Previous Article | Next Article 
Journal of Virology, May 1999, p. 4251-4256, Vol. 73, No. 5
Retroviral Genetics Section, ABL-Basic
Research Program, National Cancer Institute-Frederick Cancer Research
and Development Center, Frederick, Maryland
21702,1 and Unité Propre de
Recherche du CNRS no. 9002, Institut de Biologie Moleculaire et
Cellulaire (IBMC), 67084 Strasbourg Cedex, France2
Received 11 November 1998/Accepted 13 February 1999
The formation of an infectious retrovirus particle requires several
RNA-RNA interaction events. In particular, the genomic RNA molecules
form a dimeric structure, and a cellular tRNA molecule is annealed to
an 18-base complementary region (the primer binding site, or PBS) on
the genomic RNA, where it will serve as primer for reverse
transcription. tRNAs normally possess a highly stable secondary and
tertiary structure; it seems unlikely that annealing of a tRNA molecule
to the PBS, which involves unwinding of this structure, could occur
efficiently at physiological temperatures without the assistance of a
cofactor. Many prior studies have shown that the viral nucleocapsid
(NC) protein can act as a nucleic acid chaperone (i.e., facilitate
annealing events between nucleic acids), and the assays used to
demonstrate this activity include its ability to catalyze dimerization
of transcripts representing retroviral genomes and the annealing of
tRNA to the PBS in vitro. However, mature NC is not required for these
events in vivo, since protease-deficient viral mutants, in which NC is
not cleaved from the parental Gag polyprotein, are known to contain
dimeric RNAs with tRNA annealed to the PBS. In the present experiments,
we have tested recombinant human immunodeficiency virus type 1 Gag polyprotein for nucleic acid chaperone activity. The protein was positive by all of our assays, including the ability to stimulate dimerization and to anneal tRNA to the PBS in vitro. In quantitative experiments, its activity was approximately equivalent on a molar basis
to that of NC. Based on these results, we suggest that the Gag
polyprotein (presumably by its NC domain) catalyzes the annealing of
tRNA to the PBS during (or before) retrovirus assembly in vivo.
A single viral protein, the Gag
polyprotein, is sufficient for assembly of retrovirus particles in
cells of higher eukaryotes. Normally, after the particle is released
from the cell, the polyprotein is cleaved by the virus-coded protease
(PR), liberating a series of cleavage products. This series of cleavage
events causes a major structural reorganization of the particle called
maturation; PR-deficient particles, in which Gag is not cleaved, are
termed immature particles (reviewed in reference
10).
Among the molecular events which occur during virus assembly and
maturation are several instances of RNA-RNA interaction, including the
formation of a dimer from two identical, plus-strand molecules of
genomic RNA; maturation or condensation of the dimer to a more compact,
more thermostable dimer; and placement of a cellular tRNA molecule at a
specific site, the primer binding site (PBS), on the genomic RNA, where
it will serve as the primer for viral DNA synthesis by reverse
transcriptase when the particle infects a new host cell (reviewed in
reference 10). It seems likely that some or all of
these RNA-RNA interactions are facilitated by viral or cellular
cofactors. In particular, it appears extremely improbable that the
primer tRNA could spontaneously bind to the PBS with high efficiency
under physiological conditions. This binding involves the annealing of
the 18 3' nucleotides of the tRNA to the PBS (to which they are
complementary) and additional interactions between other regions of the
tRNA and other sites in the genomic RNA (2, 24, 27); thus,
formation of this complex requires the disruption of the normal
secondary and tertiary structure of the tRNA.
What is the identity of this putative cofactor? In fact, a virus-coded
protein, termed nucleocapsid (NC), is an obvious candidate, since it is
capable of facilitating all of these RNA-RNA interactions in vitro
(12). NC is one of the products formed as a result of
cleavage of the Gag polyprotein during virus maturation. NC proteins
are small, basic proteins which bind single-stranded nucleic acids in
vitro and are associated with the genomic RNA in the interior of mature
retrovirus particles. They have been shown to possess nucleic acid
chaperone activity in a wide variety of assays; that is, they catalyze
the conformational rearrangement of nucleic acids into optimally
base-paired structures. The molecular mechanism of this effect is not
well understood, but NC presumably acts by lowering the energy barrier
for breakage and reformation of base pairs. Recent evidence strongly
suggests that this activity gives NC a crucial accessory role during
the reverse transcription of retroviral RNA into DNA (reviewed in
references 12 and 31).
Further evidence supporting the idea that NC assists in the placement
of tRNA on the PBS in vivo is the fact that mutations in the NC coding
region prevent the placement of the primer tRNA on the PBS in packaged
viral RNA (22, 30).
On the other hand, well-documented biological observations are
difficult to reconcile with the hypothesis that the mature NC protein
performs these functions in vivo. In particular, immature retrovirus
particles, in which NC is not formed from the Gag polyprotein because
of a defect in PR, contain dimeric RNA (16, 18, 32). Further, primer tRNA is annealed to the PBS on these genomic RNA molecules (11, 17, 23, 32).
One hypothesis which is consistent with all of these observations is
that the retroviral Gag polyprotein, like the NC protein derived from
it by proteolytic cleavage, possesses nucleic acid chaperone activity.
The present experiments have tested this possibility, and we now report
that recombinant human immunodeficiency virus type 1 (HIV-1) Gag
polyprotein indeed exhibits nucleic acid chaperone activity. The data
presented here show that this protein is able to catalyze both the
dimerization of transcripts containing HIV-1 genomic sequences and the
annealing of primer tRNA to the PBS in vitro. In view of these results,
we suggest that Gag catalyzes these two events in vivo, probably during
assembly of the retrovirus particle.
Reagents.
