TEXT

Top Abstract Text References

A neuropathogenic variant of Friend murine leukemia virus (FrMLV), FrC6 virus clone A8, induced spongiform degeneration in the brains of infected rats (17, 19). Studies with chimerae constructed from A8 virus and nonneuropathogenic FrMLV clone 57 (13) revealed that the env gene of A8 is a primary determinant for the induction of neurodegeneration and that the long terminal repeat (LTR) and/or 5' leader sequence of A8 is also necessary for neuropathogenicity (17). Although the mechanism of induction of spongiform degeneration in brain by retrovirus infection is still not understood, it is speculated that the interaction between the env gene product of neuropathogenic virus and the viral receptor or other substances is critical for neuropathogenicity (20).

The A8 virus replicates efficiently in rat glial cell line F10. In contrast, the 57 virus is not very infective in F10 cells, but in NIH 3T3 cells, both 57 and A8 proliferate efficiently (17). Studies on A8 and 57 chimerae revealed that the determinants for proliferation in F10 cells are the env gene and the LTR and/or 5' leader sequence of A8, but how much each gene contributes to viral production in F10 cells is not clear. Efficient viral replication in F10 cells is necessary for neuropathological manifestation in rats infected with chimerae (17). The proliferation in the central nervous system (CNS) in vivo of their chimerae and of the parental viruses A8 and 57 showed good correlation with viral production in F10 cells in vitro. Therefore, F10 cells and the A8 virus are a suitable model for analysis of the interaction between SU protein and the receptor connected with viral proliferation in CNS cells and neuropathogenicity.

Efficiency of receptor-mediated viral entry into F10 and NIH 3T3 cells. To examine receptor-virus interaction, we used an assay for receptor-mediated cell entry with pseudotyped retroviruses incorporating A8-SU (pseudo-A8) or 57-SU (pseudo-57), which transfer the -galactosidase gene. Retrovirus vector, BAG, bearing -galactosidase and neomycin resistance gene provided by C. Cepko, Harvard Medical School (14), was stably introduced into NIH 3T3 cells. Then, expression vectors containing the A8 env gene or the 57 env gene were stably introduced into the BAG-introduced NIH 3T3 cells by cotransfection with an expression vector for gag-pol of the A8 virus bearing the blasticidin deaminase (BSD) gene. Pseudo-A8 and pseudo-57 were inoculated to 2 × 10⁴ of F10 or NIH 3T3 cells on a 12-well culture plate in the presence of 10 µg of Polybrene per ml, and the numbers of -galactosidase-positive cells were compared. For 5-bromo-4-chloro-3-indolyl -D-galactoside (X-Gal) visualization of -galactosidase activity in intact cells, the method of Dannenberg and Suga (5) was used, following fixation in 4% paraformaldehyde for 5 min and then fixation in 2% formaldehyde-0.2% glutaraldehyde for 10 min. Relative infectivity of F10 cells to NIH 3T3 cells was compared for pseudo-A8 or pseudo-57, since titers of individual virus preparations differed for each experiment. Pseudo-A8 gave F10/NIH relative infectivities of 0.17 on average, whereas pseudo-57 exhibited relative titers of 1 order of magnitude lower (Table 1). These results indicate that the viruses recognized EcoR on F10 cells as distinct from that on NIH 3T3 cells. The efficiency of receptor-mediated viral entry varied in rat cell lines derived from different tissues. In lymph node-derived cells (LYM-1) as well as in F10 cells, A8 had a higher efficiency of entry than that of 57, indicating that the efficient utilization of rat EcoR by A8 is not restricted to glial cells (Table 2). In liver-derived cells (ARLJ301-3), the efficiency of entry of 57 was similar to that of A8 (Table 2). Whole rat ecoR cDNAs have been isolated from hepatoma cells and intestinal cells (3, 21). The third extracellular loop domain, containing the virus-binding site of these gene products, is identical to that of the ecoR gene on F10 cells (described later). Therefore, posttranslational modifications of ecoR, such as glycosylation, numbers of EcoR molecules on cells, or cofactors other than the receptor, might account for differences in efficiency of viral entry in each cell line.

