Previous Article | Next Article ![]()
Journal of Virology, June 1999, p. 5132-5136, Vol. 73, No. 6
The Marjorie B. Kovler Viral Oncology
Laboratories, The University of Chicago, Chicago, Illinois 60637
Received 19 November 1998/Accepted 18 February 1999
Herpes simplex virus 1 infected cell protein 22 (ICP22) localizes
in small, dense nuclear bodies of primate cells early in infection and
in the more diffuse replicative complexes after the onset of DNA
synthesis. UL4, a Of the 84 herpes simplex virus
1 (HSV-1) open reading frames (ORFs), more than half can be
deleted without significantly impairing the ability of the virus to
replicate in cells grown in culture (20). The
UL4 ORF, one of the dispensable ORFs, has no apparent function in infected cells in culture or in experimental animal systems
(3, 4, 13). In other studies, Singh and Wagner (22) reported that UL4 is encoded by a
0.8-kb mRNA, and Yamada et al. (25) reported, while this
work was in progress, that the product of the HSV-2 UL4
gene is a very late ( We report that the UL4 protein colocalizes with the pre-DNA
synthesis isoforms of infected cell protein 22 (ICP22), a
420-amino-acid protein encoded by the To carry out these studies, we made polyclonal rabbit antibody to
the UL4 protein and constructed a virus (R4660)
containing a UL4 gene carrying in frame a small
sequence encoding an epitope of the glycoprotein B of the human
cytomegalovirus (CMV) (16). The monoclonal antibody to this
protein, CH28-2, was purchased from the Goodwin Cancer
Research Institute (Plantation, Fla.).
The glutathione S-transferase (GST)-UL4
chimeric protein used for rabbit immunization was made as
follows. Plasmid pRB5249 was constructed by the in-frame insertion of
an EcoRI-digested PCR product containing the
entire UL4 ORF cloned into the EcoRI site of the
vector pGEX4T-1 (Pharmacia Biotech). The GST-UL4 protein encoded by pRB5249 was expressed in BL21 cells, purified according to
the manufacturer's directions, and used for the immunization of two
rabbits according to standard protocols (Josman Laboratories, Napa,
Calif.). Serum from rabbit A was used in the experiments described
in this report.
The recombinant virus R4660 was constructed as follows. Plasmid pRB4660
contained a CMV tag in the correct orientation and in frame with the
UL4 ORF. It was constructed in three steps. First, the
oligonucleotide
5'-AAGGGACAGAAG CCCAACCTGCTAGACCGACTGCGACACCGCAAAAA CGGGTACCGACAC-3',
annealed with its complement (not shown), was inserted at the
SmaI site of a plasmid containing the
BamHI-to-MluI fragment of the UL4
gene in pGEM3Zf+ (Fig. 1, line 3). Next,
a DraIII fragment, containing the
DraIII-to-EcoRI sequences encoding the N terminus
of UL4 plus an EcoRI-to-DraIII
fragment from the pGEM3Zf+ vector, was inserted into the
DraIII site of the first construct to complete the
UL4 gene. Last, a 332-bp
XhoI-to-BamHI fragment encoding the C terminus of
UL3 was inserted between the SalI and
BamHI sites of the polylinker in the construct from the second step. Recombinant virus R4660 was selected and plaque purified from the progeny of cotransfection of R7205 viral DNA (3)
and plasmid pRB4660 as described elsewhere (18).
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Colocalization of the Herpes Simplex Virus 1 UL4
Protein with Infected Cell Protein 22 in Small, Dense Nuclear
Structures Formed prior to Onset of DNA Synthesis
![]()
ABSTRACT
Top
Abstract
Text
References
2 protein, localizes in
cytoplasm and in the small nuclear structures containing ICP22 but not
in replicative complexes. In rabbit skin cells, both ICP22 and
UL4 localize in the dense nuclear bodies late in infection.
The results suggest that the small nuclear structures perform a
function involving both proteins late in infection.
![]()
TEXT
Top
Abstract
Text
References
2) protein that accumulates
in the cytoplasms of transfected cells but accumulates in
punctate nuclear structures late in infection. Homologs of the
UL4 gene have also been reported to occur in the genomes of a number of members of the Alphaherpesvirinae subfamily of
herpesviruses (7, 8, 10, 17, 23, 24).