The production of recombinant HIV-1 Gag
polyprotein and of Gag polyprotein lacking the p6 domain (Gag
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The Human Immunodeficiency Virus Type 1 Gag
Polyprotein Has Nucleic Acid Chaperone Activity: Possible Role in
Dimerization of Genomic RNA and Placement of tRNA on the Primer
Binding Site
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
p6)
have been described previously (7). Briefly, the coding
regions from the BH10 isolate of HIV-1 were expressed by using the pET
3xc vector. Some experiments used proteins with two point mutations,
viz., A37V and Q63D, but control experiments indicated that these
differences from the wild-type sequence did not affect the results of
our studies. The two polyproteins were purified as previously described
for derivatives of the Gag protein of Rous sarcoma virus
(8); in addition, the full-length protein was purified with
an affinity column containing rabbit antibodies against the 21 C-terminal amino acids of Gag. We estimate, based on inspection of
Coomassie blue-stained sodium dodecyl sulfate (SDS)-polyacrylamide
gels, that the proteins were 
90% pure. One microgram of Gagp6
corresponds to 20 pmol of the protein.
Selective annealing of oligonucleotides. Selective annealing experiments were performed exactly as described by Tsuchihashi and Brown (34), except that the sequences of the oligonucleotides were slightly altered: the labeled oligonucleotide was 5'GACTAAAAAAAAATCTCTAGCAGTGCAT3', and the two competing oligonucleotides were 5'ATGCACTGCTAGAGATTTTTTTTTAGTC3' (28-base perfect match) and 5'ACTGCTAGAGATTTTTTTTTT3' (21-base oligonucleotide, which can form 20 base pairs with the labeled oligonucleotide). This change in sequence had no detectable effect on the outcome of selective annealing experiments with NC protein (data not shown). Briefly, 20 fmol of the labeled oligonucleotide was mixed with 20 fmol of the complementary 28-base oligonucleotide and 1 pmol of the complementary 21-base oligonucleotide, along with the protein being tested, in 10 µl of 50 mM Tris (pH 7.9)-1 mM EDTA-3 mM MgCl2-1 mM dithiothreitol-0.1% Triton X-100-0.2 µg of BSA/ml. After incubation as indicated, the reactions were terminated by the addition of SDS (final concentration, 2%), extracted with phenol, and analyzed by electrophoresis in 15% polyacrylamide and by autoradiography.
RNA-RNA annealing.
The ability of proteins to stimulate the
annealing of complementary RNA molecules was assayed as follows. A
205-base RNA molecule, consisting of nucleotides 34 to 180 of the sense
strand of the Neor-encoding open reading frame plus 58 vector nucleotides, was synthesized by using T7 RNA polymerase in the
presence of [
-32P]CTP. The second RNA, also
synthesized with T7 RNA polymerase, was 833 nt long, consisting of the
antisense strand of the Neor-encoding open reading frame
from residues 790 to 34, plus 76 residues from the 3' untranslated
region of the gene. Twenty fmol of the first RNA were mixed with 200 femtomol of the second in 10 µl of 5 mM NaCl-0.1 mM EDTA-10 mM Tris
[pH 8.0]-0.1 M 
-mercaptoethanol-0.2 µg of bovine serum albumin
(BSA) (New England Biolabs)-8 U of RNasin (Promega)/µl. Each tube
thus contained a total of ~57 ng of RNA. The RNAs were first
denatured by heating the mixture to 90°C for 5 min and chilling it on
ice. Proteins were then added to the mixture as indicated, and the
reactions were incubated at 0°C. (Incubation of these reactions at
37°C frequently resulted in aggregation of the RNA samples in the
presence of NC). After incubation times as indicated, the reactions
were terminated by the addition of 2 µl 10% SDS and 10 µl
H2O, followed by extraction with phenol-CHCl3
(1:1) and analysis by electrophoresis in agarose under nondenaturing
conditions and by autoradiography.
Dimerization of HIV-1 RNA.
An RNA transcript representing nt
1 to 331 of the NL4-3 clone of HIV-1 (1) was synthesized by
T7 RNA polymerase in the presence of [-32P]CTP. The
transcript was purified on a G-50 spun column (Stratagene) and by
electrophoresis in polyacrylamide. For dimerization, 1.5 µg of RNA
was heated in water to 85°C for 2 min and chilled on ice. It was then
incubated in 20 µl of 250 mM NaCl-5 mM MgCl2-20 mM Tris
(pH 7.0) at 37°C for 3 h, in the presence of NC or Gag. The RNAs
were then treated with 2% SDS, extracted with phenol, and analyzed by
electrophoresis through 2.5% Metaphor (FME) under nondenaturing
conditions and by autoradiography.
Stabilization of dimers of HaSV RNA. The thermostability of dimers of HaSV 34-378 RNA was assessed as described previously (13), except that in some experiments the dimers were formed in the presence of Gag, NC, or BSA rather than being formed first and then treated with the proteins. Briefly, labeled RNA was allowed to dimerize by incubation for 30 min at 37°C in 0.25 M NaCl-1 mM MgCl2-0.01 M Tris (pH 7.0). After deproteinization by phenol extraction, it was then microdialyzed into 0.05 M NaCl-1 mM EDTA-0.01 M Tris (pH 7.0). The thermostabilities of the dimers were then determined by incubating them for 10 min at the indicated temperatures and analyzing them by electrophoresis in agarose, followed by autoradiography.
Placement of tRNA3Lys on PBS of HIV-1 RNA.
Purified tRNA3Lys was labeled at its 5' end by
incubation with T4 polynucleotide kinase (Boehringer Mannheim) and
[
-32P]ATP. The labeled tRNA was repurified by
electrophoresis in a polyacrylamide gel. After elution from the gel, it
was precipitated with ethanol and redissolved in water. Unlabeled RNA
transcripts representing nt 1 to 331 of the NL4-3 clone of HIV-1 or nt
34 to 378 of HaSV were synthesized using T7 or SP6 RNA polymerase, respectively. The transcripts were heated to 85°C in water and placed
on ice. Fifty nanograms of radioactive tRNA was mixed with 250 ng of
transcript in 20 µl of 50 mM NaCl-5 mM MgCl2-20 mM Tris (pH 7.0) in the presence or absence of Gagp6 protein. After
incubation for 30 min at 37°C, the samples were deproteinized and
analyzed as in the dimerization experiments (see above).
Extension of tRNA3Lys with reverse transcriptase
after annealing to PBS of HIV-1 RNA.
