = 0.01), but the
reason for this
is not
clear.
At 39°C, the ability of T7-
tsN19P to direct the expression
of the reporter genes was reduced even further, to 0.4 to 1% of
the
wt values. Compared to the controls with no P plasmid,
T7-
tsN19P
was not significantly different, implying that no
residual activity
was detectable in our system at the restrictive
temperature of
the original mutant
virus.
We did not attempt to test different concentrations of
T7-
tsN19P plasmid, since it has been established that
nonoptimal amounts
of the helper plasmids in minigenome rescues
decrease the reporter
activity (references
7 and
11 and unpublished data), thus
making quantitative
data
uninterpretable.
Thermosensitivity of the mutant P gene in RNA synthesis.
RNA
was extracted from transfected cells and analyzed by Northern blotting
to determine if replication of the minigenome, as well as
transcription, was affected. Total RNA was extracted with Trizol
reagent (Gibco-BRL Life Technologies) and separated into
poly(A)+ and poly(A) fractions on
oligo(dT)-cellulose (Pharmacia type 7). RNAs were Northern blotted and
probed with digoxigenin-labelled riboprobes as described previously
(4). Transcription was analyzed by probing the
poly(A)+ mRNAs with a negative-sense riboprobe (Fig.
2). At 33°C, no difference was seen
between the wt and ts P plasmids, whereas
omitting P produced only a background smear of RNA. The major bands
seen are CAT mRNA (0.7 kb) and Luc mRNA (1.7 kb). The uppermost
poly(A)+ mRNA band (2.5 kb) is presumably the CAT-Luc
readthrough mRNA, since antigenome will not be selected by
oligo(dT)-cellulose. At 37°C, transcription by T7-tsN19P
was greatly reduced, with only very weak CAT and Luc mRNA bands being
visible (lane 3). At 39°C, no mRNAs were visible from
T7-tsN19P, just a smear resembling the sample with no P
plasmid. These data agree well with the results of the reporter protein
assays, demonstrating that reporter translation accurately reflects
transcription levels.
View larger version (53K):
[in this window]
[in a new window]
|
FIG. 2.
Northern blot of mRNA selected by oligo(dT)-cellulose.
The probe was a digoxigenin-labelled riboprobe corresponding to the
minus strand of the pCAT-Luc minigenome. Lanes: 1, no P plasmid; 2, T7-P; 3, T7-tsN19P.
|
|
Replication was analyzed by digesting cell lysates with micrococcal
nuclease S7 to remove unencapsidated RNAs (
7) before
extraction with Trizol reagent, leaving only replicative RNAs
protected
by N protein intact. Use of a positive-sense riboprobe
to detect
minigenome (Fig.
3A) or a negative-sense
riboprobe to
detect antiminigenome (Fig.
3B) produced very similar
results;
T7-
tsN19P (lanes 3) was roughly equal in activity
to T7-P (lanes
2) at 33°C, greatly reduced at 37°C (band
intensities, 17 to 18%
of
wt levels), and indistinguishable
from background at 39°C.
The faint minigenome band seen in the
no-T7-L tracks at 33 and
37°C (Fig.
3A, lanes 4) probably represent
negative-sense primary
transcripts from the pCAT-Luc plasmid which have
been encapsidated
by N (and P) but are not being replicated; the
equivalent positive-sense
band is not visible in Fig.
3B. These data
suggest that mutant
P is equally defective in the synthesis of plus-
and minus-strand
RNAs.
View larger version (47K):
[in this window]
[in a new window]
|
FIG. 3.
Northern blots of RNA which was protected from nuclease
S7 digestion. The probes were the digoxigenin-labelled riboprobe
corresponding to the minus strand of the pCAT-Luc minigenome (B) and
the digoxigenin-labelled riboprobe corresponding to the plus strand of
the CAT gene (A). Lanes: 1, no P plasmid; 2, T7-P; 3, T7-tsN19P, 4, T7-P but no T7-L. The 39°C tracks in panel B
were exposed for 25 times as long as the other tracks, to show the
fainter bands.
|
|
Thermosensitivity of mutant P protein in the N-binding assay.
