Previous Article | Next Article 
Journal of Virology, June 1999, p. 5098-5109, Vol. 73, No. 6
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Inhibition of Tumor Necrosis Factor Alpha by an
Adenovirus-Encoded Soluble Fusion Protein Extends Transgene
Expression in the Liver and Lung
YuFeng
Peng,1
Jose
Trevejo,2
JunLiang
Zhou,1
Michael W.
Marino,3
Ronald G.
Crystal,4
Erik
Falck-Pedersen,2 and
Keith B.
Elkon1,*
Hospital for Special Surgery, Cornell
University Medical Center,1 W. R Hearst
Research Foundation Department of
Microbiology,2 Department of Medicine,
Division of Pulmonary and Critical Care, Weill Medical College of
Cornell University/New York Presbyterian
Hospital,4 and Ludwig Institute for
Cancer Research, Memorial Sloan-Kettering Cancer
Center,3 New York, New York 10021
Received 6 November 1998/Accepted 9 March 1999
 |
ABSTRACT |
The cellular and humoral immune responses to adenovirus (Ad) remain
a major barrier to Ad-mediated gene therapy. We recently reported that
mice deficient in tumor necrosis factor alpha (TNF-
) or Fas (APO-1,
CD95) have prolonged expression of an Ad transgene expressing a foreign
protein in the liver. To determine whether blockade of TNF-
or Fas
would have the same effect in normal mice, we created transgenes that
expressed soluble murine CD8 or CD8 fused to the extracellular regions
of TNF receptor 1 (TNFR) or Fas and inserted into the left-end region
of first-generation (E1/E3
) Ad vectors. Consistent with the results
observed in TNF-deficient mice, expression of the TNFR-CD8 fusion
protein was prolonged in vivo compared to that of control proteins. Not
only did expression of TNFR-CD8 persist in the liver and the lung, but
when coadministered with another first-generation vector, the protein
provided "transprotection" for the companion vector and transgene.
In addition, TNFR-CD8 attenuated the humoral immune response to the Ad.
Together, these findings demonstrate that blockade of TNF-
is likely
to be useful in extending the expression of an Ad-encoded transgene in
a gene therapy application.
 |
INTRODUCTION |
In view of their high level of
transgene expression and ability to infect nondividing cells,
first-generation adenovirus (Ad)-based vectors remain an important tool
for gene therapy. The utility of these vectors is, however, limited by
the immune response to Ad or its transgene. The cellular arm of the
immune response eliminates transgene expression 2 to 3 weeks
postinfection, and the humoral component prevents reinfection (reviewed
in references 35 and 38).
Despite the fact that >90% of Ad is taken up by macrophages following
intravenous (i.v.) administration (37), little attention has
been paid to the earliest events whereby virus infection activates the
innate immune response. Tumor necrosis factor alpha (TNF-
) is a
major proinflammatory cytokine that is secreted by infected macrophages
and is known to be released following wild-type Ad infection
(15), as well as following infection with first-generation Ad vectors (21). Wild-type Ad synthesizes at least four
proteins encoded in the E3 gene to counteract TNF-
action
(36). In addition, since the E3 region has been removed from
almost all Ad vectors to accommodate transgenes, Horwitz and colleagues
(17) reinserted the E3 region into gene therapy vectors and
demonstrated markedly prolonged persistence of expression. We have
recently shown that TNF-
-deficient mice have a marked impairment in
the ability to clear Ad compared to that of wild-type mice
(10). Taken together, these findings suggest that TNF-
plays a critical role in the elimination of wild-type and Ad gene
therapy vectors.
Although granzyme/perforin-mediated cytotoxicity is generally regarded
as the most common effector pathway through which viruses are
eliminated, perforin-deficient mice are able to mount efficient immune
responses against viruses such as vesicular stomatitis virus, influenza
virus, Semliki Forest virus, and rotavirus (13, 18). We
recently observed that perforin-deficient mice were also able to
efficiently clear Ad expressing the chloramphenicol acetyltransferase
(CAT) transgene (AdCAT) (10). In contrast, Fas-deficient
(lpr) mice had a modest prolongation in the expression of
AdCAT compared to wild-type mice, suggesting that Fas-mediated apoptosis played a role in immune elimination of the virus. This suggestion is supported by recent studies demonstrating Fas receptor degradation as an antihost strategy employed by wild-type Ad (29, 31).
Both Fas (8)- and TNF-
(22, 27)-deficient mice
develop immunological abnormalities caused by the deficiency of the gene product from birth. To determine whether blockade of TNF-
or
Fas in an immunologically intact mouse would affect the duration of
expression of Ad vectors, we constructed soluble inhibitors of TNF-
and Fas. As observed with TNF-
-deficient mice, the TNF-
inhibitor
prolonged transgene expression whereas the Fas inhibitor was much less effective.
 |
MATERIALS AND METHODS |
Mice.
C57BL/6 (B6) (H-2b), BALB/c/J
(H-2d), C3H (H-2k), and
C57/BL-Faslpr mice were purchased from Jackson
Laboratory, Bar Harbor, Maine. SCID mice were bred and maintained at
HSS in a pathogen-free environment. TNF-
-deficient mice
(22) were kindly provided by M. W. Marino.
RT-PCR.
Total RNA was extracted from lung tissue by RNAzol
(TelTest) in accordance with the manufacturer's protocol. cDNAs were
synthesized with the Superscript Kit (Gibco). PCR amplification (30 cycles) was performed with primers specific for CD8 (5') paired with
either the TNF receptor (TNFR) or Fas (3') using the primers described below. Reverse transcription (RT)-PCR for
-actin was used as a
housekeeping gene control. For PCR amplification of CAT cDNA, the
following primers (5'
3') and conditions were used:
CACTGGATATACCACCGT and CGCCCCGCCCTGCCACTC; 95°C
for 30 s, 55°C for 30 s, and 72°C for 50 s for 40 cycles. The common primers CCCAGGTCCAACTGCAGCCC and
GGTACTTGTGAGCCAAGGCAG were used for PCR of the Ad vector
spanning the different transgenes.
Generation of replication-defective Ad expressing soluble murine
proteins.
The extracellular domains of murine TNFR1, Fas, and
CD8-
chain were amplified from cDNA by using the following primers
(in the 5'
3' orientation): Fas, ACACTCTGCGATGAAGAGCA;
TNFR1, CCTGTAAGGAGACTCAGAAC; CD8,
CGCTAAGCTTCCACCATGGCCTCACCGTTGACCCGC
and GCTGCTCGAGCTATTAATCACAGGCGAAGTCCAATCC. Chimeric TNFR-CD8
and Fas-CD8 fusion proteins were created by overlapping PCR, taking
care to avoid the introduction of foreign amino acids, by using the
following primers: FasCD8, CGGAGTTCGGGTGCCTGTGGCTTAGCT CATTTCTGGGACTTTGTTTCCTGCAGTTTGT and
ACAAACTGCAGGAAA CAAAGTCCCAGAAATGAAGCAAGCCACAGGCACCCGAACTCCG; TNFRCD8,
CGGAGTTCGGGTGCCTGTGGCTTAGCTTCCGCAGTACCTGAGTCCTGGGGGTTTGTG and
CACAAACCCCCAGGACTCAGGTACTGGGGAAGCTAAGCCACAGGCACCCGAACTCCG. All fragments were ligated between the
HindIII and XhoI sites of pAd. The viruses
expressing TNFR-CD8 and Fas-CD8 were produced as previously described
(10). Briefly, the pAd vector containing a transgene was
cotransfected with PJM17 into 293 cells. The cell lysate was used to
infect 293 cells. Viral DNA was extracted by a modified Hirt assay, and
recombination was verified by restriction enzyme digestion and PCR, and
the protein product was verified by enzyme-linked immunosorbent assay
(ELISA). The viruses were further plaque purified. Each clone was
rescreened as described above. Finally, large-scale virus was purified
by two-step CsCl concentration and stored in glycerol at
20°C
or in sucrose at
70°C. Viral particles were quantitated by
measurement of optical density (OD) at 260 nm.