Two hundred fifty nanograms
of an RNA transcript representing nucleotides 1 to 331 of pNL4-3 HIV-1
was heated to 100°C and placed on ice. It was then mixed with 50 ng
of unlabeled tRNA3Lys in 20 µl of 250 mM NaCl-1 mM
MgCl2-10 mM Tris (pH 7.0). After incubation for 60 min at
37°C in the presence or absence of Gagp6 protein, the mixture was
deproteinized by treatment with 2% SDS and phenol extraction. After
ethanol precipitation, the RNAs were redissolved in 20 µl of 75 mM
KCl-5 mM MgCl2-0.1 mM dithiothreitol-50 mM Tris (pH 7.5)
containing 57 U of HIV-1 reverse transcriptase (Worthington) and 0.1 mM
(each) deoxynucleoside triphosphate (dNTP), including 1 µCi of
[-32P]dCTP (Amersham). After 30 min at 37°C, 27 additional U of reverse transcriptase was added and the incubation was
continued for 30 min more. The reaction mixture was then heated to
85°C for 5 min and digested for 60 min at 37°C with 20 µg of
pancreatic RNase (Boehringer Mannheim) and 8 U of RNase H (Stratagene).
The digest was then extracted with phenol, and the DNA was purified
with a G-50 spun column (Boehringer Mannheim). Finally, the product was
analyzed by electrophoresis on a 15% polyacrylamide gel in the
presence of 7 M urea, followed by autoradiography.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Selective annealing of oligodeoxynucleotides. The nucleic acid chaperone activity of NC protein has previously been demonstrated by the selective annealing of oligonucleotides (34). In this assay, a radioactively labeled 28-base oligodeoxynucleotide is mixed with two other oligodeoxynucleotides. Both of these oligonucleotides are complementary to the labeled oligonucleotide, but one is a 28-base, completely complementary molecule, while the other is shorter and can form only 20 base pairs with the labeled oligonucleotide. The shorter of these two molecules is in 50-fold excess over the longer one; therefore, the less stable hybrid which can form in this mixture is kinetically favored over the more stable one. As previously shown by Tsuchihashi and Brown (34), labeled oligonucleotide is found annealed to the shorter complementary oligonucleotide if the mixture is incubated in the absence of NC but is annealed to the longer oligonucleotide if NC is present. This shift presumably reflects the ability of NC to destabilize the 20-bp hybrid, enabling the labeled DNA strand to enter into the more stable, 28-bp hybrid.
We tested the ability of HIV-1 Gagp6 polyprotein to promote the
selective formation of the more stable hybrid in this assay. As shown
in Fig. 1A, incubation with Gag p6 at
37°C did cause the labeled oligonucleotide to shift from the
kinetically favored, 20-bp hybrid to the thermodynamically favored
28-bp hybrid; in fact, analysis of the data (Fig. 1B) indicated that
the activities of the polyprotein and of NC in this assay were, on a
molar basis, indistinguishable.
|
Annealing of complementary RNA molecules. We also tested the ability of the Gag polyprotein to stimulate the annealing of complementary RNAs. These RNA molecules were transcripts of portions of the Neor gene. Figure 2 (lanes 8 and 9) shows that in the presence of Gag, a large fraction of the labeled RNA (although less than in the sample incubated with NC) was hybridized to the complementary strand, while under these conditions no detectable hybrid was formed in the absence of Gag.
|
Dimerization of retroviral RNAs in the presence of Gag. As originally demonstrated by Darlix and coworkers (12, 29), RNA transcripts containing sequences from the 5' portion of a retroviral genome can form dimers in vitro, even in the absence of any added proteins or other macromolecular cofactors. However, as noted above, NC has been shown to accelerate this dimerization process in vitro (12). We tested the ability of the Gag polyprotein to promote the dimerization of RNA molecules consisting of nt 1 to 331 of the HIV-1 genome, using a low RNA concentration at which there was virtually no spontaneous dimerization during the incubation period. As shown in Fig. 3, this RNA was converted to a dimeric structure in the presence of Gag; the amount of Gag required for this effect, ~0.8 µg (lane 14), was equivalent in molar terms to the level of NC (~0.1 µg) (lane 5) which exerted a similar effect.
|
Stabilization of a dimer of retroviral RNA by Gag. The genomic RNA in an immature retrovirus particle is dimeric. However, during maturation of the particle, the dimer is converted to a more thermostable dimeric structure (16, 18, 33). We previously described conditions in which a 345-base transcript of HaSV RNA formed dimers in vitro, but some of these dimers were relatively thermolabile. Incubation of these preparations of dimeric RNA with recombinant HIV-1 NC was shown to convert the thermolabile dimers into more stable dimers; this conversion thus appeared to replicate, in a defined system in vitro, the stabilization of dimeric RNAs which occurs during the maturation of a retrovirus particle (13).
We also tested the ability of the HIV-1 Gag polyprotein to induce this stabilization in dimers of HaSV transcripts. Figure 4 shows the results of this experiment. As can be seen, the dissociation profile of the dimers after exposure to the Gagp6 polyprotein (lanes 15 to 21), like that seen after
exposure to NC (lanes 8 to 14), showed that the dimers were uniformly
dissociated between 55 and 65°C; in contrast, controls incubated with
BSA (lanes 1 to 7) were a mixture in which some molecules dissociated
between 25 and 37°C, and others were stable to a temperature between
55 and 65°C. Thus, the Gag polyprotein is evidently able to induce the stabilization of dimers of retroviral RNAs in vitro. Moreover, its
activity per mole appears to be at least as high as that of NC in this
assay, since NC and Gag were equimolar in these experiments and since
the dose of NC is only slightly more than sufficient for full
stabilization of the dimers (13).
|
Placement of tRNA3Lys on the PBS by Gag.