Binding of P protein to the N protein of RSS-2 was assayed by using the
Clontech Matchmaker mammalian two-hybrid system at 33 and 39°C, that
is, the permissive and restrictive temperatures of the tsN19
mutation. The N gene was inserted into the binding-domain vector, pM,
and the P gene was inserted into the activation domain vector, pVP16.
This results in the production of N protein as a fusion at the C
terminus of the yeast GAL4 binding domain and of P protein as a fusion
at the C terminus of VP16 of herpes simplex virus type 1. The G172S
mutation was introduced into pVP16-P on a
NcoI-HindIII fragment from
T7-tsN19P. The N and P plasmids were transfected into COS-7
cells along with the pG5CAT reporter plasmid as described by Slack and
Easton (21). Plasmid pG5CAT contains CAT as the reporter
gene, under the control of five tandem consensus GAL4 binding sites and
the minimal promoter of the adenovirus E1b gene. Interaction of the N
and P fusion proteins, concurrent with binding of the GAL4-N fusion
protein to the GAL4 binding sites, brings the VP16 activating domain
into proximity with the RNA polymerase II and results in transcription
of the CAT gene. Cells were harvested for CAT enzyme-linked
immunosorbent assay after 48 h (39°C) or 72 h (33°C) of incubation.
At each temperature, the level of CAT expression obtained with the
tsN19 mutation in the P-activation domain vector was
compared
to the activity obtained with the
wt P-activation
domain vector
(Fig.
4). At 33°C the
relative activity (
ts P/
wt P) was 0.99 ±
0.07, and at 39°C the relative activity was 1.01 ± 0.09. These
figures are not significantly different (
P = 0.76), and
since
expression of CAT activity reflects the level of interaction of
the N and P proteins, this demonstrates that the mutant P protein
shows
no thermosensitivity in its interaction with N protein.
These data
suggest that the
ts P protein must be stable at 39°C
to
preserve the interaction with the N protein. This was confirmed
directly by expressing the protein with vTF7-3 in the absence
of other
RSV proteins (Fig.
5). At 39°C, just as
much protein
is produced from T7-
tsN19P as from wild-type
T7-P.
View larger version (40K):
[in this window]
[in a new window]
|
FIG. 4.
Reporter gene activity produced by two-hybrid
interactions. Values are expressed as picograms per 2 × 105 cells. Error bars show the standard deviation of four
or five replicate experiments. "no P" refers to empty pVP16 vector
in place of the pVP16-P fusion.
|
|
View larger version (69K):
[in this window]
[in a new window]
|
FIG. 5.
Immunoblot analysis of wt and ts P
proteins at the restrictive temperature. Following separation by sodium
dodecyl sulfate-polyacrylamide gel electrophoresis and blotting onto a
nitrocellulose membrane, cell lysates were probed with a bovine
polyclonal anti-RSV serum. Lanes 1 to 3 contain extracts of cells
infected with vTF7-3 and transfected with T7-P (lane 1),
T7-tsN19P (lane 2), no DNA (lane 3). Lane 4 contains RSS-2
virus-infected cell extract.
|
|
We have shown that the vaccinia virus-T7-based reconstituted RNA
polymerase system can be used to identify functional conditional
mutations in the RSV replication complex. The RSS-2-based minigenome
rescue system showed all types of RSV RNA polymerase activity
at
temperatures between 33 and 39°C, namely, replication, transcription,
polycistronic mRNA synthesis, and polyadenylation. Capping was
also
assumed to be occurring, since the CAT and Luc transcripts
were readily
translated.
