Previous Article | Next Article 
Journal of Virology, May 1999, p. 4230-4238, Vol. 73, No. 5
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The Amino-Terminal Region of Vpr from Human
Immunodeficiency Virus Type 1 Forms Ion Channels and Kills
Neurons
S. C.
Piller,1,
G. D.
Ewart,1
D. A.
Jans,2
P. W.
Gage,1 and
G. B.
Cox1,*
Membrane Biology
Program1 and Nuclear Signalling
Laboratory,2 John Curtin School of Medical
Research, Australian National University, Canberra, ACT 2601, Australia
Received 29 June 1998/Accepted 19 February 1999
 |
ABSTRACT |
We have previously reported that the accessory protein Vpr from
human immunodeficiency virus type 1 forms cation-selective ion channels
in planar lipid bilayers and is able to depolarize intact cultured
neurons by causing an inward sodium current, resulting in cell death.
In this study, we used site-directed mutagenesis and synthetic peptides
to identify the structural regions responsible for the above functions.
Mutations in the N-terminal region of Vpr were found to affect channel
activity, whereas this activity was not affected by mutations in the
hydrophobic region of Vpr (amino acids 53 to 71). Analysis of mutants
containing changes in the basic C terminus confirmed previous results
that this region, although not necessary for ion channel function, was
responsible for the observed rectification of wild-type Vpr currents. A
peptide comprising the first 40 N-terminal amino acids of Vpr (N40) was found to be sufficient to form ion channels similar to those caused by
wild-type Vpr in planar lipid bilayers. Furthermore, N40 was able to
cause depolarization of the plasmalemma and cell death in cultured
hippocampal neurons with a time course similar to that seen with
wild-type Vpr, supporting the idea that this region is responsible for
Vpr ion channel function and cytotoxic effects. Since Vpr is found in
the serum and cerebrospinal fluids of AIDS patients, these results may
have significance for AIDS pathology.
 |
INTRODUCTION |
Although the accessory protein Vpr
from human immunodeficiency virus type 1 (HIV-1) is not essential for
viral replication in CD4+ T cells, it has been suggested
that it plays important roles either in the early or in the late stages
of the life cycle (for a review, see reference 18).
It accelerates viral replication in primary macrophages/monocytes
(3), possibly through its role in the transport of the
preintegration complex to the nucleus (11, 13). Other
demonstrated effects of Vpr include arresting cells in the
G2 phase of the cell cycle (4, 9, 12, 16, 30,
32) and causing apoptosis and/or cell death (2, 21, 34), as well as playing a role in transactivation (7).
Vpr is predominantly located in the nucleus of infected cells (19, 23) and is also present in virus particles. Recently, Levy et al.
(17, 18) demonstrated that Vpr can also be found in the sera
of AIDS patients as well as in the cerebrospinal fluid of patients with
neurological disorders (AIDS dementia).
Vpr appears to have several structural regions including an N-terminal
region predicted by the Chou-Fasman algorithm to be
-helical (amino
acids 16 to 35); a hydrophobic, possibly
-helical region (amino
acids 53 to 71); and a basic C terminus with two repeats of a conserved
H(F/S)RIG motif. Mutational analysis has suggested that the N-terminal
region of Vpr is important for nuclear localization (8, 38),
virion incorporation (8, 24, 25, 38), and oligomerization
(39) while the C terminus is mainly responsible for causing
cell cycle arrest (6, 8, 16, 40) and mitochondrial
dysfunction (2, 22).
The mechanism of action for any of the functions of Vpr is as yet
unknown. We reported previously that Vpr can form cation-selective ion
channels in planar lipid bilayers (27). In addition,
extracellular Vpr is able to associate with the cell membrane and cause
a large inward sodium current resulting in depolarization and
eventually cell death in cultured rat hippocampal neurons
(28). Recently, several other small viral proteins including
M2 from influenza A virus (14, 29), NB from influenza B
virus (35), and Vpu from HIV-1 (10, 33), all of
which possess a single hydrophobic region, have also been reported to
form ion channels in planar lipid bilayers, suggesting a wider role for
ion channels in the replication of enveloped viruses.