Finally, we also tested the ability of the Gagp6 polyprotein to
anneal tRNA3Lys to the PBS on transcripts of the HIV-1
genome. We used natural tRNA3Lys, rather than tRNA
produced by transcription in vitro, since the posttranscriptional
modifications in natural tRNA play a significant role in the
interaction of the primer with the PBS (25). As shown in
Fig. 5A, incubation of labeled
tRNA3Lys with RNA molecules representing nt 1 to 331 of
HIV RNA, together with Gagp6, caused a shift of radioactive tRNA to
a high-molecular-weight complex (lanes 3 and 4). This shift was not
observed in the absence of Gagp6 (lane 5) and reflected a true
annealing reaction, rather than aggregation of the RNAs, since it was
also not seen in a control reaction in which the tRNA was incubated
with a 345-base HaSV transcript, which contains a PBS complementary to
tRNAPro rather than tRNA3Lys, in place of
the HIV transcript (lane 2). In other experiments (data not shown),
there was no shift of the labeled tRNA into a complex with the HaSV
RNA, even when the latter was present at a fourfold-higher level than
that of HIV-1 RNA used in these experiments.
|
-32P]dCTP, to the reaction
mixtures. The products were then digested with RNase and analyzed by
polyacrylamide gel electrophoresis and autoradiography. As shown in
Fig. 5B (lane 4), a major DNA product was seen at ~182 nucleotides in
the reaction mixture containing HIV-1 RNA, tRNA3Lys,
and Gagp6. This product corresponds to minus-strand strong stop DNA.
(Higher-molecular-weight products were also observed in this lane;
these products presumably arise by self-priming of DNA synthesis from
the minus-strand strong stop DNA [20, 26]). These
three reactants are all required for the synthesis of significant
amounts of DNA under these conditions, since very little product was
observed if any of them was omitted (lanes 1 to 3). The formation of a
DNA product of the correct size is strong evidence that Gagp6
faithfully anneals the natural primer molecule to the PBS under our in
vitro conditions.
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
The basic conclusion which can be drawn from the results presented here is that the HIV-1 Gag polyprotein, like its cleavage product NC, exhibits nucleic acid chaperone activity. That is, it is capable of catalyzing the rearrangement of nucleic acid molecules into the conformation with the maximum number of base pairs. As discussed below, these results support the suggestion that in vivo, the Gag polyprotein catalyzes the dimerization of the genomic RNA of the virus and the placement of the primer tRNA on the PBS, probably during assembly of the virion.
It is striking to note that the Gag polyprotein is evidently capable of exquisitely specific interaction with RNA, i.e., selection of the genomic RNA for packaging during virus assembly in vivo (reviewed in reference 5), and also of nonspecific interactions, as demonstrated here by the nucleic acid chaperone activity observed with nonviral RNA substrates (Fig. 1 and 2). Gag resembles NC in this respect, since NC also exhibits profound sequence preferences in binding to DNA or RNA (3-5, 15) but displays nucleic acid chaperone activity in a wide variety of assays with nonviral substrates (12, 21, 31). Remarkably, still another outcome of the interaction between Gag and nucleic acid molecules is the assembly of minute virus-like particles in vitro, which occurs with short oligodeoxynucleotides as well as larger RNA molecules and shows almost no sequence dependence (7). It is conceivable that these structures formed during some of the experiments described above.
In some of the nucleic acid chaperone assays presented here, it was
possible to make a direct comparison between the dose-response curve of
the Gag polyprotein and that of NC. It was found that the two proteins
have very similar activities per mole in these assays (Fig. 1 and 3).
Thus, the NC domain of the Gag polyprotein, which is near the C
terminus of the polyprotein (and only 16 residues from the C terminus
of Gagp6, which was used in many of these experiments), probably
functions as a nucleic acid chaperone independently of the remainder of
the polyprotein.
What is the biological significance of the nucleic acid chaperone activity of Gag? Analysis of protease-deficient, immature virions, in which the Gag polyprotein is not cleaved, shows that they contain dimers of genomic RNA (16, 18, 32) and that the primer tRNA is annealed to the PBS on this RNA (11, 17, 23, 32). Thus, cleavage of the polyprotein, which releases NC protein, is not required for these RNA-RNA interaction events in vivo. We have also demonstrated (17) that in murine leukemia virus, expression of the pol gene product is unnecessary for these interactions. Thus the Gag polyprotein is the only internal viral protein which might be required to facilitate these events. In light of the present results (Fig. 3 and 5), showing that Gag can catalyze them in vitro, we consider it likely that it performs this function in vivo. (It is also possible that RNA dimerization occurs without the aid of a cofactor in vivo, as has been shown with transcripts of retroviral RNAs in vitro [12, 29]).
There is no direct information as to whether RNA dimerization and tRNA annealing precede or occur simultaneously with virus assembly, and one could imagine that the cytoplasm contains genomic RNA molecules which are dimeric and/or contain primer tRNA annealed to the PBS as a result of interactions with Gag. However, several observations seem to argue against this possibility. First, an early study suggested that tRNA annealing was incomplete in newly released particles of avian leukosis virus (9), and secondly, a recent report indicated that the placement was also incomplete in immature (PR-deficient) HIV-1 particles (28). The fact that the annealing is not complete at the moment of virus release suggests that it occurs simultaneously with virus assembly; perhaps under normal circumstances it is catalyzed in part by the Gag polyprotein and in part by NC. It is also striking that that the HIV-1 Gag polyprotein can induce the stabilization of a dimer of retroviral RNA in vitro (Fig. 4). This finding was somewhat unexpected, since stabilization of dimeric RNAs within the retroviral particle in vivo depends upon the release of NC from the polyprotein by the viral PR (16, 18). Thus, the polyprotein is evidently capable of inducing stabilization in solution but not within the virion. One possible explanation for this discrepancy is that the polyprotein does not interact with viral RNAs within the cytoplasm, but only during the formation of the virion, and that the structure of the nascent virus particle somehow restricts the ability of the protein to interact with the RNA. Indeed, contact between Gag and RNA in the immature particle is probably very limited: a careful analysis of avian leukosis virus particles (in which the maturation of dimeric RNA was first observed [33]) showed that UV-induced cross-linking of Gag to RNA in immature particles is extremely inefficient compared to the cross-linking of NC to RNA in mature particles (32).
In summary, the initial assembly of a retrovirus particle involves at least two RNA-RNA interaction events: dimerization of genomic RNA and annealing of a cellular tRNA to a specific site on the genomic RNA. The present results strongly suggest that the Gag polyprotein (the major structural protein of the immature retrovirus particle) is responsible not only for formation of the particle but also for catalyzing these associations between RNA molecules. This catalysis is presumably carried out by the NC domain of the polyprotein, but the detailed molecular mechanism of the catalytic reaction is not yet understood.
| |
ACKNOWLEDGMENTS |
|---|
We thank Guillaume Bec and Gerard Keith for the gift of purified bovine tRNA3Lys, Robert Gorelick and Louis Henderson for the gift of HIV-1 NC protein, Jianhui Guo and Judith Levin for the pJD plasmid, and Judith Levin for help with the experiments and for a thoughtful reading of the manuscript.