22 gene (11, 12).
The domain of the
22 gene also encodes a protein designated
US1.5 whose sequence is identical to the 249 carboxyl-terminal amino acids of ICP22 (6). The promoter of
US1.5 is located in the 5' coding sequence of the
22
gene. ICP22 is dispensable for growth in continuous human primate cell
lines (18). The deletion mutant is apathogenic when
inoculated intracerebrally into mice and replicates poorly in
restricted (e.g., rodent or rabbit) cells or in primary human fibroblasts (21). ICP22 localizes in small, dense
nuclear structures early in infection. After the onset of viral DNA
synthesis, ICP22 localizes in replicative complexes with nascent
DNA and RNA polymerase II, ICP4 (the major viral regulatory protein),
and other proteins. The transition from the small, dense nuclear
structures to the replicative complexes requires the phosphorylation of
ICP22 by the viral protein kinase encoded by the UL13 gene
(15).

View larger version (16K):
[in a new window]
FIG. 1.
Schematic diagram of the sequence arrangement of the
HSV-1(F) genome and the sequence arrangement of the region containing
the UL4 gene in the plasmids used for the construction of
viruses used in this study. Line 1, linear representation of the HSV-1
genome. The thin line represents the unique long (UL) and
unique short (US) sequences of the long and short
components of the HSV-1 genome, respectively. The open rectangles
represent the inverted repeats flanking the unique sequences. Line 2, sequence arrangement of the coding domain for the UL4
protein in HSV-1(F). The arrows labeled UL4 and
UL3 represent the coding domains of the genes. Line 3, sequence arrangement of plasmid pRB4660 containing the entire
UL4 sequence and the sequence corresponding to the
carboxyl-terminal portion of UL3. A 60-bp oligonucleotide
(black square) encoding the CMV epitope was inserted into the
SmaI site (in the sequence corresponding to the carboxyl
terminus) of the UL4 ORF to generate plasmid pRB4660. The
oval indicates the location of the CMV tag within the coding domain.
Line 4, sequence arrangement of plasmid pRB4037 used in the
construction of recombinant virus R7217 as reported elsewhere
(3). The dashed line indicates the DNA sequence that had
been deleted in R7217. The region between the HpaI site and
the XhoI site in lines 2 and 4 is foreshortened in the
interest of space. B, BamHI; D, DraIII; E,
EcoRI; H, HindIII; HP, HpaI; M,
MluI; S, SmaI; SA, SalI; X,
XhoI.
Two series of experiments were done to verify that the rabbit
polyclonal antibody generated against the GST-UL4 fusion
protein detected the UL4 protein. In the first, an
immunoblot of electrophoretically separated lysates of mock
infected or infected HEp-2 cells was reacted with the
UL4 antiserum. The UL4 antiserum reacted with a
protein with an apparent Mr of 26,500 that was
present in lysates of cells infected with HSV-1(F) (9),
HSV-1(F)
305 (18), or R7205 (Fig.
2A, lanes 3, 7, and 8) but not with the
lysates of cells either mock infected or infected with the R7217
(
UL4 [3]) recombinant virus (Fig. 2A,
lanes 2 and 6). As expected inasmuch as the UL4 gene
carries an in-frame insert of 20 codons, the anti-UL4 antibody reacted with a more slowly migrating protein band in lysates
of cells infected with R4660 (Fig. 2A, lane 5). The results unambiguously verified that the antibody reacted with the
UL4 protein. The UL4 gene was assigned to the
2 kinetic class, based on the absence of the protein
from the lysates of HSV-1(F)-infected cells maintained in the presence
of the viral DNA synthesis inhibitor phosphonoacetic acid at 300 µg/ml (Fig. 2A, lane 3 versus lane 4).
|
The second set of experiments was designed to verify the evidence from the immunofluorescence studies (presented below) that UL4 protein was distributed in both the nuclei and the cytoplasms of infected cells. HEp-2 cells were mock infected or infected with HSV-1(F), harvested 16 h after infection, and either solubilized intact or fractionated into nuclear and cytoplasmic fractions as described elsewhere (14). The lysates were then subjected to electrophoresis on denaturing polyacrylamide gels and reacted with the UL4 antiserum and with the monoclonal antibody to ICP4 (H640), which was described elsewhere (1) and was purchased from Goodwin Cancer Research Institute. As expected, ICP4 fractionated with the nuclear extract (Fig. 2B), whereas UL4 protein was detected in both the nuclear and cytoplasmic fractions.