Isolation and sequence analysis of ecotropic murine leukemia virus receptor cDNA from F10 cells. We cloned the ecoR gene from F10 cells to compare it with the ecoR gene derived from NIH 3T3 cells. Total RNA (4) was extracted from F10 cells, and first-strand DNA was synthesized by a reaction with the SuperScript preamplification system for the first-strand cDNA synthesis kit (GibcoBRL) with an oligonucleotide deoxyribosylthymine primer, in accordance with the manufacturer's protocol. Second-strand DNA was synthesized by PCR with a universal primer (5'TGGAATTCATGGGCTGCAAAAACCTGCT) and a reverse primer (5'TGGAATTCTCATTTGCACTGGTCCAAGT), which contain the ATG and the stop codon, respectively, and an EcoRI recognition site. Three cDNA clones of the genes, homologous with NIH-ecoR, were isolated. Restriction map and partial sequence analyses revealed the structural identities of the three clones (data not shown). The cDNA of the ecoR homologue derived from F10 cells (F10-ecoR; accession no. D67087) was highly homologous with both its NIH 3T3 cell counterpart (NIH-ecoR), having 96% amino acid identity, and the ecoR isolated from rat hepatoma cells (21) (99% amino acid identity). The nucleotide sequence of F10-ecoR cDNA predicted a 624-amino-acid protein. The putative virus-binding site, Y-G-E (open circles, Fig. 1), of F10-ecoR was identical to those of NIH-ecoR and rat ecoR isolated from hepatoma cells. The greatest diversity was found in the amino acid sequence 221-ENKSSPLCGNND-232, flanking the virus-binding site in the third extracellular loop (boxed in Fig. 1). The amino acid sequence of this region of F10-ecoR was identical to that of rat ecoR isolated from hepatoma cells. The Y-G-E amino acid sequence at position 235 to 237 of the NIH-EcoR protein in the third extracellular loop has been demonstrated to be critical for ensuring proper viral receptor function (1, 22). This sequence of F10-ecoR is identical to that in NIH-ecoR. Recent studies demonstrated that the two potential sites for N-glycosylation in the third extracellular loop of EcoR (arrowheads, Fig. 1) are glycosylated (9), and these carbohydrate moieties interfere with virus binding in a combination of several cell lines and viruses (6, 12, 18). Comparison of the sequences of F10-ecoR and NIH-ecoR revealed the existence of a 3-amino-acid sequence (S-P-L) between these two potential sites for N-glycosylation of F10-EcoR, with two amino acid substitutions (F to K and N to G) (Fig. 1). Therefore, the amino acid substitutions between the two potential sites for N-glycosylation could affect the tertiary structure around the virus-binding site, resulting in a change in the capability of SU protein to bind receptor.

View larger version (8K): [in this window] [in a new window]   FIG. 1.   Alignment of deduced amino acid sequences of F10-ecoR (F10), NIH-ecoR (NIH 3T3), and rat ecoR isolated from hepatoma cells (rat hepatoma) in the third extracellular loop domain (boxed). Conserved amino acids with F10-ecoR are represented by dots. Arrowheads indicate potential N-linked glycosylation sites. Potential membrane-spanning domains present in mouse ecoR (2) are underlined. Open circles indicate the amino acid sequence suggested to serve as the viral binding site (1, 22).

Comparison of receptor activity of F10-EcoR and NIH-EcoR expressed on SIRC cells. To compare the contribution of F10-ecoR gene and NIH-ecoR gene to viral proliferation in cells with the same genetic background, F10-ecoR cDNA or NIH-ecoR cDNA was introduced into rabbit cornea cell line SIRC (11). Expression vectors containing NIH-ecoR cDNA (pJET) were provided by J. M. Cunningham, Harvard Medical School (2). F10-ecoR cDNA was inserted into the pJAY3 (10) expression vector derived from pJET. These plasmids were stably introduced into SIRC cells by cotransfection with selectable plasmid pSTNeoB (8). RNA samples (20 µg each) were electrophoresed through a formaldehyde gel, transferred to a membrane, and hybridized to a ³²P-labeled PstI-HincII fragment (0.5 kb) of NIH-ecoR cDNA (4, 16). Abundant expression of the introduced genes was detected in transfected SIRC cells (Fig. 2). ecoR-related mRNA was not found in normal SIRC cells. We examined the interaction between the viruses and the receptors expressed on SIRC cells by pseudotyped virus infection. The relative infectivity of F10-ecoR-expressing SIRC cells against NIH-ecoR-expressing SIRC cells of pseudo-A8 was 0.12, on average, for each experiment, whereas pseudo-57 exhibited fourfold-lower relative infectivities on F10-ecoR-expressing SIRC cells (Table 1). To compare the viral proliferation of A8 and 57, these viruses were inoculated into 10⁴ of the exogenous ecoR-expressing cells on a 12-well culture plate, and then viral titers at 4 days postinfection were determined by XC plaque assay on C182 cells (15). At the same time, the number of cells on the 12-well culture plates was determined by modified MTT assay with WST-1 (Dojindo) in accordance with the manufacturer's protocol (7). Virus titers were normalized by cell number to compare growth rates among different kinds of cells. In two clones of F10-ecoR-expressing SIRC cells, virus titers of A8 were 129- and 360-fold higher than those of virus 57 at a multiplicity of infection of 0.1 (Table 3). In NIH-ecoR-expressing SIRC cell clones, virus 57 proliferated with the same efficiency as A8 (Table 3).

View larger version (71K): [in this window] [in a new window]   FIG. 2.   Northern blot hybridization of SIRC cell clones after the introduction of F10-ecoR cDNA or NIH-ecoR cDNA. Expression vector containing 1.9 kb of F10-ecoR cDNA or 2.3 kb of NIH-ecoR cDNA was introduced. Twenty micrograms of total RNA was electrophoresed and transferred to a membrane. The quality of the RNA was confirmed by visualization of ribosomal RNA on membrane by using a UV lamp. A 32P-labeled PstI-HincII fragment of NIH-ecoR cDNA was used as a hybridization probe. Arrows indicate transfected ecoR mRNA. The asterisk indicates endogenous ecoR mRNA in NIH 3T3 cells.