Previous Article | Next Article 
Journal of Virology, May 1999, p. 4461-4464, Vol. 73, No. 5
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Contribution of Virus-Receptor Interaction to
Distinct Viral Proliferation of Neuropathogenic and Nonneuropathogenic
Murine Leukemia Viruses in Rat Glial Cells
Sayaka
Takase-Yoden* and
Rihito
Watanabe
Institute of Life Science, Soka University,
Hachioji, Tokyo 192-8577, Japan
Received 14 September 1998/Accepted 15 January 1999
 |
ABSTRACT |
The efficiency of receptor-mediated entry of pseudotyped virus
carrying the surface protein (SU) of clone A8, a neuropathogenic variant of Friend murine leukemia virus (FrMLV), to rat glial cell line
F10 was 1 order of magnitude greater than that of pseudotyped virus
carrying SU of nonneuropathogenic FrMLV clone 57. Introduction of the
gene coding for ecotropic MLV receptor on F10 cells
(F10-ecoR) into SIRC cells, which are naturally resistant
to FrMLV infection, also revealed the difference in receptor
recognition between the A8 and the 57 viruses. Our results show that
the difference in receptor utilization between A8-SU and 57-SU only
partially explains the 3-order-of-magnitude difference in proliferation
between A8 and 57 viruses in F10 cells.
 |
TEXT |
A neuropathogenic variant of Friend
murine leukemia virus (FrMLV), FrC6 virus clone A8, induced spongiform
degeneration in the brains of infected rats (17, 19).
Studies with chimerae constructed from A8 virus and nonneuropathogenic
FrMLV clone 57 (13) revealed that the env gene of
A8 is a primary determinant for the induction of neurodegeneration and
that the long terminal repeat (LTR) and/or 5' leader sequence of A8 is
also necessary for neuropathogenicity (17). Although the
mechanism of induction of spongiform degeneration in brain by
retrovirus infection is still not understood, it is speculated that the
interaction between the env gene product of neuropathogenic
virus and the viral receptor or other substances is critical for
neuropathogenicity (20).
The A8 virus replicates efficiently in rat glial cell line F10. In
contrast, the 57 virus is not very infective in F10 cells, but in NIH
3T3 cells, both 57 and A8 proliferate efficiently (17). Studies on A8 and 57 chimerae revealed that the determinants for proliferation in F10 cells are the env gene and the LTR
and/or 5' leader sequence of A8, but how much each gene contributes to viral production in F10 cells is not clear. Efficient viral replication in F10 cells is necessary for neuropathological manifestation in rats
infected with chimerae (17). The proliferation in the central nervous system (CNS) in vivo of their chimerae and of the
parental viruses A8 and 57 showed good correlation with viral production in F10 cells in vitro. Therefore, F10 cells and the A8 virus
are a suitable model for analysis of the interaction between SU protein
and the receptor connected with viral proliferation in CNS cells and neuropathogenicity.
Efficiency of receptor-mediated viral entry into F10 and NIH 3T3
cells.
To examine receptor-virus interaction, we used an assay for
receptor-mediated cell entry with pseudotyped retroviruses
incorporating A8-SU (pseudo-A8) or 57-SU (pseudo-57), which transfer
the
-galactosidase gene. Retrovirus vector, BAG, bearing
-galactosidase and neomycin resistance gene provided by C. Cepko,
Harvard Medical School (14), was stably introduced into NIH
3T3 cells. Then, expression vectors containing the A8 env
gene or the 57 env gene were stably introduced into the
BAG-introduced NIH 3T3 cells by cotransfection with an expression
vector for gag-pol of the A8 virus bearing the blasticidin deaminase (BSD) gene. Pseudo-A8 and pseudo-57 were inoculated to 2 × 104 of F10 or NIH 3T3 cells on a 12-well culture plate
in the presence of 10 µg of Polybrene per ml, and the numbers of
-galactosidase-positive cells were compared. For
5-bromo-4-chloro-3-indolyl
-D-galactoside (X-Gal)
visualization of
-galactosidase activity in intact cells, the method
of Dannenberg and Suga (5) was used, following fixation in
4% paraformaldehyde for 5 min and then fixation in 2%
formaldehyde-0.2% glutaraldehyde for 10 min. Relative infectivity of
F10 cells to NIH 3T3 cells was compared for pseudo-A8 or pseudo-57,
since titers of individual virus preparations differed for each
experiment. Pseudo-A8 gave F10/NIH relative infectivities of 0.17 on
average, whereas pseudo-57 exhibited relative titers of 1 order of
magnitude lower (Table 1). These results
indicate that the viruses recognized EcoR on F10 cells as distinct
from that on NIH 3T3 cells. The efficiency of receptor-mediated viral
entry varied in rat cell lines derived from different tissues. In lymph
node-derived cells (LYM-1) as well as in F10 cells, A8 had a higher
efficiency of entry than that of 57, indicating that the efficient
utilization of rat EcoR by A8 is not restricted to glial cells
(Table 2). In liver-derived cells
(ARLJ301-3), the efficiency of entry of 57 was similar to that of A8
(Table 2). Whole rat ecoR cDNAs have been isolated from
hepatoma cells and intestinal cells (3, 21). The third
extracellular loop domain, containing the virus-binding site of these
gene products, is identical to that of the ecoR gene on F10
cells (described later). Therefore, posttranslational modifications of
ecoR, such as glycosylation, numbers of EcoR molecules on
cells, or cofactors other than the receptor, might account for
differences in efficiency of viral entry in each cell line.