ELISA.
The antibodies used for ELISA and their sources were
as follows: anti-CD8-
chain, TIB 105 hybridoma (American Type
Culture Collection); mouse YST 169 (Caltag); anti-Fas; Jo-2
(Pharmingen); R-anti-Fas, a rabbit polyclonal antibody (9);
and anti-mTNFR1 clone55R-593 (Genzyme). ELISA plates were coated with
antibody (5 µg/ml) and then incubated overnight at 4°C. The plates
were blocked with phosphate-buffered saline (PBS)-3% bovine serum
albumin (BSA) for 1 h at room temperature and then incubated with
the test sample for 4 to 5 h at room temperature. The plates were washed and sequentially incubated with biotinylated secondary antibody,
avidin-alkaline phosphatase, and substrate. The OD was read at 405 nm.
Unless indicated otherwise, cell culture supernatants and BALs
(broncheoalveolar lavage fluids) were tested without further dilution
whereas serum was diluted 1/2.
To obtain a standard for ELISA, Fas-CD8 was isolated from culture
supernatants by step elution on a DEAE ion-exchange column. The protein
was isolated to ~70% purity as determined by silver staining
and Western blot analysis.
Western blotting and gel filtration.
Sodium dodecyl sulfate
(SDS)-polyacrylamide gel electrophoresis was performed on a 12% gel
under reducing conditions. Western blotting was performed as previously
described (5) by using rabbit anti-Fas or goat anti-TNFR
antibodies (Santa Cruz). To evaluate the molecular masses of the fusion
proteins under nondenaturing conditions, gel filtration on a Sephadex
G-100 column (Pharmacia) equilibrated in PBS was performed following
calibration with immunoglobulin G (IgG), BSA, and ovalbumin.
Concentrated supernatant from virus-infected 293 cells was loaded onto
the column, and 1-ml fractions were collected. Fas-CD8 or TNFR-CD8 was
detected by ELISA as described above. The same supernatants were run on
the same column under dissociating conditions (0.2% SDS).
T-cell cytotoxicity and proliferation assays.
To determine
whether the Fas-CD8 fusion protein could inhibit apoptosis by authentic
FasL, Fas-CD8 or CD8 supernatants were incubated with soluble
functional human FasL (25) at 4°C for 6 h. The
supernatants were then incubated with FasL-sensitive cell line A20
(24), and apoptosis was quantified by the alamar blue assay
of viability as previously described (24) 12 to 16 h
later. To evaluate TNFR-CD8 function, recombinant TNF-
(Genzyme) was
incubated with serial dilutions of TNFR-CD8 supernatants or anti-mTNF-
clone MP6-XT22 (Pharmingen) at 4°C for 6 h.
Cytotoxicity was then evaluated at 16 h by the alamar blue assay
using the L929 cell line in the presence of cycloheximide (10 µg/ml).
Fas-CD8 supernatant and Rat IgG were included as controls.
Allogeneic cytotoxic T-lymphocyte reactions were generated by injection
of C3H B6/F1 spleen cells into C3H mice. Spleen cells were harvested at
7 days and tested for cytotoxicity against 51Cr-labeled EL4
cell (H-2b) targets. Percent lysis was
calculated according to the formula [(cpm sample
cpm
spontaneous)/(cpm maximum
cpm spontaneous)] × 100%.
To quantify T-cell sensitization to Ad, splenocytes were harvested at
day 10 after i.v. infection. Cultures (2.5 × 10
5
cells/well) were incubated with various concentrations of virus
in
96-well plates. At day 5, cells were pulsed with
[
3H]thymidine (1 µCi/well) and proliferation was
quantified on a
scintillation
counter.
Jo-2- and LPS-induced hepatic damage.
To induce hepatic
apoptosis through the Fas receptor (23), SCID mice were
injected with 6 µg of Jo-2 antibody i.v. The mice were observed for
24 h, and any live mice were sacrificed. To induce
TNF-
-mediated septic shock, C3HeSnJ mice were sensitized and then
injected with lipopolysaccharide (LPS) as previously described
(22). In brief, six C3H/HeSnJ mice per group were injected
with 2 × 1010 particles of AdTNFR-CD8 or the AdCAT
control. Five days later, they were sensitized with 25 mg of
D-galactosamine, followed by 0.3 µg of LPS given
intraperitoneally. The mice were observed for 3 days, after which
surviving mice were sacrificed. At the time of death, the livers were
harvested and fixed in formalin. Formalin-fixed tissue was embedded in
paraffin, and sections were stained with hematoxylin and eosin for
examination by light microscopy.
Anti-Ad antibody response.
Quantitation of anti-Ad IgG was
performed as described previously (9). Briefly, plates were
coated with purified Ad (108 particles/well) at 4°C
overnight. Following blocking with 3% BSA, serum samples were diluted
from 1/10 to 1/2,000 and incubated with antigen. The plates were
sequentially blocked with 3% BSA, incubated with serum (diluted
1/2,000 for i.v. infected mice and 1/200 for intratracheally [i.t.]
infected mice) and alkaline phosphatase-conjugated anti-mouse IgG.
Neutralizing antibody titers were evaluated as previously reported
(7). Briefly, twofold serial dilutions of sera were
preincubated with Ad expressing LacZ (500 particles/cell) for 1 h
at 37°C and added to A549 cells in 96-well plates (20,000 cells/well). Expression of LacZ was measured by
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal)
staining 16 h after infection.
Statistical analysis.
Test samples were analyzed for normal
distribution and then compared by either Student's t test
(normal distribution) or the Mann-Whitney rank sum test (nonparametric
data). Multiple comparisons were performed by analysis of variance with
the Student-Newman-Keuls method for pairwise comparisons.
 |
RESULTS |
Construction and expression of CD8 fusion protein.
Trimerization has been shown to be important for TNF family
ligand-receptor interaction (3). Given the property of
spontaneous oligomerization of the CD8
-chain extracellular (EC)
domain and successful employment of a CD8-CD40L fusion protein
(6), the CD8 EC domain was fused with the Fas or TNFR1 EC
domain to generate a chimeric fusion protein. As a control, a virus
expressing only the CD8
-chain EC domain was also produced. To
minimize any possible foreign elements in the transgene, no extra amino
acid was introduced between these domains.