Research was supported in part by the National Cancer Institute, DHHS, under contract with ABL, and also by grants from the French Agence Nationale de Recherches sur le SIDA and the CNRS.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Retroviral Genetics Section, ABL-BRP, NCI-Frederick Cancer Research & Development Center, P.O. Box B, Bldg. 535, Frederick, MD 21702. Phone: (301) 846-1361. Fax: (301) 846-7146. E-mail: rein{at}mail.ncifcrf.gov.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. |
Adachi, A.,
H. E. Gendelman,
S. Koenig,
T. Folks,
R. Willey,
A. Rabson, and M. A. Martin.
1986.
Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone.
J. Virol.
59:284-291 |
| 2. |
Aiyar, A.,
D. Cobrinik,
Z. Ge,
H. J. Kung, and J. Leis.
1992.
Interaction between retroviral U5 RNA and the T psi C loop of the tRNA(Trp) primer is required for efficient initiation of reverse transcription.
J. Virol.
66:2464-2472 |
| 3. | Allen, P., B. Collins, D. Brown, Z. Hostomsky, and L. Gold. 1996. A specific RNA structural motif mediates high affinity binding by the HIV-1 nucleocapsid protein (NCp7). Virology 225:306-315[Medline]. |
| 4. |
Berglund, J. A.,
B. Charpentier, and M. Rosbash.
1997.
A high affinity binding site for the HIV-1 nucleocapsid protein.
Nucleic Acids Res.
25:1042-1049 |
| 5. | Berkowitz, R., J. Fisher, and S. P. Goff. 1996. RNA packaging. Curr. Top. Microbiol. Immunol. 214:177-218[Medline]. |
| 6. | Busch, L. K. 1994. Production of HIV-1 (MN) nucleocapsid protein (p7) by recombinant DNA technology. M.S. thesis. Hood College, Frederick, Md. |
| 7. |
Campbell, S., and A. Rein.
1999.
In vitro assembly properties of human immunodeficiency virus type 1 Gag protein lacking the p6 domain.
J. Virol.
73:2270-2279 |
| 8. | Campbell, S., and V. M. Vogt. 1997. In vitro assembly of virus-like particles with Rous sarcoma virus Gag deletion mutants: identification of the p10 domain as a morphological determinant in the formation of spherical particles. J. Virol. 71:4425-4435[Abstract]. |
| 9. |
Canaani, E.,
K. V. Helm, and P. Duesberg.
1973.
Evidence for 30-40S RNA as precursor of the 60-70S RNA of Rous sarcoma virus.
Proc. Natl. Acad. Sci. USA
70:401-405 |
| 10. | Coffin, J. M., S. H. Hughes, and H. E. Varmus. 1997. Retroviruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 11. |
Crawford, S., and S. P. Goff.
1985.
A deletion mutation in the 5' part of the pol gene of Moloney murine leukemia virus blocks proteolytic processing of the gag and pol polyproteins.
J. Virol.
53:899-907 |
| 12. | Darlix, J. L., M. Lapadat-Tapolsky, H. de Rocquigny, and B. P. Roques. 1995. First glimpses at structure-function relationships of the nucleocapsid protein of retroviruses. J. Mol. Biol. 254:523-537[Medline]. |
| 13. |
Feng, Y. X.,
T. D. Copeland,
L. E. Henderson,
R. J. Gorelick,
W. J. Bosche,
J. G. Levin, and A. Rein.
1996.
HIV-1 nucleocapsid protein induces "maturation" of dimeric retroviral RNA in vitro.
Proc. Natl. Acad. Sci. USA
93:7577-7581 |
| 14. | Feng, Y. X., W. Fu, A. J. Winter, J. G. Levin, and A. Rein. 1995. Multiple regions of Harvey sarcoma virus RNA can dimerize in vitro. J. Virol. 69:2486-2490[Abstract]. |
| 15. |
Fisher, R. J.,
A. Rein,
M. Fivash,
M. A. Urbaneja,
J. R. Casas-Finet,
M. Medaglia, and L. E. Henderson.
1998.
Sequence-specific binding of human immunodeficiency virus type 1 nucleocapsid protein to short oligonucleotides.
J. Virol.
72:1902-1909 |
| 16. |
Fu, W.,
R. J. Gorelick, and A. Rein.
1994.
Characterization of human immunodeficiency virus type 1 dimeric RNA from wild-type and protease-defective virions.
J. Virol.
68:5013-5018 |
| 17. | Fu, W., B. A. Ortiz-Conde, R. J. Gorelick, S. H. Hughes, and A. Rein. 1997. Placement of tRNA primer on the primer-binding site requires pol gene expression in avian but not murine retroviruses. J. Virol. 71:6940-6946[Abstract]. |
| 18. |
Fu, W., and A. Rein.
1993.
Maturation of dimeric viral RNA of Moloney murine leukemia virus.
J. Virol.
67:5443-5449 |
| 19. | Gross, H. J., G. Krupp, H. Domdey, M. Raba, P. Jank, C. Lossow, H. Alberty, K. Ramm, and H. L. Sanger. 1982. Nucleotide sequence and secondary structure of citrus exocortis and chrysanthemum stunt viroid. Eur. J. Biochem. 121:249-257[Medline]. |
| 20. | Guo, J., L. E. Henderson, J. Bess, B. Kane, and J. G. Levin. 1997. Human immunodeficiency virus type 1 nucleocapsid protein promotes efficient strand transfer and specific viral DNA synthesis by inhibiting TAR-dependent self-priming from minus-strand strong-stop DNA. J. Virol. 71:5178-5188[Abstract]. |
| 21. |
Herschlag, D.
1995.
RNA chaperones and the RNA folding problem.
J. Biol. Chem.
270:20871-20874 |
| 22. |
Huang, Y.,
A. Khorchid,
J. Gabor,
J. Wang,
X. Li,
J. L. Darlix,
M. A. Wainberg, and L. Kleiman.
1998.