Isolation and sequence analysis of ecotropic murine leukemia virus
receptor cDNA from F10 cells.
We cloned the ecoR gene
from F10 cells to compare it with the ecoR gene derived from
NIH 3T3 cells. Total RNA (4) was extracted from F10 cells,
and first-strand DNA was synthesized by a reaction with the SuperScript
preamplification system for the first-strand cDNA synthesis kit
(GibcoBRL) with an oligonucleotide deoxyribosylthymine primer, in
accordance with the manufacturer's protocol. Second-strand DNA was
synthesized by PCR with a universal primer
(5'TGGAATTCATGGGCTGCAAAAACCTGCT) and a reverse primer
(5'TGGAATTCTCATTTGCACTGGTCCAAGT), which contain the ATG and
the stop codon, respectively, and an EcoRI recognition site.
Three cDNA clones of the genes, homologous with NIH-ecoR, were isolated. Restriction map and partial sequence analyses revealed the structural identities of the three clones (data not shown). The
cDNA of the ecoR homologue derived from F10 cells
(F10-ecoR; accession no. D67087) was highly homologous with
both its NIH 3T3 cell counterpart (NIH-ecoR), having 96%
amino acid identity, and the ecoR isolated from rat hepatoma
cells (21) (99% amino acid identity). The nucleotide
sequence of F10-ecoR cDNA predicted a 624-amino-acid
protein. The putative virus-binding site, Y-G-E (open circles, Fig.
1), of F10-ecoR was identical
to those of NIH-ecoR and rat ecoR isolated from
hepatoma cells. The greatest diversity was found in the amino acid
sequence 221-ENKSSPLCGNND-232, flanking the virus-binding site in the
third extracellular loop (boxed in Fig. 1). The amino acid sequence of
this region of F10-ecoR was identical to that of rat
ecoR isolated from hepatoma cells. The Y-G-E
amino acid sequence at position 235 to 237 of the NIH-EcoR protein
in the third extracellular loop has been demonstrated to be critical
for ensuring proper viral receptor function (1, 22). This
sequence of F10-ecoR is identical to that in
NIH-ecoR. Recent studies demonstrated that the two potential
sites for N-glycosylation in the third extracellular loop of EcoR
(arrowheads, Fig. 1) are glycosylated (9), and these
carbohydrate moieties interfere with virus binding in a combination of
several cell lines and viruses (6, 12, 18). Comparison of
the sequences of F10-ecoR and NIH-ecoR revealed
the existence of a 3-amino-acid sequence (S-P-L) between these two
potential sites for N-glycosylation of F10-EcoR, with two amino acid
substitutions (F to K and N to G) (Fig. 1). Therefore, the amino acid
substitutions between the two potential sites for N-glycosylation could
affect the tertiary structure around the virus-binding site, resulting
in a change in the capability of SU protein to bind receptor.

View larger version (8K):
[in this window]
[in a new window]
|
FIG. 1.
Alignment of deduced amino acid sequences of
F10-ecoR (F10), NIH-ecoR (NIH 3T3), and rat
ecoR isolated from hepatoma cells (rat hepatoma) in the
third extracellular loop domain (boxed). Conserved amino acids with
F10-ecoR are represented by dots. Arrowheads indicate
potential N-linked glycosylation sites. Potential membrane-spanning
domains present in mouse ecoR (2) are underlined.