To determine whether full-length, functional proteins were produced,
HeLa cells were transiently infected with the Ad vectors
and the
culture medium was tested for protein expression by ELISA
and Western
blot analysis and for function by inhibition of cell
death. As shown in
Fig.
1A, all three proteins could be
detected
by ELISA using two different monoclonal antibodies to CD8.
These
results were specific, since when the coating antibody was
directed
against either Fas (Fig.
1B) or TNF-R1 (Fig.
1C), only the
appropriate
transgene product was detected. Western blot analysis
revealed
that TNFR-CD8 and Fas-CD8 had molecular masses of ~60 and 56 kDa,
respectively (Fig.
1D), consistent with the sizes predicted from
the DNA sequences and glycosylation (
34). To examine the
molecular
weights of these fusion proteins under native (PBS) and
dissociating
(0.5% SDS) conditions, we applied culture supernatants to
a Sephadex
G-100 gel filtration column and detected the fusion
proteins by
ELISA. Under native conditions, TNFR-CD8 and Fas-CD8 eluted
near
the void volume of the column, whereas under dissociating
conditions,
the size of TNFR-CD8 was ~45 kDa (data not shown).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 1.
Detection of fusion proteins by ELISA and Western
blotting. ELISA plates were coated with capture antibody (A, anti-CD8;
B, anti-Fas; C, anti-TNFR1) and incubated with the culture supernatants
from HeLa cells infected with Ad vectors expressing the proteins
indicated (x axis). The proteins were detected by sequential
incubation with biotinylated anti-CD8, streptavidin-alkaline
phosphatase, and substrate. The results are expressed as OD at 405 nm.
Panels A to C are representative of six experiments. The negative
control was culture medium alone. (D) Concentrated supernatants
obtained from AdFas-CD8 (lane 1), AdCD8 (lanes 2 and 3)-, and
AdTNFR-CD8 (lane 4)-infected HeLa cells were analyzed by Western
blotting using rabbit anti-Fas (lanes 1 and 2) or goat anti-TNFR1
antibodies (lanes 3 and 4) followed by the appropriate
peroxidase-labeled secondary antibodies and substrate. The values to
the left are molecular sizes in kilodaltons.
|
|
CD8 fusion proteins specifically inhibit their cognate ligands in
vitro.
To ensure that the fusion proteins retained the function of
binding authentic ligand, we tested the culture supernatants containing each protein in an in vitro functional assay. As shown in Fig. 2A, TNFR-CD8 efficiently inhibited
TNF-
induced death of L929 cells. Similarly, Fas-CD8 attenuated
FasL-mediated apoptosis of the B-cell lymphoma A20 (Fig. 2B). Since CD8
can bind to major histocompatibility complex class I via its CDR1
and CDR2 domains, we also evaluated the possible interference of
soluble CD8 in a classical allogeneic cytotoxic T-lymphocyte
reaction. As shown in Fig. 2C, addition of supernatants containing
Fas-CD8 or TNFR-CD8 failed to inhibit this in vitro reaction. In
addition, no evidence for binding of these fusion proteins to
several major histocompatibility complex class I-positive cell
lines (AE7 and EL4) was observed by flow cytometry analysis (data
not shown).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 2.
CD8 fusion proteins specifically inhibit their cognate
ligands in vitro. (A) Twofold dilutions of TNFR-CD8 viral supernatant
or MP6-XT22 anti-TNFR- monoclonal antibody were preincubated
with 300 pg of TNF- per ml for 4 h at 4°C and then incubated
with L929 cells in the presence of cycloheximide (10 µg/ml) for
16 h. Cell viability was evaluated by using alamar blue. (B) A
serial twofold dilution of soluble human Fas ligand (FasL)
(25) was added to the B-cell lymphoma A20 in the presence of
either Fas-CD8 or soluble CD8 alone. Cell viability was quantified by
the alamar blue assay as for panel A. Results are presented as mean of
duplicates and are representative of three experiments. (C)
Alloreactive (anti-H-2b) or control (F1) T cells
were generated in vivo as described in Materials and Methods and tested
for cytotoxicity against 51Cr-labeled EL4 cells.
Supernatants from HeLa cells infected with Ad vectors expressing
-galactosidase, CD8, Fas-CD8, or TNFR-CD8 were coincubated in the
cytotoxicity assay, and the results are expressed as percent specific
lysis. The results shown are means of triplicates and are
representative of two experiments. E:T ratio, effector-to-target cell
ratio.
|
|
The soluble Fas and TNFR fusion proteins are expressed and
functional in vivo.
Purified viruses were injected into BALB/c
mice i.v. and serum was assayed for transgene expression at 1 week
postinjection. To determine whether the secreted soluble fusion
proteins were functional, inducers of cell death were administered to
Ad-infected SCID mice at 1 week postinfection. As shown in Fig.
3A, 6 µg of anti-Fas antibody Jo2
induced massive hepatic apoptosis in SCID mice infected with the
control AdCAT virus (all six mice died by 24 h), whereas mice
infected with AdFas-CD8 were substantially protected (none of six mice
died at 24 h). To investigate the functional capacity of the
TNFR-CD8 fusion protein in vivo, we exploited the high sensitivity of
mice to lethal shock when exposed to bacterial LPS systemically.
Following LPS injection, the mice were observed for 3 days, after which
surviving mice were sacrificed. All of the six mice injected with AdCAT
died within 6 h of injection of LPS. In striking contrast, all six
mice that had been injected with AdTNFR-CD8 survived (similar to
TNF-
deficient mice [21]). At autopsy (immediately
after death), the AdCAT-injected mice showed extensive hemorrhagic
liquifaction of the liver whereas mice receiving AdTNFR-CD8
were protected (Fig. 3B).

View larger version (144K):
[in this window]
[in a new window]
|
FIG. 3.
Fusion proteins Fas-CD8 and TNFR-CD8 protect mice from
lethal anti-Fas hepatic apoptosis or LPS-induced shock. (A) SCID mice
were injected i.v. with 2 × 1010 particles of AdCAT
(n = 6) or AdFas-CD8 (n = 6). Six days
later, the mice were injected with 6 µg of anti-Fas i.v. Livers of
mice that died or were sacrificed at 24 h postinjection were
analyzed by hematoxylin- and eosin staining. Livers from AdCAT-infected
mice showed extensive hemorrhage with liquefaction "necrosis",
whereas mice infected with AdFas-CD8 were protected. Magnification,
×40. (B) C3H/HeSnJ mice were injected i.v. with 2 × 1010 particles of AdTNFR-CD8 (n = 6) or
the AdCAT control (n = 6). Five days later, they were
sensitized with 20 mg of D-galactosamine followed by 0.3 µg of LPS given intraperitoneally. The livers of mice that died or
were sacrificed were sectioned and stained with hematoxylin and eosin.
The AdCAT-injected mice showed extensive hemorrhagic liquefaction of
the liver, whereas mice receiving AdTNFR-CD8 were protected.
Magnification, ×40.
|
|
Duration of transgene expression in the liver.