The role of nucleocapsid and U5 stem/A-rich loop sequences in tRNA(3Lys) genomic placement and initiation of reverse transcription in human immunodeficiency virus type 1.
J. Virol.
72:3907-3915 |
| 23. | Huang, Y., J. Wang, A. Shalom, Z. Li, A. Khorchid, M. A. Wainberg, and L. Kleiman. 1997. Primer tRNA3Lys on the viral genome exists in unextended and two-base extended forms within mature human immunodeficiency virus type 1. J. Virol. 71:726-728[Abstract]. |
| 24. | Isel, C., C. Ehresmann, G. Keith, B. Ehresmann, and R. Marquet. 1995. Initiation of reverse transcription of HIV-1: secondary structure of the HIV-1 RNA/tRNA(3Lys) (template/primer). J. Mol. Biol. 247:236-250[Medline]. |
| 25. |
Isel, C.,
R. Marquet,
G. Keith,
C. Ehresmann, and B. Ehresmann.
1993.
Modified nucleotides of tRNA(3Lys) modulate primer/template loop-loop interaction in the initiation complex of HIV-1 reverse transcription.
J. Biol. Chem.
268:25269-25272 |
| 25a. | Keith, G. Personal communication. |
| 26. | Lapadat-Tapolsky, M., C. Gabus, M. Rau, and J. L. Darlix. 1997. Possible roles of HIV-1 nucleocapsid protein in the specificity of proviral DNA synthesis and in its variability. J. Mol. Biol. 268:250-260[Medline]. |
| 27. | Liang, C., X. Li, L. Rong, P. Inouye, Y. Quan, L. Kleiman, and M. A. Wainberg. 1997. The importance of the A-rich loop in human immunodeficiency virus type 1 reverse transcription and infectivity. J. Virol. 71:5750-5757[Abstract]. |
| 28. | Liang, C., L. Rong, N. Morin, E. Cherry, Y. Huang, L. Kleiman, and M. A. Wainberg. 1997. The roles of the human immunodeficiency virus type 1 Pol protein and the primer binding site in the placement of primer tRNA(3Lys) onto viral genomic RNA. J. Virol. 71:9075-9086[Abstract]. |
| 29. |
Prats, A.-C.,
C. Roy,
P. Wang,
M. Erard,
V. Housset,
C. Gabus,
C. Paoletti, and J.-L. Darlix.
1990.
cis elements and trans-acting factors involved in dimer formation of murine leukemia virus RNA.
J. Virol.
64:774-783 |
| 30. | Prats, A. C., L. Sarih, C. Gabus, S. Litvak, G. Keith, and J. L. Darlix. 1988. Small finger protein of avian and murine retroviruses has nucleic acid annealing activity and positions the replication primer tRNA onto genomic RNA. EMBO J. 7:1777-1783[Medline]. |
| 31. | Rein, A., L. E. Henderson, and J. G. Levin. 1998. Nucleic acid chaperone activity of retroviral nucleocapsid proteins: significance for viral replication. Trends Biochem. Sci. 23:297-301[Medline]. |
| 32. |
Stewart, L.,
G. Schatz, and V. M. Vogt.
1990.
Properties of avian retrovirus particles defective in viral protease.
J. Virol.
64:5076-5092 |
| 33. |
Stoltzfus, C. M., and P. N. Snyder.
1975.
Structure of B77 sarcoma virus RNA: stabilization of RNA after packaging.
J. Virol.
16:1161-1170 |
| 34. |
Tsuchihashi, Z., and P. O. Brown.
1994.
DNA strand exchange and selective DNA annealing promoted by the human immunodeficiency virus type 1 nucleocapsid protein.
J. Virol.
68:5863-5870 |
| 35. |
Wu, W.,
L. E. Henderson,
T. D. Copeland,
R. J. Gorelick,
W. J. Bosche,
A. Rein, and J. G. Levin.
1996.
Human immunodeficiency virus type 1 nucleocapsid protein reduces reverse transcriptase pausing at a secondary structure near the murine leukemia virus polypurine tract.
J. Virol.
70:7132-7142 |
Journal of Virology, May 1999, p. 4251-4256, Vol. 73, No. 5
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Guo, F., Saadatmand, J., Niu, M., Kleiman, L.
(2009). Roles of Gag and NCp7 in Facilitating Formula Annealing to Viral RNA in Human Immunodeficiency Virus Type 1. J. Virol.
83: 8099-8107
[Abstract] [Full Text] -
Henriet, S., Mercenne, G., Bernacchi, S., Paillart, J.-C., Marquet, R.
(2009). Tumultuous Relationship between the Human Immunodeficiency Virus Type 1 Viral Infectivity Factor (Vif) and the Human APOBEC-3G and APOBEC-3F Restriction Factors. Microbiol. Mol. Biol. Rev.
73: 211-232
[Abstract] [Full Text] -
Bilbille, Y., Vendeix, F. A. P., Guenther, R., Malkiewicz, A., Ariza, X., Vilarrasa, J., Agris, P. F.
(2009). The structure of the human tRNALys3 anticodon bound to the HIV genome is stabilized by modified nucleosides and adjacent mismatch base pairs. Nucleic Acids Res
37: 3342-3353
[Abstract] [Full Text] -
Stewart-Maynard, K. M., Cruceanu, M., Wang, F., Vo, M.-N., Gorelick, R. J., Williams, M. C., Rouzina, I., Musier-Forsyth, K.
(2008). Retroviral Nucleocapsid Proteins Display Nonequivalent Levels of Nucleic Acid Chaperone Activity. J. Virol.
82: 10129-10142
[Abstract] [Full Text] -
Guo, F., Cen, S., Niu, M., Yang, Y., Gorelick, R. J., Kleiman, L.
(2007). The Interaction of APOBEC3G with Human Immunodeficiency Virus Type 1 Nucleocapsid Inhibits tRNA3Lys Annealing to Viral RNA. J. Virol.
81: 11322-11331
[Abstract] [Full Text] -
Laham-Karam, N., Bacharach, E.
(2007). Transduction of Human Immunodeficiency Virus Type 1 Vectors Lacking Encapsidation and Dimerization Signals. J. Virol.