Open circles indicate the amino acid sequence suggested to serve as the
viral binding site (1, 22).
|
|
Comparison of receptor activity of F10-EcoR and NIH-EcoR expressed
on SIRC cells.
To compare the contribution of F10-ecoR
gene and NIH-ecoR gene to viral proliferation in cells with
the same genetic background, F10-ecoR cDNA or
NIH-ecoR cDNA was introduced into rabbit cornea cell line
SIRC (11). Expression vectors containing NIH-ecoR cDNA (pJET) were provided by J. M. Cunningham, Harvard Medical School (2). F10-ecoR cDNA was inserted into the
pJAY3 (10) expression vector derived from pJET. These
plasmids were stably introduced into SIRC cells by cotransfection with
selectable plasmid pSTNeoB (8). RNA samples (20 µg each)
were electrophoresed through a formaldehyde gel, transferred to a
membrane, and hybridized to a 32P-labeled
PstI-HincII fragment (0.5 kb) of
NIH-ecoR cDNA (4, 16). Abundant expression of the
introduced genes was detected in transfected SIRC cells (Fig.
2). ecoR-related mRNA was not found in normal SIRC cells. We examined the interaction between the
viruses and the receptors expressed on SIRC cells by pseudotyped virus
infection. The relative infectivity of F10-ecoR-expressing SIRC cells against NIH-ecoR-expressing SIRC cells of
pseudo-A8 was 0.12, on average, for each experiment, whereas pseudo-57
exhibited fourfold-lower relative infectivities on
F10-ecoR-expressing SIRC cells (Table 1). To compare
the viral proliferation of A8 and 57, these viruses were inoculated
into 104 of the exogenous ecoR-expressing cells
on a 12-well culture plate, and then viral titers at 4 days
postinfection were determined by XC plaque assay on C182 cells
(15). At the same time, the number of cells on the 12-well
culture plates was determined by modified MTT assay with WST-1
(Dojindo) in accordance with the manufacturer's protocol
(7). Virus titers were normalized by cell number to compare
growth rates among different kinds of cells. In two clones of
F10-ecoR-expressing SIRC cells, virus titers of A8 were 129- and 360-fold higher than those of virus 57 at a multiplicity of
infection of 0.1 (Table 3). In
NIH-ecoR-expressing SIRC cell clones, virus 57 proliferated with the same efficiency as A8 (Table 3).

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 2.
Northern blot hybridization of SIRC cell clones after
the introduction of F10-ecoR cDNA or NIH-ecoR
cDNA. Expression vector containing 1.9 kb of F10-ecoR cDNA
or 2.3 kb of NIH-ecoR cDNA was introduced. Twenty micrograms
of total RNA was electrophoresed and transferred to a membrane. The
quality of the RNA was confirmed by visualization of ribosomal RNA on
membrane by using a UV lamp. A 32P-labeled
PstI-HincII fragment of NIH-ecoR cDNA
was used as a hybridization probe. Arrows indicate transfected
ecoR mRNA. The asterisk indicates endogenous ecoR
mRNA in NIH 3T3 cells.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Comparison of production of A8 and 57 in F10 cells, NIH
3T3 cells, and F10-ecoR- or NIH-ecoR-expressing
SIRC cells
|
|
Could a difference in receptor-mediated viral entry efficiency of 1 order of magnitude account for the final difference in
neuropathogenic
and nonneuropathogenic viral titers assayed at
4 days postinfection? As
shown in our previous work (
17), studies
with chimerae from
A8 and 57 demonstrated that at 4 days after
infection in F10 cells, the
production of Rec6, which contains
the
env gene of 57 against the background of the A8 gene, is 1
order of magnitude lower
than the A8 viral titer. Furthermore,
the reverse chimera to Rec6,
having A8-SU on the background of
virus 57, and designated Rec5, showed
a 1-order-of-magnitude increase
of viral production in F10 cells over
virus 57. These results
indicate that the interaction of the SU protein
and the receptor
is responsible for the increase or decrease of viral
production
by 1 order of magnitude. Since the LTR and/or 5' leader
sequence
of A8 have been shown to be indispensable for efficient viral
proliferation in F10 cells (
17), the proliferation of A8 in
F10 cells could be attributed to the velocity of proliferation
after
viral entry into cells facilitated by the LTR and/or 5'
leader sequence
of A8. Therefore, the difference in receptor utilization
between A8-SU
and 57-SU can only partially explain the distinct
viral proliferation
of A8 and 57 in F10 cells. The in vivo study
with chimerae revealed
that the LTR and/or 5' leader sequence
of A8 is more critical than the
structural difference in the SU
protein in A8 and 57 (
17)
for the proliferation of viruses in
the brains of rats at 6 to 10 weeks
postinfection. Based on the
present findings and on previous studies on
the proliferation
of chimerae in vitro and in vivo, we conclude that A8
and 57 recognize
the receptor in distinct manners; however, this
difference in
recognition would account only for 1 (that is, 1% at
most) of
a >3-order-of-magnitude difference in titer between the two
viruses
in the
CNS.