A single point mutation at Gly172 has previously been implicated in the
temperature sensitivity of the conditional lethal
mutant
tsN19: the
tsN19 mutation was indicated to lie in
the P
protein, since the mutation caused the loss of reactivity of
tsN19
virus with the P protein-specific monoclonal antibody
3-5 whereas
revertant
ts+R3/6 regained the
ability to bind monoclonal antibody 3-5 (
1).
The evidence
that this mutation was solely responsible for the
phenotype, although
compelling, was of necessity indirect. By
inserting the mutation into a
P gene used in a reverse genetics
system, we have demonstrated directly
that the G172S mutation
alone confers thermosensitivity on the function
of the expressed
P protein in RNA synthesis. This occurs even though
the mutation
is inserted into a subgroup A genetic background instead
of the
subgroup B in which it was first identified. Furthermore, the
increased sensitivity at 39 over 37°C observed for the original
tsN19 virus was also reproduced in this
system.
It has been suggested that this mutation may render the mutant P
protein unable to interact functionally with one or more
of the
components of the ribonucleoprotein complex at the restrictive
temperature (
1). The region of the P protein around residue
172 is not required for binding to N protein; indeed, a mutant
P
protein in which residues 168 to 198 were deleted was still
able to
interact with N as strongly as the
wt was (
21).
The
two-hybrid data presented here show that binding of the mutant
P
protein to N protein is not thermosensitive, so that if the
restrictive
temperature induces an inactivating conformational
change in the P
protein, this change does not extend to the major
N binding regions.
However, other putative functions of the P
protein such as
oligomerization, binding to L protein, or direct
interaction with the
N-RNA template, have not been investigated,
and the responsible domains
of the P protein remain to be
mapped.
Large panels of conditional lethal mutants have been isolated for a
number of negative-strand viruses, in particular the paramyxoviruses
RSV, Newcastle disease virus, Sendai virus, and measles virus
(
20); the rhabdoviruses vesicular stomatitis virus and
Chandipura
virus (
19); and 11 members of the
Bunyaviridae (
5). Although
many of the lesions
remain unmapped, several complementation groups
have been more or less
tentatively assigned to polymerase component
genes. In RSV, several
ts lesions have been mapped to the L protein
by genomic
sequencing and reverse genetic methods (
3,
13,
23,
24). For
many of the above viruses, minigenome-RNA polymerase
reconstitution
systems analogous to the one described here are
available or under
development. These systems could be used to
correlate complementation
groups with specific genes involved
in RNA synthesis and to identify
residues critical for the function
of the RNA polymerase
complex.
| |
ACKNOWLEDGMENTS |
This work was supported by project grant G9708765PB from the
Medical Research Council and by a project grant from the Wellcome Trust.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biological Sciences, University of Warwick, Coventry CV4 7AL, United Kingdom. Phone: 44 (0)1203 522696. Fax: 44 (0)1203 523701. E-mail: qm{at}dna.bio.warwick.ac.uk.
Present address: Department of Infection, University of Birmingham
Medical School, Edgbaston, Birmingham B15 2TJ, United Kingdom.
| |
REFERENCES |
| 1.
|
Caravokyri, C.,
A. J. Zajac, and C. R. Pringle.
1992.
Assignment of mutant tsN19 (complementation group E) of respiratory syncytial virus to the P protein gene.
J. Gen. Virol.
73:865-873[Abstract/Free Full Text].
|
| 2.
|
Collins, P. L.,
M. G. Hill,
J. Cristina, and H. Grosfeld.
1996.
Transcription elongation factor of respiratory syncytial virus, a nonsegmented negative-strand RNA virus.
Proc. Natl. Acad. Sci. USA
93:81-85[Abstract/Free Full Text].
|
| 3.
|
Crowe, J. E.,
C.-Y. Firestone,
S. S. Whitehead,
P. L. Collins, and B. R. Murphy.
1996.
Acquisition of the ts phenotype by a chemically mutagenized cold-passaged human respiratory syncytial virus vaccine candidate results from the acquisition of a single mutation in the polymerase (L) gene.