In the first series of immunofluorescence studies (data not shown), we noted that the pattern of UL4 fluorescence was very similar to that of ICP22 (15). To test the hypothesis that ICP22 and UL4 protein colocalize, rabbit skin cells were infected and processed for immunofluorescence analysis as described elsewhere (15) with the monoclonal antibody to the CMV tag (CH28-2) and either the rabbit polyclonal antibody to UL4 or R77 to ICP22 (2). The results were as follows.
(i) Neither the anti-UL4 nor the anti-CMV antibody reacted with cells infected with R7217 (Fig. 3A to C).
|
(ii) In cells infected with R4660, the antigens reacting with the UL4 and the CMV antibodies colocalized in the small, dense nuclear bodies (Fig. 3D to F). The UL4 antibody gave a slightly more diffuse pattern of fluorescence than the anti-CMV antibody. This and the results of experiments whose data are not shown indicated that the two antibodies reacted in immunofluorescence assays with identical CMV-tagged proteins and that the native and tagged UL4 proteins localized in identical structures.
(iii) In cultures infected with R4660, the antigens reacting with the monoclonal antibody to the tag in the UL4 protein and to the polyclonal antibody to ICP22 colocalized in the same small, dense nuclear structures (Fig. 3G to I).
(iv) The pattern of accumulation of ICP22 in rabbit skin cells infected
with HSV-1(F) (Fig. 3K) could not be differentiated from that observed
in cells infected with R4460 (Fig. 3H) or in cells infected with the
deletion mutant R7217 (
UL4) (Fig. 3N).
(v) Late in infection of human or nonhuman primate cells, ICP22 localizes in replicating structures along with nascent DNA, RNA polymerase II, and other cellular and viral proteins (15). The transition from small, dense nuclear structures to the diffuse intranuclear replication complexes requires the activity of the UL13 protein kinase. Although the rabbit skin cells were examined 17 h after infection, the distribution of ICP22 in these cells resembled that of cells fixed early in infection rather than that of human cells observed late in infection (15).
These experiments suggested the possibility that the accumulation of ICP22 in rabbit skin cells may differ from that in HEp-2 cells. To resolve the question of whether UL4 and ICP22 also colocalize in HEp-2 cells fixed late in infection, HEp-2 cells were fixed 17 h after infection with HSV-1(F), R4660, or R7217 and reacted with both the polyclonal antibody to ICP22 and the monoclonal antibody to the CMV tag. The results (Fig. 4) were as follows.
|
The antibody to ICP22 reacted with antigens localized in two kinds of structures: small, dense nuclear bodies and more diffuse nuclear materials that in some cells were dispersed and in other cells (e.g., the lower right cell in Fig. 4A) filled a large portion of the nucleus. The monoclonal antibody against the CMV-tagged UL4 protein reacted only with small, dense nuclear structures in cells infected with the R4660 mutant (Fig. 4E). The small, dense nuclear structures illuminated by the ICP22 antibody colocalized with the structures containing the UL4 protein.
We conclude from these studies the following. UL4 protein accumulates in the cytoplasm and in small, dense nuclear bodies. In rabbit skin cells, UL4 protein and ICP22 colocalize and are present predominantly in these structures, apparently throughout the accumulation of UL4. In infected HEp-2 cells, ICP22 and UL4 protein also colocalize in small, dense nuclear bodies. However, as previously reported, by the time UL4 accumulates in sufficient amounts to be detected late in infection, ICP22 is also present in replicative complexes containing nascent DNA, RNA polymerase, and other viral and cellular proteins (15).
The significant points of the findings described in this report are as follows.