To compare
the expression levels of the different transgenes in vivo, SCID
mice were injected with 2 × 1010 particles of
AdCD8, AdTNFR-CD8, or AdFas-CD8 and pooled serum from
each group was tested for CD8 expression by ELISA. As shown in Fig.
4A, CD8, Fas-CD8, and TNFR-CD8 were
produced at similar levels in vivo as determined by the CD8
sandwich ELISA. In contrast, when anti-Fas or anti-TNFR was used as the
coating antibody, the ELISA sensitivities were severalfold higher for
Fas-CD8 and TNFR-CD8, respectively. Because of the low level of CD8
detection, this transgene was not used for kinetic studies.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
Detection and kinetics of transgene expression in vivo.
(A) To compare the relative sensitivities of the ELISAs for the
transgenes, SCID mice (four or five per group) were infected with
2 × 1010 particles of Ad vectors expressing CD8,
FasCD8, or TNFR-CD8. The 7-day serum samples were pooled, diluted 1:2,
and tested by ELISAs using the capture antibodies shown and anti-CD8
antibody YST 169 as the detecting antibody. AdFas-CD8, AdTNFR-CD8,
or both viruses together were used to infect BALB/c (B) or B6 (C) mice.
Serum was analyzed at weekly intervals for Fas-CD8 (closed symbols) or
TNFR-CD8 (open symbols) transgene expression by ELISA as described in
the legend to Fig. 1. The results are expressed relative to the OD at
week 1. Expression of Fas-CD8 was significantly higher in
AdFas-CD8-plus-AdTNFR-CD8-infected mice compared to
AdFas-CD8-infected mice (BALB/c mice at week 2, P < 0.0001; B6 mice at week 6, P < 0.001).
|
|
To determine whether inhibition of Fas or TNF-

allowed prolonged
expression of the respective fusion proteins in normal mice,
BALB/c and
B6 mice were infected by the i.v. route and tested
for fusion protein
expression by ELISA. In BALB/c mice, levels
of Fas-CD8 in serum peaked
at week 1 (corresponding to ~4 µg/ml
compared to a partially
purified standard) and then approached
background levels after 2 weeks,
whereas TNFR-CD8 levels were
sustained until week 2 and then declined
in week 3 (Fig.
4B).
When AdFas-CD8 and AdTNFR-CD8 were coinjected,
Fas-CD8 persisted
with kinetics similar to those of TNFR-CD8 (Fig.
4B).
To examine
strain differences, the experiments were repeated with B6
mice.
In contrast to BALB/c mice, a high level of Fas-CD8 expression
was detected in about a third of mice for 4 weeks postinjection,
followed by a gradual decline. All of the B6 mice expressed high
a
level of TNFR-CD8 (
n = 5) up to 6 weeks postinfection.
As in
BALB/c mice, TNFR-CD8 prolonged the expression of Fas-CD8.
Coinfection with AdCAT and AdTNFR-CD8 results in reduced
mononuclear cell infiltration in the liver.
We previously reported
that prolonged expression of AdCAT in the livers of TNF-
-deficient
mice was explained, in part, by reduced hepatic infiltration of
mononuclear cells. To determine whether a similar mechanism could
explain prolonged TNFR-CD8 expression in B6 mice, we examined the
livers of mice infected with AdTNFR-CD8 7 days postinfection. As
shown in Fig. 5, AdCAT-infected mice showed extensive infiltration of mononuclear cells, especially around
the portal vein, whereas coinjection of AdTNFR-CD8 with AdCAT
greatly reduced the extent of inflammation. As shown in Fig. 5E, T
cells from TNFR-CD8 mice were equivalently sensitized to virus,
indicating that the absence of TNF-
results in a marked reduction in
mononuclear cell recruitment but does not impair T-cell proliferation
(this study) or T-cell cytotoxicity (9).

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 5.
T cells in AdTNFR-CD8-infected mice proliferate in
response to antigen but show reduced mononuclear cell infiltration in
the liver. B6 mice were infected with 2 × 1010
particles of AdCAT (n = 4) or 2 × 1010 particles of AdTNFR-CD8 (n = 4)
together with AdCAT and sacrificed at 7 days postinfection. Liver
sections were stained with hematoxylin and eosin and examined by light
microscopy (magnifications: A and C, ×10; B and D, ×40). Extensive
perivascular infiltrates were observed in mice infected with AdCAT (A
and B) but were much less prominent in mice receiving the coinjection
(C and D). To determine whether T cells were sensitized to Ad, T-cell
proliferative responses were compared at different multiplicities of
infection (MOI) at day 5 by [3H]thymidine incorporation
(E).
|
|
Absence or blockade of TNF-
prolongs transgene expression in the
lung.
To determine whether mucosal immune responses in the airway
were similar to the systemic immune response in the liver, we administered AdCAT to TNF-
- and Fas-deficient mice by the i.t. route
and quantified CAT expression in the lungs. At 4 weeks postinjection, CAT activity was significantly higher in lung tissue obtained from
TNF-
-deficient mice but only modestly higher in Fas-deficient mice
compared to wild-type mice (Fig. 6).

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 6.
Transgene expression in the lung. (A) AdCAT (2.5 × 109 viral particles) was administered to TNF- -deficient
(TNF / ) mice, Fas-deficient (lpr) mice, or paired
wild-type (WT) controls (n = 5) by the i.t. route, and
CAT expression was quantified at days 7 and 30 as previously described
(10).
|
|
We next examined whether the soluble fusion proteins would promote
virus persistence in the lung. When B6 mice were infected
with
AdTNFR1-CD8, AdFas-CD8, or AdCD8 by the i.t. route, relatively
high
levels (compared to the SCID control) of the TNFR1-CD8 but
not the
Fas-CD8 fusion protein were detected in BALs 4 weeks postadministration
(Fig.
7). In view of the differences in
the sensitivities of the
ELISAs, we evaluated mRNA transcription of the
transgenes with
the same primer pairs used to create the transgene.
RT-PCR confirmed
continued transcription of the TNFR1-CD8 transgene
mRNA in four
out of five mice and Fas-CD8 in none of four mice, and CD8
mRNA
was barely detected in all five mice at this time (Fig.
7).
Similar
results were obtained when common vector primers were used for
PCR. These findings indicate that blockade of TNF-

in the lung
has a
protective effect on immune elimination similar to that
observed in the
liver but that Fas plays a lesser role than that
previously observed in
the liver (
10).

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 7.
B6 mice (four or five per group) were infected with
2.5 × 109 viral particles of AdTNFR1, AdFas-CD8,
AdCD8, or AdCAT (background control) by the i.t. route. BALs were
obtained at day 28, and the levels of expression of TNFR-CD8 (A),
Fas-CD8 (B) and CD8 (C) were quantified by ELISA as described in the
legend to Fig. 1. The level of expression of the corresponding
transgene in SCID serum (open bars in panels A and B) is shown for
comparison. In panel C, BAL from AdTNFR-CD8-infected mice whose
results are shown in panel A was used as a control (open bar).
Expression of the mRNAs encoding these proteins was also evaluated
by RT-PCR using the primers described in Materials and Methods. The
lanes containing RNA from mice infected with the transgene are shown.