Virus Genes
13:269-273[Medline].
|
| 4.
| Easton, A. J., A. C. Marriott, and C. R. Pringle. Investigation of RNA virus genome structure.
In A. J. Cann (ed.), RNA viruses: a practical approach.
in press. Oxford University Press, Oxford, United Kingdom.
|
| 5.
|
Elliott, R. M.
1990.
Molecular biology of the Bunyaviridae.
J. Gen. Virol.
71:501-522[Abstract/Free Full Text].
|
| 6.
|
Faulkner, G. P.,
P. V. Shirodaria,
E. A. C. Follett, and C. R. Pringle.
1976.
Respiratory syncytial virus ts mutants and nuclear immunofluorescence.
J. Virol.
20:487-500[Abstract/Free Full Text].
|
| 7.
|
Fearns, R.,
M. E. Peeples, and P. L. Collins.
1997.
Increased expression of the N protein of respiratory syncytial virus stimulates minigenome replication but does not alter the balance between the synthesis of mRNA and antigenome.
Virology
236:188-201[Medline].
|
| 8.
|
Fuerst, T. R.,
E. G. Niles,
W. Studier, and B. Moss.
1986.
Eukaryotic transient-expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase.
Proc. Natl. Acad. Sci. USA
83:8122-8126[Abstract/Free Full Text].
|
| 9.
|
Garcia-Barreno, B.,
T. Delgado, and J. A. Melero.
1996.
Identification of protein regions involved in interaction of human respiratory syncytial virus phosphoprotein and nucleoprotein: significance for nucleocapsid assembly and formation of cytoplasmic inclusions.
J. Virol.
70:801-808[Abstract].
|
| 10.
|
Gimenez, H. B., and C. R. Pringle.
1978.
Seven complementation groups of respiratory syncytial virus temperature-sensitive mutants.
J. Virol.
27:459-464[Abstract/Free Full Text].
|
| 11.
|
Grosfeld, H.,
M. G. Hill, and P. L. Collins.
1995.
RNA replication by respiratory syncytial virus (RSV) is directed by the N, P and L proteins: transcription also occurs under these conditions but requires RSV superinfection for efficient synthesis of full-length mRNA.
J. Virol.
69:5677-5686[Abstract].
|
| 12.
|
Hardy, R. W., and G. W. Wertz.
1998.
The product of the respiratory syncytial virus M2 gene ORF1 enhances readthrough of intergenic junctions during viral transcription.
J. Virol.
72:520-526[Abstract/Free Full Text].
|
| 13.
|
Juhasz, K.,
S. S. Whitehead,
P. T. Bui,
J. M. Biggs,
C. A. Boulanger,
P. L. Collins, and B. R. Murphy.
1997.
The temperature-sensitive (ts) phenotype of a cold-passaged (cp) live attenuated respiratory syncytial virus vaccine candidate, designated cpts530, results from a single amino acid substitution in the L protein.
J. Virol.
71:5814-5819[Abstract].
|
| 14.
|
Mallipeddi, S. K., and S. K. Samal.
1992.
Sequence comparison between the phosphoprotein mRNAs of human and bovine respiratory syncytial viruses identifies a divergent domain in the predicted protein.
J. Gen. Virol.
73:2441-2444[Abstract/Free Full Text].
|
| 15.
| Marriott, A. C., and A. J. Easton.
Reverse genetics of the Paramyxoviridae. Adv. Virus Res., in
press.
|
| 16.
|
Moss, B.,
O. Elroy-Stein,
T. Mizukami,
W. A. Alexander, and T. R. Fuerst.
1990.
New mammalian expression vectors.
Nature
348:91-92[Medline].
|
| 17.
|
Pattnaik, A. K.,
L. A. Ball,
A. W. Legrone, and G. W. Wertz.
1992.