(i) The shift from small, dense nuclear structures to replicative
complexes after the onset of DNA synthesis in primate cells has led to
the suggestion that ICP22 performs different functions before and after
the onset of viral DNA synthesis. Entry into replicative complexes
requires phosphorylation by the UL13 viral protein kinase
and the association with nascent DNA and ICP4 (the major regulatory
protein), RNA polymerase II, and other partially defined viral and
cellular proteins. In this report, we show that UL4, a
2 protein, is associated with the small, dense nuclear bodies formed prior to the onset of DNA synthesis but not with the
replicative complexes formed after the onset of DNA synthesis. These
results suggest that the function of UL4 is associated with that of ICP22 in the context of small, dense nuclear structures and
that these structures persist and function after infection inasmuch as
they recruit additional viral proteins made late in infection. This
observation raises the intriguing possibility that the functions of
ICP22 and of UL4 partially overlap, explaining the absence
of a phenotype for the UL4 gene.
(ii) Rabbit skin cells are highly permissive for wild-type
HSV-1 but are restrictive for mutants lacking the
22 gene. In the
restrictive cell lines, the function of ICP22 after the onset of
viral DNA synthesis concerns the expression of a subset of late
(
2) genes and the stability and expression of the
0
gene (5, 6, 19). A striking observation to emerge in
the studies reported here is that in rabbit skin cells, ICP22 localized
only in the small, dense nuclear structures even late in infection and
that the UL4 protein colocalized with all of the structures containing ICP22. The significance of this observation is unclear. Hypotheses that remain to be explored further are that in restricted cell lines the compartmentalization of viral functions performed in the
nucleus is different from those taking place in permissive cells and
that the factors determining the localization of ICP22 play an
important role in defining the permissivity of cells.
| |
ACKNOWLEDGMENTS |
|---|
S.J. and N.S.M. contributed equally to this work.
These studies were aided by grants from the National Cancer Institute (CA47451 and CA71933), the U.S. Public Health Service, a Young Investigator Award to N.S.M. from the National Alliance for Research on Schizophrenia and Depression, and a Howard Hughes Medical Institute Summer Research Fellowship for Undergraduates to S.J.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: The Marjorie B. Kovler Viral Oncology Laboratories, The University of Chicago, 910 E. 58th St., Chicago, IL 60637. Phone: (773) 702-1898. Fax: (773) 702-1631. E-mail: bernard{at}cummings.uchicago.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Ackermann, M.,
D. K. Braun,
L. Pereira, and B. Roizman.
1984.
Characterization of herpes simplex virus 1 proteins 0, 4, and 27 with monoclonal antibodies.
J. Virol.
52:108-118 |
| 2. |
Ackermann, M.,
M. Sarmiento, and B. Roizman.
1985.
Application of antibody to synthetic peptides for characterization of the intact and truncated 22 protein specified by herpes simplex virus 1 and the R325 22 deletion mutant.
J. Virol.
56:207-215 |
| 3. |
Baines, J. D., and B. Roizman.
1991.
The open reading frames UL3, UL4, UL10, and UL16 are dispensable for the replication of herpes simplex virus 1 in cell culture.
J. Virol.
65:938-944 |
| 4. | Baines, J. D., and B. Roizman. Unpublished data. |
| 5. |
Carter, K. L., and B. Roizman.
1996.
Alternatively spliced mRNAs predicted to yield frame-shift proteins and stable intron 1 RNAs of the herpes simplex virus 1 regulatory gene 0 accumulate in the cytoplasm of infected cells.
Proc. Natl. Acad. Sci. USA
93:12535-12540 |
| 6. |
Carter, K. L., and B. Roizman.
1996.
The promoter and transcriptional unit of a novel herpes simplex virus 1 gene are contained in, and encode a protein in frame with, the open reading frame of the 22 gene.
J. Virol.
70:172-178[Abstract].
|
| 7. |
Davidson, A. J., and J. E. Scott.
1986.
The complete DNA sequence of varicella-zoster virus.
J. Gen. Virol.
67:1759-1816 |
| 8. | Dean, H. J., and A. K. Cheung. 1994. Identification of the pseudorabies virus UL4 and UL5 (helicase) genes. Virology 202:962-967[Medline]. |
| 9. |
Ejercito, P. M.,
E. D. Kieff, and B. Roizman.
1968.
Characteristics of herpes simplex virus strains differing in their effect on social behavior of infected cells.
J. Gen. Virol.
2:357-364 |
| 10. |
Fuchs, W., and T. C. Mettenleiter.
1996.
DNA sequence and transcriptional analysis of the UL1 to UL5 gene cluster of infectious laryngotracheitis virus.