N, mice injected with an irrelevant transgene; S, SCID mouse injected
with the same transgene; P, plasmid positive control.
|
|
Transprotection mediated by TNFR-CD8.
To approximate
a gene therapy application more closely, we examined
whether TNFR-CD8 would provide transprotection for a second gene product, in this case, the bacterial enzyme CAT (Fig.
8). AdTNFR-CD8 and AdCAT were
coinjected i.v., and CAT expression was evaluated at day 21 in BALB/c
mice (Fig. 8A) or at day 28 in B6 mice (Fig. 8B). As shown,
coexpression of AdTNFR-CD8 with AdCAT markedly enhanced CAT
expression in both strains of mice compared to AdCAT alone. To
determine whether this effect could also be seen in the lung, the three
transgenes were coadministered with AdCAT by the i.t. route and
expression of CAT was quantified at day 28. As shown in Fig. 8C,
TNFR-CD8 conferred significantly greater protection for CAT expression
compared to the other transgenes. When analyzed at the level of
transcription, CAT mRNA was only detected in
AdTNFR-CD8-infected lungs (Fig. 8D). CAT mRNA expression was not detected in the lungs of mice infected with AdCAT alone (data
not shown). Together, these findings indicate that TNFR-CD8 can extend
the expression of a foreign transgene product and that this expression
is due to continued transcription of the transgene.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 8.
Transprotection of CAT by TNFR-CD8. For liver tests,
BALB/c (A) or B6 (B) mice (four or five per group) were either infected
with 2 × 1010 particles of AdCAT alone or coinfected
with 2 × 1010 particles of AdCAT together with 2 × 1010 particles of AdTNFR-CD8 i.v. The mice were
sacrificed at the time points shown, and the livers were harvested for
measurement of CAT activity. NS, not significant. For lung tests, B6
mice were infected with 2.5 × 109 particles of
AdTNFR1 (n = 5), AdFas-CD8 (n = 4),
or AdCD8 (n = 5) together with 2.5 × 109 particles of AdCAT by the i.t. route. At day 28, the
mice were sacrificed and the lungs were harvested for measurement of
CAT enzyme activity (C) or CAT mRNA expression by RT-PCR (D). V,
CAT viral DNA; N, negative control.
|
|
TNFR-CD8 attenuates the humoral immune response to Ad.
We
previously showed that TNF-
-deficient mice had an impaired humoral
immune response to AdCAT (10). This finding is of considerable importance, since the humoral immune response prevents successful readministration of the virus. T-cell-dependent B-cell responses in TNF-
-deficient mice are compromised due to a defect in
germinal-center formation (22, 27). We therefore
examined the effect of TNF-
blockade on humoral responses to Ad
in the liver and lung 4 weeks postinfection. Following i.v.
administration, IgG responses in AdTNFR-CD8 mice were
substantially reduced compared to those in controls (CAT and CD8) (Fig.
9A). In contrast, mice infected with
AdFas-CD8 alone or with both vectors simultaneously had antibody
responses similar to those of controls. When mice were infected with
AdTNFR-CD8 by the i.t. route, there was a statistically significant
reduction in anti-Ad antibodies compared to controls (Fig. 9B).
Neutralizing assays confirmed that the reduction in total antibody
levels was associated with reduced neutralizing activity. About 10- and
4-fold less neutralizing antibody was produced in mice infected with
AdTNFR-CD8 than in those infected with AdCD8 by the i.v. (Fig. 9C)
and i.t. (Fig. 9D) routes, respectively.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 9.
TNFR-CD8, but not Fas-CD8, reduces the humoral immune
response to Ad. Mice were infected with Ad vectors expressing the
vectors shown (x axis) by either the i.v. (A and C) or the
i.t. (B and D) route. Sera were tested for total IgG anti-Ad antibodies
(A and B) or neutralizing antibodies (C and D) at day 28 by ELISA. In
panel A, the TNFR-CD8 and uninjected (Uninj) levels, but not the
Fas-CD8 and combined (TNFR-CD8 together with Fas-CD8 [Comb]) levels,
were significantly lower than the control (CAT and CD8) levels
(analysis of variance, P < 0.05). In panel B, antibody
levels were significantly lower in the TNFR-CD8 group than in the CD8
group (P < 0.001).
|
|
 |
DISCUSSION |
TNF and Fas belong to the nerve growth factor-TNF (NGF-TNF)
receptor NGF-TNF superfamily of proteins that now comprise almost 20 members (1, 33). TNF-
has dual antiviral potential based on the ability to directly induce cytotoxicity as well as to promote a
potent proinflammatory immune response. This proinflammatory response
is mediated, in part, by NF-
B transcription of numerous cytokine and
adhesion molecule gene products (reviewed in reference 2). FasL is a cytotoxic effector that induces
apoptosis in activated cells that bear the Fas receptor (reviewed in
reference 26). FasL has been implicated in the host
defense against several virus infections. CD4+ T cells can
transfer lethal lymphocytic choriomeningitis virus disease to
2-microglobulin-deficient mice by a Fas-dependent pathway
(39), and evidence for FasL-mediated tissue injury has been
observed both in the hepatitis transgene model and in Fas null mice
(20), as well as in human livers infected with hepatitis B
virus (14, 16).
We previously reported a marked or moderate persistence of expression
of a foreign transgene, that for CAT, in mice that were deficient in
TNF-
or Fas, respectively (10). In the present study,
we demonstrated the persistence of transgenes in normal animals by
expressing soluble receptors that inhibited their respective ligands.
To design Ad vectors expressing soluble TNFR1 and Fas, the
extracellular domains of these proteins were ligated to the EC domain
of CD8. We developed ELISAs to quantify recombinant protein levels and
demonstrated that soluble CD8 and the chimeric fusion proteins TNFR-CD8
and Fas-CD8 were produced by virus-infected cells in vitro. It has
previously been shown that TNFR and Fas function as trimmers (3,
19). Western blot analysis and gel filtration confirmed the
correct size of the fusion proteins and, most important for ligand
binding, confirmed that the fusion protein multimerized under
nondissociating conditions. Both TNFR-CD8 and Fas-CD8 were found to
block their respective ligands in vitro, as well as to prevent fatal
LPS-induced shock mediated through TNF (22) or
anti-Fas-mediated hepatic apoptosis (23) in vivo.
Most foreign transgenes expressed by Ad are eliminated between 2 and 3 weeks postinfection (35, 38). Few studies, however, have
evaluated the duration of expression of self transgenes. Tripathy et
al. (32) compared the duration of expression of transgenes
encoding a foreign (human) soluble protein with that of a self
(mouse) soluble protein, erythropoietin, following
intramuscular injection into normal mice. Whereas the human-encoded
protein was rapidly eliminated, mouse erythropoietin persisted for
periods exceeding 4 months as determined by its biological effect on
erythrocyte production. The authors concluded that limited transgene
expression reported by other investigators could be explained by an
immune attack on the foreign protein. Other investigators have shown a
shorter duration of expression of self proteins. Although a biological
effect of thrombopoietin was evident for 2 months, mRNA expression
of the transgene was not detected beyond 2 weeks postinfection,
regardless of the route of administration or the mouse strain infected
(30).