81: 10687-10698
[Abstract] [Full Text] -
Cruceanu, M., Urbaneja, M. A., Hixson, C. V., Johnson, D. G., Datta, S. A., Fivash, M. J., Stephen, A. G., Fisher, R. J., Gorelick, R. J., Casas-Finet, J. R., Rein, A., Rouzina, I., Williams, M. C.
(2006). Nucleic acid binding and chaperone properties of HIV-1 Gag and nucleocapsid proteins. Nucleic Acids Res
34: 593-605
[Abstract] [Full Text] -
Fisher, R. J., Fivash, M. J., Stephen, A. G., Hagan, N. A., Shenoy, S. R., Medaglia, M. V., Smith, L. R., Worthy, K. M., Simpson, J. T., Shoemaker, R., McNitt, K. L., Johnson, D. G., Hixson, C. V., Gorelick, R. J., Fabris, D., Henderson, L. E., Rein, A.
(2006). Complex interactions of HIV-1 nucleocapsid protein with oligonucleotides. Nucleic Acids Res
34: 472-484
[Abstract] [Full Text] -
Roldan, A., Warren, O. U., Russell, R. S., Liang, C., Wainberg, M. A.
(2005). A HIV-1 Minimal Gag Protein Is Superior to Nucleocapsid at in Vitro Annealing and Exhibits Multimerization-induced Inhibition of Reverse Transcription. J. Biol. Chem.
280: 17488-17496
[Abstract] [Full Text] -
Morcock, D. R., Thomas, J. A., Gagliardi, T. D., Gorelick, R. J., Roser, J. D., Chertova, E. N., Bess, J. W. Jr., Ott, D. E., Sattentau, Q. J., Frank, I., Pope, M., Lifson, J. D., Henderson, L. E., Crise, B. J.
(2005). Elimination of Retroviral Infectivity by N-Ethylmaleimide with Preservation of Functional Envelope Glycoproteins. J. Virol.
79: 1533-1542
[Abstract] [Full Text] -
Muriaux, D., Costes, S., Nagashima, K., Mirro, J., Cho, E., Lockett, S., Rein, A.
(2004). Role of Murine Leukemia Virus Nucleocapsid Protein in Virus Assembly. J. Virol.
78: 12378-12385
[Abstract] [Full Text] -
Luo, K., Liu, B., Xiao, Z., Yu, Y., Yu, X., Gorelick, R., Yu, X.-F.
(2004). Amino-Terminal Region of the Human Immunodeficiency Virus Type 1 Nucleocapsid Is Required for Human APOBEC3G Packaging. J. Virol.
78: 11841-11852
[Abstract] [Full Text] -
Heilman-Miller, S. L., Wu, T., Levin, J. G.
(2004). Alteration of Nucleic Acid Structure and Stability Modulates the Efficiency of Minus-Strand Transfer Mediated by the HIV-1 Nucleocapsid Protein. J. Biol. Chem.
279: 44154-44165
[Abstract] [Full Text] -
Andersen, E. S., Contera, S. A., Knudsen, B., Damgaard, C. K., Besenbacher, F., Kjems, J.
(2004). Role of the Trans-activation Response Element in Dimerization of HIV-1 RNA. J. Biol. Chem.
279: 22243-22249
[Abstract] [Full Text] -
Oshima, M., Muriaux, D., Mirro, J., Nagashima, K., Dryden, K., Yeager, M., Rein, A.
(2004). Effects of Blocking Individual Maturation Cleavages in Murine Leukemia Virus Gag. J. Virol.
78: 1411-1420
[Abstract] [Full Text] -
Matsumoto, T., Takahashi, H., Fujiwara, H.
(2004). Targeted Nuclear Import of Open Reading Frame 1 Protein Is Required for In Vivo Retrotransposition of a Telomere-Specific Non-Long Terminal Repeat Retrotransposon, SART1. Mol. Cell. Biol.
24: 105-122
[Abstract] [Full Text] -
Heath, M. J., Derebail, S. S., Gorelick, R. J., DeStefano, J. J.
(2003). Differing Roles of the N- and C-terminal Zinc Fingers in Human Immunodeficiency Virus Nucleocapsid Protein-enhanced Nucleic Acid Annealing. J. Biol. Chem.
278: 30755-30763
[Abstract] [Full Text] -
Iwatani, Y., Rosen, A. E., Guo, J., Musier-Forsyth, K., Levin, J. G.
(2003). Efficient Initiation of HIV-1 Reverse Transcription in Vitro. REQUIREMENT FOR RNA SEQUENCES DOWNSTREAM OF THE PRIMER BINDING SITE ABROGATED BY NUCLEOCAPSID PROTEIN-DEPENDENT PRIMER-TEMPLATE INTERACTIONS. J. Biol. Chem.
278: 14185-14195
[Abstract] [Full Text] -
Sakuragi, J.-I., Ueda, S., Iwamoto, A., Shioda, T.
(2003). Possible Role of Dimerization in Human Immunodeficiency Virus Type 1 Genome RNA Packaging. J. Virol.
77: 4060-4069
[Abstract] [Full Text] -
Andersen, E. S., Jeeninga, R. E., Damgaard, C. K., Berkhout, B., Kjems, J.
(2003). Dimerization and Template Switching in the 5' Untranslated Region between Various Subtypes of Human Immunodeficiency Virus Type 1. J. Virol.
77: 3020-3030
[Abstract] [Full Text] -
Zhang, W.-h., Hwang, C. K., Hu, W.-S., Gorelick, R. J., Pathak, V. K.
(2002). Zinc Finger Domain of Murine Leukemia Virus Nucleocapsid Protein Enhances the Rate of Viral DNA Synthesis in Vivo. J. Virol.
76: 7473-7484
[Abstract] [Full Text] -
Shehu-Xhilaga, M., Hill, M., Marshall, J. A., Kappes, J., Crowe, S. M., Mak, J.
(2002). The Conformation of the Mature Dimeric Human Immunodeficiency Virus Type 1 RNA Genome Requires Packaging of Pol Protein. J. Virol.
76: 4331-4340
[Abstract] [Full Text] -
Kameoka, M., Morgan, M., Binette, M., Russell, R. S., Rong, L., Guo, X., Mouland, A., Kleiman, L., Liang, C., Wainberg, M. A.