J. Gen. Virol.
77:2221-2229 |
| 11. |
Honess, R. W., and B. Roizman.
1974.
Regulation of herpesvirus macromolecular synthesis. I. Cascade regulation of the synthesis of three groups of viral proteins.
J. Virol.
14:8-19 |
| 12. |
Honess, R. W., and B. Roizman.
1975.
Regulation of herpesvirus macromolecular synthesis: sequential transition of polypeptide synthesis requires functional viral polypeptides.
Proc. Natl. Acad. Sci. USA
72:1276-1280 |
| 13. | Jun, P. Y., L. I. Strelow, R. C. Herman, H. S. Marsden, T. Eide, L. Haarr, and D. A. Leib. 1998. The UL4 gene of herpes simplex virus type 1 is dispensable for latency, reactivation and pathogenesis in mice. J. Gen. Virol. 79:1603-1611[Abstract]. |
| 14. |
Kawaguchi, Y.,
R. Bruni, and B. Roizman.
1997.
Interaction of herpes simplex virus 1 regulatory protein ICP0 with elongation factor 1 : ICP0 affects translational machinery.
J. Virol.
71:1019-1024[Abstract].
|
| 15. | Leopardi, R., P. L. Ward, W. O. Ogle, and B. Roizman. 1997. Association of herpes simplex virus regulatory protein ICP22 with transcriptional complexes containing EAP, ICP4, RNA polymerase II, and viral DNA requires posttranslational modification by the UL13 protein kinase. J. Virol. 71:1133-1139[Abstract]. |
| 16. |
Liu, F., and B. Roizman.
1991.
The promoter, transcriptional unit, and coding sequence of herpes simplex virus 1 family 35 proteins are contained within and in frame with the UL26 open reading frame.
J. Virol.
65:206-212 |
| 17. |
McGeoch, D. J.,
C. Cunningham,
G. McIntyre, and A. Dolan.
1991.
Comparative sequence analysis of the long repeat regions and adjoining parts of the long unique regions in the genomes of herpes simplex viruses types 1 and 2.
J. Gen. Virol.
72:3057-3075 |
| 18. |
Post, L. E., and B. Roizman.
1981.
A generalized technique for deletion of specific genes in large genomes: gene 22 of herpes simplex virus 1 is not essential for growth.
Cell
25:227-232[Medline].
|
| 19. |
Purves, F. C.,
W. O. Ogle, and B. Roizman.
1993.
Processing of the herpes simplex virus regulatory protein 22 mediated by the UL13 protein kinase determines the accumulation of a subset of and mRNAs and proteins in infected cells.
Proc. Natl. Acad. Sci. USA
90:6701-6705 |
| 20. |
Roizman, B.
1996.
The function of herpes simplex virus genes: a primer for genetic engineering of novel vectors.
Proc. Natl. Acad. Sci. USA
93:11307-11312 |
| 21. |
Sears, A. E.,
I. W. Halliburton,
B. Meignier,
S. Silver, and B. Roizman.
1985.
Herpes simplex virus 1 mutant deleted in the 22 gene: growth and gene expression in permissive and restrictive cells and establishment of latency in mice.
J. Virol.
55:338-346 |
| 22. | Singh, J., and E. K. Wagner. 1993. Transcriptional analysis of the herpes simplex virus type 1 region containing the TRL/UL junction. Virology 196:220-231[Medline]. |
| 23. | Telford, E. A., M. S. Watson, K. McBride, and A. Davidson. 1992. The DNA sequence of equine herpesvirus-1. Virology 189:304-316[Medline]. |
| 24. | Vlcek, C., V. Benes, Z. Lu, G. F. Kutish, V. Paces, D. Rock, G. J. Letchworth, and M. Schwyzer. 1995. Nucleotide sequence analysis of a 30-kb region of the bovine herpesvirus 1 genome which exhibits a colinear gene arrangement with the UL21 to UL4 genes of herpes simplex virus. Virology 210:100-108[Medline]. |
| 25. | Yamada, H., Y.-M. Jiang, S. Oshima, K. Wada, F. Goshima, T. Daikoku, and Y. Nishiyama. 1998. Characterization of the UL4 gene product of herpes simplex virus type 2. Arch. Virol. 143:1199-1207[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»