To determine the duration of expression of CD8 self transgenes
following i.v. administration in normal mice, we quantified the levels
of soluble CD8 and the CD8 fusion proteins in serum at weekly intervals
postinfection. Failure to detect CD8 in serum beyond 1 week was, at
least in part, explained by the low sensitivity of the CD8 ELISA,
whereas when serum was tested neat or diluted 1/2, the ELISAs for Fas
and TNFR were approximately equivalent in sensitivity. The significant
increase in the levels of TNFR-CD8 compared to Fas-CD8 therefore
suggests that the TNFR fusion protein prolonged its own expression in
the liver. This was particularly striking in the B6 strain, where the
fusion protein was readily detectable in serum 2 to 3 months postinfection.
We previously reported that persistence of a foreign transgene,
that for CAT, in TNF-
-deficient mice was explained by reduced recruitment of T cells to the liver rather than a failure of
T-cell cytotoxicity (10). Since reduced mononuclear cells
were also observed in the livers of mice infected with AdTNFR-CD8
yet T-cell proliferation in response to the virus was normal, we
conclude that persistence of the virus in these mice is also due to
impaired recruitment to the site of infection.
To further examine the effects of the soluble TNFR and Fas fusion
proteins, similar experiments were performed in the lung. Following
i.t. administration, TNFR-CD8, but not Fas-CD8 or CD8 alone, was
detected at relatively high levels in the BAL at day 28. Detection of
the protein was due to persistent expression, since mRNA was
readily demonstrable in most of these mice at the time of sacrifice.
Together, these findings indicate that infection of normal mice with
AdTNFR-CD8 results in prolonged expression of the transgene and is
consistent with the results obtained with TNF-
-deficient animals
(10). Fas-CD8 had a much more modest effect on Ad
persistence and, for reasons that are unexplained, was more variable
from mouse to mouse. This result is also consistent with the lower
expression of CAT in Fas-deficient mice compared to TNF-
-deficient
mice (10) and suggests that redundant pathways are able to
compensate for Fas-mediated cytotoxicity in this model. Although
detection of AdTNFR-CD8 mRNA in the lungs of infected mice at 4 weeks indicated persistent expression of the transgene, the sensitivity
of the ELISAs could be a limiting factor for accurate assessment of
transgene persistence at the protein level. To simulate a potential
gene therapy application, we examined the ability of the fusion
proteins to protect against an immune response against a foreign
transgene, that for CAT. Coadministration of AdTNFR-CD8 and AdCAT
i.v. caused a striking increase in CAT expression in both BALB/c and B6
mice. Similarly, TNFR-CD8, but not the other two transgenes, extended
CAT expression in the lungs. Ad-mediated transgene expression may vary
between different mouse strains (4). Although our studies
are not exhaustive, persistent expression of TNFR-CD8 in both BALB/c
and B6 mice suggests that these results are likely to be generalizable.
Together, these findings suggest that transprotection by
TNFR-containing fusion proteins might be useful in extending the
expression of a transgene product in human diseases, including cystic fibrosis.
Many strategies have been proposed to reduce the immune response
against Ad-encoded transgenes. However, depletion of lymphocyte subpopulations or immunosuppressive drugs such as cyclosporine would be
expected to predispose to secondary infection. TNF-
-deficient mice do not spontaneously develop infections, although they have higher
mortality when infected with Listeria monocytogenes or Mycobacterium tuberculosis (22, 27). We did not
observe any overt infection in mice receiving AdTNFR-CD8,
suggesting that this may be a relatively safe form of
immunosuppression, at least in normal individuals. Further studies are
required to determine whether temporary blockade of TNF-
increases the risk of infection in hosts who have a pre-existing
infection or are immunocompromised.
Humoral immune responses pose another hurdle for gene therapy by
eliminating soluble foreign transgenes and by preventing readministration of the Ad vectors. While the striking reduction in the
IgG antibody response to Ad in TNF-
-deficient mice (10) might be expected in view of the key role of TNF in the formation of
germinal centers (22, 27), the significant decrease in the
total and neutralizing anti-Ad IgG response observed following expression of a soluble inhibitor of TNF-
indicates that a similar effect can be obtained in mice that have normal maturation of lymph
nodes. Blockade of TNF-
in normal mice may reduce humoral responses
by also inhibiting T-B interaction in germinal centers or by one of the
other numerous effects that TNF-
has on the immune system. These
effects range from promoting maturation of dendritic cells that are
important in antigen presentation (28), recruitment of
effector cells to the site of infection, and regulation of T- and
B-cell function (12). Despite reduction of the humoral immune response to Ad in AdTNFR-CD8-infected mice, preliminary attempts to reinfect the mice have not yielded a high level of expression of a second transgene 1 to 2 months later (unpublished observations).
The reduced antibody response was specific for TNF blockade, since mice
injected with Fas-CD8 or CD8 had similar levels of anti-Ad IgG.
Interestingly, coadministration of Fas-CD8 and TNFR-CD8 abrogated the
humoral effect of TNFR, suggesting that blocking Fas most likely
protects B cells from apoptosis mediated through Fas ligand
expressed on Th1 CD4+ T cells (see reference
11). This finding emphasizes that whereas blockade
of TNFR1 or Fas (to a much lower extent) independently prolongs the
expression of transgenes, the combination of transgenes abrogates the
effect of TNF inhibition on the humoral immune response. These findings
caution against the combined use of immunomodulators without careful
evaluation of their interactions.
 |
ACKNOWLEDGMENTS |
This work was supported by grants NIH AR45482 (to K.B.E.) and PO1
HL51746 (for E.F.-P. and R.G.C.) and Cystic Fibrosis Foundation grant
Z990 (to E.F.-P.). E.F.P. and R.G.C. receive sponsored research support
from GenVec.
We thank Stephan Worgall and Peter Bullough for help with these studies.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Research
Division, Hospital for Special Surgery-Cornell University Medical
Center, 535 East 70th St., New York, NY 10021. Phone: (212) 606-1409. Fax: (212) 717-1192. E mail: elkonk{at}hss.edu.
 |
REFERENCES |
| 1.
|
Ashkenazi, A., and V. M. Dixit.
1998.
Death receptors: signaling and modulation.
Science
281:1305-1308[Abstract/Free Full Text].
|
| 2.
|
Baldwin, A. S., Jr.
1996.
The NF-kappa B and I kappa B proteins: new discoveries and insights.
Annu. Rev. Immunol.
14:649-683[Medline].
|
| 3.
|
Banner, D.,
A. D'Arcy,
W. Janes,
R. Gentz,
H. Schoenfeld,
C. Broger,
H. Loetscher, and W. Lesslauer.
1993.
Crystal structure of the soluble human 55 kDa TNF receptor-human TNF beta complex: implications for TNF receptor activation.
Cell
73:431-445[Medline].
|
| 4.
|
Barr, D.,
J. Tubb,
D. Ferguson,
A. Scaria,
A. Lieber,
C. Wilson,
J. Perkins, and M. A. Kay.
1995.