(2002). The Tat Protein of Human Immunodeficiency Virus Type 1 (HIV-1) Can Promote Placement of tRNA Primer onto Viral RNA and Suppress Later DNA Polymerization in HIV-1 Reverse Transcription. J. Virol.
76: 3637-3645
[Abstract] [Full Text] -
Shehu-Xhilaga, M., Kraeusslich, H. G., Pettit, S., Swanstrom, R., Lee, J. Y., Marshall, J. A., Crowe, S. M., Mak, J.
(2001). Proteolytic Processing of the P2/Nucleocapsid Cleavage Site Is Critical for Human Immunodeficiency Virus Type 1 RNA Dimer Maturation. J. Virol.
75: 9156-9164
[Abstract] [Full Text] -
Shigemoto, K., Brennan, J., Walls, E., Watson, C. J., Stott, D., Rigby, P. W. J., Reith, A. D.
(2001). Identification and characterisation of a developmentally regulated mammalian gene that utilises -1 programmed ribosomal frameshifting. Nucleic Acids Res
29: 4079-4088
[Abstract] [Full Text] -
Cen, S., Khorchid, A., Javanbakht, H., Gabor, J., Stello, T., Shiba, K., Musier-Forsyth, K., Kleiman, L.
(2001). Incorporation of Lysyl-tRNA Synthetase into Human Immunodeficiency Virus Type 1. J. Virol.
75: 5043-5048
[Abstract] [Full Text] -
Hansen, A. C., Grunwald, T., Lund, A. H., Schmitz, A., Duch, M., Überla, K., Pedersen, F. S.
(2001). Transfer of Primer Binding Site-Mutated Simian Immunodeficiency Virus Vectors by Genetically Engineered Artificial and Hybrid tRNA-Like Primers. J. Virol.
75: 4922-4928
[Abstract] [Full Text] -
Muriaux, D., Mirro, J., Harvin, D., Rein, A.
(2001). RNA is a structural element in retrovirus particles. Proc. Natl. Acad. Sci. USA
98: 5246-5251
[Abstract] [Full Text] -
Kameoka, M., Rong, L., Götte, M., Liang, C., Russell, R. S., Wainberg, M. A.
(2001). Role for Human Immunodeficiency Virus Type 1 Tat Protein in Suppression of Viral Reverse Transcriptase Activity during Late Stages of Viral Replication. J. Virol.
75: 2675-2683
[Abstract] [Full Text] -
Martin, S. L., Bushman, F. D.
(2001). Nucleic Acid Chaperone Activity of the ORF1 Protein from the Mouse LINE-1 Retrotransposon. Mol. Cell. Biol.
21: 467-475
[Abstract] [Full Text] -
Garbitt, R. A., Albert, J. A., Kessler, M. D., Parent, L. J.
(2001). trans-Acting Inhibition of Genomic RNA Dimerization by Rous Sarcoma Virus Matrix Mutants. J. Virol.
75: 260-268
[Abstract] [Full Text] -
Cen, S., Khorchid, A., Gabor, J., Rong, L., Wainberg, M. A., Kleiman, L.
(2000). Roles of Pr55gag and NCp7 in tRNA3Lys Genomic Placement and the Initiation Step of Reverse Transcription in Human Immunodeficiency Virus Type 1. J. Virol.
74: 10796-10800
[Abstract] [Full Text] -
Feng, Y.-X., Moore, S. P., Garfinkel, D. J., Rein, A.
(2000). The Genomic RNA in Ty1 Virus-Like Particles Is Dimeric. J. Virol.
74: 10819-10821
[Abstract] [Full Text] -
Driscoll, M. D., Hughes, S. H.
(2000). Human Immunodeficiency Virus Type 1 Nucleocapsid Protein Can Prevent Self-Priming of Minus-Strand Strong Stop DNA by Promoting the Annealing of Short Oligonucleotides to Hairpin Sequences. J. Virol.
74: 8785-8792
[Abstract] [Full Text] -
Zuber, G., McDermott, J., Karanjia, S., Zhao, W., Schmid, M. F., Barklis, E.
(2000). Assembly of Retrovirus Capsid-Nucleocapsid Proteins in the Presence of Membranes or RNA. J. Virol.
74: 7431-7441
[Abstract] [Full Text] -
Wei, X., Gotte, M., Wainberg, M. A.
(2000). Human immunodeficiency virus type-1 reverse transcription can be inhibited in vitro by oligonucleotides that target both natural and synthetic tRNA primers. Nucleic Acids Res
28: 3065-3074
[Abstract] [Full Text] -
Cimarelli, A., Sandin, S., Höglund, S., Luban, J.
(2000). Rescue of Multiple Viral Functions by a Second-Site Suppressor of a Human Immunodeficiency Virus Type 1 Nucleocapsid Mutation. J. Virol.
74: 4273-4283
[Abstract] [Full Text] -
Hsu, M., Rong, L., Rocquigny, H. d., Roques, B. P., Wainberg, M. A.
(2000). The effect of mutations in the HIV-1 nucleocapsid protein on strand transfer in cell-free reverse transcription reactions. Nucleic Acids Res
28: 1724-1729
[Abstract] [Full Text] -
Gorelick, R. J., Fu, W., Gagliardi, T. D., Bosche, W. J., Rein, A., Henderson, L. E., Arthur, L. O.
(1999). Characterization of the Block in Replication of Nucleocapsid Protein Zinc Finger Mutants from Moloney Murine Leukemia Virus. J. Virol.
73: 8185-8195
[Abstract] [Full Text] -
Cristofari, G., Ficheux, D., Darlix, J.-L.
(2000). The Gag-like Protein of the Yeast Ty1 Retrotransposon Contains a Nucleic Acid Chaperone Domain Analogous to Retroviral Nucleocapsid Proteins. J. Biol. Chem.
275: 19210-19217
[Abstract] [Full Text] -
Jossinet, F., Lodmell, J. S., Ehresmann, C., Ehresmann, B., Marquet, R.
(2001). Identification of the in Vitro HIV-2/SIV RNA Dimerization Site Reveals Striking Differences with HIV-1. J. Biol. Chem.
276: 5598-5604
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»