 |
ACKNOWLEDGMENTS |
We thank Keiko Wakabayashi for performing plasmid construction and
sequence analysis.
This work was supported in part by grants from the Science and
Technology Agency of Japan (13073-2125-14).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institute of
Life Science, Soka University, Tangi-cho 1-236, Hachioji, Tokyo
192-8577, Japan. Phone: (81)426-91-2375. Fax: (81)426-91-9315. E-mail:
takase{at}scc1.t.soka.ac.jp.
 |
REFERENCES |
| 1.
|
Albritton, L. M.,
J. W. Kim,
L. Tseng, and J. M. Cunningham.
1993.
Envelope-binding domain in the cationic amino acid transporter determines the host range of ecotropic murine retroviruses.
J. Virol.
67:2091-2096[Abstract/Free Full Text].
|
| 2.
|
Albritton, L. M.,
L. Tseng,
D. Scadden, and J. M. Cunningham.
1989.
A putative murine ecotropic retrovirus receptor gene encodes a multiple membrane-spanning protein and confers susceptibility to virus infection.
Cell
57:659-666[Medline].
|
| 3.
|
Aulak, K. S.,
J. Liu,
J. Wu,
S. L. Hyatt,
M. Puppi,
S. J. Henning, and M. Hatzoglou.
1996.
Molecular sites of regulation of expression of the rat cationic amino acid transporter gene.
J. Biol. Chem.
271:29799-29806[Abstract/Free Full Text].
|
| 4.
|
Chomczynski, P., and N. Sacchi.
1987.
Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:156-159[Medline].
|
| 5.
|
Dannenberg, A. M., Jr., and M. Suga.
1981.
Histochemical stains for macrophages in cell smears and tissue section: -galactosidase, acid phosphatase, nonspecific esterase, succinic dehydrogenase, and cytochrome oxidase, p. 375-396.
In
D. O. Adams, P. J. Edelson, and M. S. Koren (ed.), Methods for studying mononuclear phagocytes. Academic Press, New York, N.Y.
|
| 6.
|
Eiden, M. V.,
K. Farrell, and C. A. Wilson.
1994.
Glycosylation-dependent inactivation of the ecotropic murine leukemia virus receptor.
J. Virol.
68:626-631[Abstract/Free Full Text].
|
| 7.
|
Ishiyama, M.,
M. Shiga,
K. Sasamoto,
M. Mizoguchi, and P. He.
1993.
A new sulfonated tetrazolium salt that produces a highly water-soluble formazan dye.
Chem. Pharm. Bull.
41:1118-1122.
|
| 8.
|
Katoh, K.,
Y. Takahashi,
S. Hayashi, and H. Kondoh.
1987.
Improved mammalian vectors for high expression of G418 resistance.
Cell Struct. Funct.
12:575-580[Medline].
|
| 9.
|
Kim, J. W., and J. M. Cunningham.
1993.
N-linked glycosylation of the receptor for murine ecotropic retroviruses is altered in virus-infected cells.
J. Biol. Chem.
268:16316-16320[Abstract/Free Full Text].
|
| 10.
|
Land, H.,
A. C. Chen,
J. P. Morgenstern,
L. F. Parada, and R. A. Weinberg.
1986.
Behavior of myc and ras oncogenes in transformation of rat embryo fibroblasts.
Mol. Cell. Biol.
6:1917-1925[Abstract/Free Full Text].
|
| 11.
|
Leerhoy, J.
1965.
Cytopathic effect of rubera virus in a rabbit-cornea cell line.
Science
149:633-634[Abstract/Free Full Text].
|
| 12.
|
Masuda, M.,
M. Masuda,
C. A. Hanson,
P. M. Hoffman, and S. K. Ruscetti.
1996.