Strain related variations in adenovirally mediated transgene expression from mouse hepatocytes in vivo: comparisons between immunocompetent and immunodeficient inbred strains.
Gene Ther.
2:151-155[Medline].
|
| 5.
|
Bullard, D. C.,
P. D. King,
M. J. Hicks,
B. Dupont,
A. L. Beaudet, and K. B. Elkon.
1997.
ICAM-1 deficiency protects MRL/MpJ-Faslpr mice from early lethality.
J. Immunol.
159:2058-2067[Abstract].
|
| 6.
|
Cella, M.,
D. Scheidegger,
K. Palmer-Lehmann,
P. Lane,
A. Lanzavecchia, and G. Alber.
1996.
Ligation of CD40 on human dendritic cells triggers production of high levels of interleukin-12 and enhances T cell stimulatory capacity: T-T help via APC activation.
J. Exp. Med.
184:747-752[Abstract/Free Full Text].
|
| 7.
|
Chirmule, N.,
J. V. Hughes,
G.-P. Gao,
S. E. Raper, and J. M. Wilson.
1998.
Role of E4 in eliciting CD4 T-cell and B-cell responses to adenovirus vectors delivered to murine and nonhuman primate lungs.
J. Virol.
72:6138-6145[Abstract/Free Full Text].
|
| 8.
|
Cohen, P. L., and R. A. Eisenberg.
1991.
lpr and gld: single gene models of systemic autoimmunity and lymphoproliferative disease.
Annu. Rev. Immunol.
9:243-269[Medline].
|
| 9.
|
Drappa, J.,
N. Brot, and K. B. Elkon.
1993.
The Fas protein is expressed at high levels on double positive thymocytes and activated mature T cells in normal but not MRL/lpr mice.
Proc. Natl. Acad. Sci. USA
90:10340-10344[Abstract/Free Full Text].
|
| 10.
|
Elkon, K. B.,
C. C. Liu,
J. G. Gall,
J. Trevejo,
M. W. Marino,
K. A. Abrahamsen,
L. J. Old,
R. G. Crystal,
X. Song,
J. L. Zhou, and E. Falck-Pedersen.
1997.
TNF- plays a central role in immune mediated clearance of adenoviral vectors.
Proc. Natl. Acad. Sci. USA
94:9814-9819[Abstract/Free Full Text].
|
| 11.
|
Elkon, K. B., and A. Marshak-Rothstein.
1996.
B cells in systemic autoimmune disease: recent insights from Fas-deficient mice and men.
Curr. Opin. Immunol.
8:852-859[Medline].
|
| 12.
|
Feldmann, M.,
F. M. Brennan, and R. N. Maini.
1995.
Role of cytokines in rheumatoid arthritis.
Annu. Rev. Immunol.
14:397-440[Medline].
|
| 13.
|
Franco, M. A.,
C. Tin,
L. S. Rott,
J. L. VanCott,
J. R. McGhee, and H. B. Greenberg.
1997.
Evidence for CD8+ T-cell immunity to murine rotavirus in the absence of perforin, Fas, and gamma interferon.
J. Virol.
71:479-486[Abstract].
|
| 14.
|
Galle, P. R.,
W. J. Hofmann,
H. Walczak,
H. Schaller,
G. Otto,
W. Stremmel,
P. H. Krammer, and L. Runkel.
1995.
Involvement of the CD95 (APO-1/Fas) receptor and ligand in liver damage.
J. Exp. Med.
182:1223-1230[Abstract/Free Full Text].
|
| 15.
|
Ginsberg, H. S.,
L. L. Moldawer,
P. B. Sehgal,
M. Redington,
P. L. Kilian,
R. M. Chanock, and G. A. Prince.
1991.
A mouse model for investigating the molecular pathogenesis of adenovirus pneumonia.
Proc. Natl. Acad. Sci. USA
88:1651-1655[Abstract/Free Full Text].
|
| 16.
|
Hiramatsu, N.,
N. Hayashi,
K. Katayama,
K. Mochizuki,
Y. Kawanishi,
A. Kasahara,
H. Fusamoto, and T. Kamada.
1994.
Immunohistochemical detection of Fas antigen in liver tissue of patients with chronic hepatitis C.
Hepatology
19:1354-1359[Medline].
|
| 17.
|
Ilan, Y.,
G. Droguett,
N. R. Chowdhury,
Y. Li,
K. Sengupta,
N. R. Thummala,
A. Davidson,
J. R. Chowdhury, and M. S. Horwitz.
1997.
Insertion of the adenoviral E3 region into a recombinant viral vector prevents antiviral humoral and cellular immune responses and permits long-term gene expression.
Proc. Natl. Acad. Sci. USA
94:2587-2592[Abstract/Free Full Text].
|
| 18.
|
Kagi, D.,
P. Seiler,
J. Pavlovic,
B. Ledermann,
K. Burki,
R. M. Zinkernagel, and H. Hengartner.
1995.
The roles of perforin- and Fas-dependent cytotoxicity in protection against cytopathic and noncytopathic viruses.
Eur. J. Immunol.
25:3256-3262[Medline].
|
| 19.
|
Kischkel, F. C.,
S. Hellbardt,
I. Behrmann,
M. Germer,
M. Pawlita,
P. H. Krammer, and M. E. Peter.
1995.
Cytotoxicity dependent APO-1 (Fas/CD95) associated proteins from a death inducing signaling complex (DISC) with the receptor.
EMBO. J.
14:5579-5588[Medline].
|
| 20.
|
Kondo, T.,
T. Suda,
H. Fukuyama,
M. Adachi, and S. Nagata.
1997.
Essential roles of the Fas ligand in the development of hepatitis.
Nat. Med.
3:409-413[Medline].
|
| 21.
|
Lieber, A.,
C. Y. He,
L. Meuse,
D. Schowalter,
I. Kirillova,
B. Winther, and M. A. Kay.
1997.
The role of Kupffer cell activation and viral gene expression in early liver toxicity after infusion of recombinant adenovirus vectors.
J. Virol.
71:8798-8807[Abstract].
|
| 22.
|
Marino, M. W.,
A. Dunn,
D. Grail,
M. Inglese,
Y. Noguchi,
E. Richards,
A. Jungbluth,
H. Wada,
M. Moore,
B. Williamson,
S. Basu, and L. J. Old.
1997.
Characterization of tumor necrosis factor-deficient mice.
Proc. Natl. Acad. Sci. USA
94:8093-8098[Abstract/Free Full Text].
|
| 23.
|
Ogasawara, J.,
R. Watanabe-Fukunaga,
M. Adachi,
A. Matsuzawa,
T. Kasugai,
Y. Kitamura,
N. Itoh,
T. Suda, and S. Nagata.
1993.
Lethal effect of the anti-Fas antibody in mice.
Nature
364:806-809[Medline].
|
| 24.
|
Onel, K.,
D. Ashany,
J. Nikolic-Zugic,
E. Lacy, and K. B. Elkon.
1995.
Expression and function of the murine CD95 Fas/APO-1 receptor in relation to B cell tolerance.
Eur. J. Immunol.