Infectious defective interfering particles of VSV from transcripts of a cDNA clone.
Cell
69:1011-1020[Medline].
|
| 18.
|
Pringle, C. R.,
P. V. Shirodaria,
H. B. Gimenez, and S. Levine.
1981.
Antigen and polypeptide synthesis by temperature-sensitive mutants of respiratory syncytial virus.
J. Gen. Virol.
54:173-183[Abstract/Free Full Text].
|
| 19.
|
Pringle, C. R.
1987.
Rhabdovirus genetics, p. 167-243.
In
R. R. Wagner (ed.), The rhabdoviruses. Plenum Press, New York, N.Y.
|
| 20.
|
Pringle, C. R.
1991.
The genetics of paramyxoviruses, p. 1-39.
In
D. W. Kingsbury (ed.), The paramyxoviruses. Plenum Press, New York, N.Y.
|
| 21.
|
Slack, M. S., and A. J. Easton.
1998.
Characterisation of the interaction of the human respiratory syncytial virus phosphoprotein and nucleocapsid protein using the two-hybrid system.
Virus Res.
55:167-176[Medline].
|
| 22.
|
Stec, D. S.,
M. G. Hill, and P. L. Collins.
1991.
Sequence analysis of the polymerase L gene of human respiratory syncytial virus and predicted phylogeny of nonsegmented negative-strand viruses.
Virology
183:273-287[Medline].
|
| 23.
|
Tolley, K. P.,
A. C. Marriott,
A. Simpson,
D. J. Plows,
D. A. Matthews,
S. J. Longhurst,
J. E. Evans,
J. L. Johnson,
P. A. Cane,
V. B. Randolph,
A. J. Easton, and C. R. Pringle.
1996.
Identification of mutations contributing to the reduced virulence of a modified strain of respiratory syncytial virus.
Vaccine
14:1637-1646[Medline].
|
| 24.
|
Whitehead, S. S.,
C.-Y. Firestone,
P. L. Collins, and B. R. Murphy.
1998.
A single nucleotide substitution in the transcription start signal of the M2 gene of respiratory syncytial virus vaccine candidate cpts248/404 is the major determinant of the temperature-sensitive and attenuation phenotypes.
Virology
247:232-239[Medline].
|
| 25.
|
Yu, Q.,
R. W. Hardy, and G. W. Wertz.
1995.
Functional cDNA clones of the human respiratory syncytial (RS) virus N, P, and L proteins support replication of RS virus genomic RNA analogs and define minimal trans-acting requirements for RNA replication.
J. Virol.
69:2412-2419[Abstract].
|
Journal of Virology, June 1999, p. 5162-5165, Vol. 73, No. 6
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Edworthy, N. L., Easton, A. J.
(2005). Mutational analysis of the avian pneumovirus conserved transcriptional gene start sequence identifying critical residues. J. Gen. Virol.
86: 3343-3347
[Abstract]
[Full Text]
-
Stokes, H. L., Easton, A. J., Marriott, A. C.
(2003). Chimeric pneumovirus nucleocapsid (N) proteins allow identification of amino acids essential for the function of the respiratory syncytial virus N protein. J. Gen. Virol.
84: 2679-2683
[Abstract]
[Full Text]
-
Lu, B., Brazas, R., Ma, C.-H., Kristoff, T., Cheng, X., Jin, H.
(2002). Identification of Temperature-Sensitive Mutations in the Phosphoprotein of Respiratory Syncytial Virus That Are Likely Involved in Its Interaction with the Nucleoprotein. J. Virol.
76: 2871-2880
[Abstract]
[Full Text]
-
Marriott, A. C., Smith, J. M., Easton, A. J.
(2001). Fidelity of Leader and Trailer Sequence Usage by the Respiratory Syncytial Virus and Avian Pneumovirus Replication Complexes. J. Virol.
75: 6265-6272
[Abstract]
[Full Text]
Top
Abstract
Text