Analysis of the unique hamster cell tropism of ecotropic murine leukemia virus PVC-211.
J. Virol.
70:8534-8539[Abstract].
|
| 13.
|
Oliff, A. I.,
G. L. Hanger,
E. H. Chang,
E. M. Scolnick,
H. W. Chan, and D. R. Lowy.
1980.
Transfection of molecularly cloned Friend murine leukemia virus DNA yields a high leukemogenic helper-independent type C virus.
J. Virol.
33:475-486[Abstract/Free Full Text].
|
| 14.
|
Price, J.,
D. Turner, and C. Cepko.
1987.
Lineage analysis in the vertebrate nervous system by retrovirus-mediated gene transfer.
Proc. Natl. Acad. Sci. USA
84:156-160[Abstract/Free Full Text].
|
| 15.
|
Rowe, W. P.,
W. E. Pugh, and J. W. Hartley.
1970.
Plaque assay techniques for murine leukemia viruses.
Virology
42:1136-1139[Medline].
|
| 16.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 17.
|
Takase-Yoden, S., and R. Watanabe.
1997.
Unique sequence and lesional tropism of a new variant of neuropathogenic Friend murine leukemia virus.
Virology
233:411-422[Medline].
|
| 18.
|
Wang, H.,
E. Klamo,
S. E. Kuhmann,
S. L. Kozak,
M. P. Kavanaugh, and D. Kabat.
1996.
Modulation of ecotropic murine retroviruses by N-linked glycosylation of the cell surface receptor/amino acid transporter.
J. Virol.
70:6884-6891[Abstract/Free Full Text].
|
| 19.
|
Watanabe, R., and S. Takase-Yoden.
1995.
Gene expression of neurotropic retrovirus in the CNS.
Prog. Brain Res.
105:255-262[Medline].
|
| 20.
|
Wiley, C. A., and M. Gardner.
1993.
The pathogenesis of murine retroviral infection of the central nervous system.
Brain Pathol.
3:123-128[Medline].
|
| 21.
|
Wu, J. Y.,
D. Robinson,
H. J. Kung, and M. Hatzoglou.
1994.
Hormonal regulation of the gene for the type C ecotropic retrovirus receptor in rat liver cells.
J. Virol.
68:1615-1623[Abstract/Free Full Text].
|
| 22.
|
Yoshimoto, T.,
E. Yoshimoto, and D. Meruelo.
1993.
Identification of amino acid residues critical for infection with ecotropic murine leukemia retrovirus.
J. Virol.
67:1310-1314[Abstract/Free Full Text].
|
Journal of Virology, May 1999, p. 4461-4464, Vol. 73, No. 5
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Yoshii, H., Kamiyama, H., Amanuma, H., Oishi, K., Yamamoto, N., Kubo, Y.
(2008). Mechanisms underlying glycosylation-mediated loss of ecotropic receptor function in murine MDTF cells and implications for receptor evolution. J. Gen. Virol.
89: 297-305
[Abstract]
[Full Text]
-
Komano, J., Miyauchi, K., Matsuda, Z., Yamamoto, N.
(2004). Inhibiting the Arp2/3 Complex Limits Infection of Both Intracellular Mature Vaccinia Virus and Primate Lentiviruses. Mol. Biol. Cell
15: 5197-5207
[Abstract]
[Full Text]
-
Kubo, Y., Ishimoto, A., Amanuma, H.
(2003). N-Linked Glycosylation Is Required for XC Cell-Specific Syncytium Formation by the R Peptide-Containing Envelope Protein of Ecotropic Murine Leukemia Viruses. J. Virol.
77: 7510-7516
[Abstract]
[Full Text]
-
Takase-Yoden, S., Watanabe, R.
(2001). Distribution of ecotropic retrovirus receptor protein in rat brains detected by immunohistochemistry. J. Gen. Virol.
82: 1815-1820
[Abstract]
[Full Text]
-
Ikeda, H., Kato, K., Suzuki, T., Kitani, H., Matsubara, Y., Takase-Yoden, S., Watanabe, R., Kitagawa, M., Aizawa, S.
(2000). Properties of the Naturally Occurring Soluble Surface Glycoprotein of Ecotropic Murine Leukemia Virus: Binding Specificity and Possible Conformational Change after Binding to Receptor. J. Virol.
74: 1815-1826
[Abstract]
[Full Text]