25:2940-2947[Medline].
|
| 25.
|
Orlinick, J. R.,
K. B. Elkon, and M. V. Chao.
1997.
Separate domains of the human Fas ligand dictate self-association and receptor binding.
J. Biol. Chem.
272:32221-32229[Abstract/Free Full Text].
|
| 26.
| Orlinick, J. R., A. K. Vaishnaw, and K. B. Elkon. Structure and function of Fas/Fas ligand. Int. Rev.
Immunol., in press.
|
| 27.
|
Pasparakis, M.,
L. Alexopoulou,
V. Episkopou, and G. Kollias.
1996.
Immune and inflammatory responses in TNF- -deficient mice: a critical requirement for TNF- in the formation of primary B cell follicles, follicular dendritic cell networks and germinal centers, and in the maturation of the humoral immune response.
J. Exp. Med.
184:1397-1411[Abstract/Free Full Text].
|
| 28.
|
Sallusto, F., and A. Lanzavecchia.
1994.
Efficient preparation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha.
J. Exp. Med.
179:1109-1118[Abstract/Free Full Text].
|
| 29.
|
Shisler, J.,
C. Yang,
B. Walter,
C. F. Ware, and L. R. Gooding.
1997.
The adenovirus E3-10.4K/14.5K complex mediates loss of cell surface Fas (CD95) and resistance to Fas-induced apoptosis.
J. Virol.
71:8299-8306[Abstract].
|
| 30.
|
Suzuki, M.,
R. Singh,
M. A. Moore,
W. R. Song, and R. G. Crystal.
1998.
Similarity of strain- and route-dependent murine responses to an adenovirus vector using the homologous thrombopoietin cDNA as the reporter genes.
Hum. Gene. Ther.
20:1223-1231.
|
| 31.
|
Tollefson, A. E.,
T. W. Hermiston,
D. L. Lichtenstein,
C. F. Colle,
R. A. Tripp,
T. Dimitrov,
K. Toth,
C. E. Wells,
P. C. Doherty, and W. S. M. Wold.
1998.
Forced degradation of Fas inhibits apoptosis in adenovirus-infected cells.
Nature
392:726-730[Medline].
|
| 32.
|
Tripathy, S. K.,
H. B. Black,
E. Goldwasser, and J. M. Leiden.
1996.
Immune responses to transgene-encoded proteins limit the stability of gene expression after injection of replication-defective adenovirus vectors.
Nat. Med.
2:545-550[Medline].
|
| 33.
|
Wallach, D.,
M. Boldin,
E. Varfolomeev,
R. Beyaert,
P. Vandenabeele, and W. Fiers.
1997.
Cell death induction by receptors of the TNF family: towards a molecular understanding.
FEBS Lett.
410:96-106[Medline].
|
| 34.
|
Watanabe-Fukunaga, R.,
C. I. Brannan,
N. G. Copeland,
N. A. Jenkins, and S. Nagata.
1992.
Lymphoproliferation disorder in mice explained by defects in Fas antigen that mediates apoptosis.
Nature
356:314-317[Medline].
|
| 35.
|
Wilson, C., and M. A. Kay.
1995.
Immunomodulation to enhance gene therapy.
Nat. Med.
1:887-893[Medline].
|
| 36.
|
Wold, W. S. M.,
T. W. Hermiston, and A. E. Tollefson.
1994.
Adenovirus proteins that subvert host defenses.
Trends Microbiol.
2:437-443[Medline].
|
| 37.
|
Worgall, S.,
P. Leopold,
G. Wolff,
B. Ferris,
N. van Roijen, and R. G. Crystal.
1997.
Role of alveolar macrophages in rapid elimination of adenovirus vectors administered by the epithelial surface of the respiratory tract.
Human. Gene Ther.
8:1687-1696.
|
| 38.
|
Yang, Y.,
Q. Li,
H. C. Ertl, and J. M. Wilson.
1995.
Cellular and humoral immune responses to viral antigens create barriers to lung-directed gene therapy with recombinant adenoviruses.
J. Virol.
69:2004-2015[Abstract].
|
| 39.
|
Zajac, A. J.,
D. G. Quinn,
P. L. Cohen, and J. A. Frelinger.
1996.
Fas-dependent CD4+ cytotoxic T cell-mediated pathogenesis during virus infection.
Proc. Natl. Acad. Sci. USA
93:14730-14735[Abstract/Free Full Text].
|
Journal of Virology, June 1999, p. 5098-5109, Vol. 73, No. 6
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Wang, B.-Z., Quan, F.-S., Kang, S.-M., Bozja, J., Skountzou, I., Compans, R. W.
(2008). Incorporation of Membrane-Anchored Flagellin into Influenza Virus-Like Particles Enhances the Breadth of Immune Responses. J. Virol.
82: 11813-11823
[Abstract]
[Full Text]
-
Philpott, N. J., Nociari, M., Elkon, K. B., Falck-Pedersen, E.
(2004). Adenovirus-induced maturation of dendritic cells through a PI3 kinase-mediated TNF-{alpha} induction pathway. Proc. Natl. Acad. Sci. USA
101: 6200-6205
[Abstract]
[Full Text]
-
Kafrouni, M. I., Brown, G. R., Thiele, D. L.
(2003). The role of TNF-TNFR2 interactions in generation of CTL responses and clearance of hepatic adenovirus infection. J. Leukoc. Biol.
74: 564-571
[Abstract]
[Full Text]
-
Hostager, B. S., Bishop, G. A.
(2002). Role of TNF Receptor-Associated Factor 2 in the Activation of IgM Secretion by CD40 and CD120b. J. Immunol.
168: 3318-3322
[Abstract]
[Full Text]
-
Wen, S., Driscoll, R. M., Schneider, D. B., Dichek, D. A.
(2001). Inclusion of the E3 Region in an Adenoviral Vector Decreases Inflammation and Neointima Formation After Arterial Gene Transfer. Arterioscler. Thromb. Vasc. Bio.
21: 1777-1782
[Abstract]
[Full Text]
-
Peng, Y., Falck-Pedersen, E., Elkon, K. B.
(2001). Variation in Adenovirus Transgene Expression between BALB/c and C57BL/6 Mice Is Associated with Differences in Interleukin-12 and Gamma Interferon Production and NK Cell Activation. J. Virol.
75: 4540-4550
[Abstract]
[Full Text]
-
Russell, W. C.
(2000). Update on adenovirus and its vectors. J. Gen. Virol.
81: 2573-2604
[Full Text]
-
Peng, Y., Falck-Pedersen, E., Elkon, K. B.
(2000). Soluble CD8 Attenuates Cytotoxic T Cell Responses Against Replication-Defective Adenovirus Affording Transprotection of Transgenes In Vivo. J. Immunol.
165: 1470-1478
[Abstract]
[Full Text]
-
Trevejo, J. M., Marino, M. W., Philpott, N., Josien, R., Richards, E. C., Elkon, K. B., Falck-Pedersen, E.
(2001). TNF-alpha -dependent maturation of local dendritic cells is critical for activating the adaptive immune response to virus infection. Proc. Natl. Acad. Sci. USA
98: 12162-12167
[Abstract]
[Full Text]