In this study, we investigated, with site-directed mutagenesis and
synthetic peptides, which structural regions of Vpr are responsible for
the formation of ion channels in planar lipid bilayers as well as for
plasmalemma depolarization and cytotoxic effects on intact hippocampal
neurons. Our results indicate that the first 40 N-terminal amino acids
of Vpr are sufficient to form ion channels in planar lipid bilayers and
to produce cytotoxic effects in hippocampal neurons which are probably
due to depolarization of the plasmalemma. Mutational analysis indicates
that the positively charged C terminus is not necessary for ion channel
formation but is responsible for the rectification of currents at
positive potentials observed with wild-type (WT) Vpr. The C-terminal
amino acids 76 to 96 can cause cell death of cultured hippocampal
neurons but without plasmalemma depolarization comparable to that
caused by Vpr. For the first time, these results directly link the
region of Vpr responsible for ion channel function with its cytotoxic effects on cultured neurons. The results may be useful for the development of therapies to treat AIDS symptoms.
 |
MATERIALS AND METHODS |
Site-directed mutagenesis.
With the exception of Vpr
1,
which corresponds to a form of Vpr with the C terminus truncated
(27), and Vpr
2, which was generated by PCR, mutations in
Vpr were generated by double-stranded mutagenesis of the plasmid
p2GEX-Vpr (27) by the unique site elimination technique
(unique site elimination kit; Pharmacia). The selection primer (5'
GCTGTTAGCAGGCCTATTAAGTTCTG 3') changed the unique ApaI
site in the p2GEX plasmid to StuI and was used in
conjunction with the target primers GAACCCGTCCACATGTTCGGTATTATT, GAATGGACACTGCAGCTTTTAGAGGAG,
GGACACTAGAGCTTCTGCAGCAGCTTAAGAAT, and
GAAATGGAGCTAGCCAATCCTAGACTGAATTCC to
generate the mutations VprE58Q, VprE21Q, VprE24Q, and VprR95Q,
respectively. Mutations were confirmed by DNA sequencing performed in
the Biomolecular Resource Facility (John Curtin School of Medical
Research, Australian National University, Canberra, Australia).
Protein expression and purification.
Recombinant WT Vpr was
purified as described previously (27) and appeared
homogeneous on Coomassie brilliant blue R250-stained polyacrylamide
gels (see Fig. 1B, lane 1). We estimate this preparation to be >99%
pure. Mutant Vpr proteins were expressed and purified by the same
method, and while the degree of purity as estimated by polyacrylamide
gel electrophoresis varied depending on the particular mutation, we
estimate all mutant preparations to be >90% pure (data not shown).
This level of purity was considered sufficient for experiments aimed at
detecting changes in the mutant proteins' ion channel activity
compared with that of the WT. Briefly, the proteins were expressed as
glutathione S-transferase fusion proteins in
Escherichia coli and purified by affinity chromatography with glutathione-agarose resin (Sigma). The mutant Vpr proteins were
then cleaved from glutathione S-transferase with thrombin and further purified by cation-exchange high-pressure liquid
chromatography (HPLC). Purified mutant Vpr was identified by sodium
dodecyl sulfate gels and Western blotting with polyclonal anti-Vpr
antibodies raised in rabbits (Fig. 1C) (27) and stored in 20 mM Tris (pH 7.0) containing the zwitterionic detergent
3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS;
0.5%), glycerol (20%), and 500 mM NaCl. Vpr with the C terminus
truncated (Vpr
1) was purified as described elsewhere (27).
Synthetic peptides.
Vpr peptides comprising the first 21 (N21) or 40 (N40) N-terminal amino acids and the last 21 (C21)
C-terminal amino acids (see Fig. 1) were synthesized in the
Biomolecular Resource Facility (Australian National University) with an
Applied Biosystems model 477a machine. The peptides were further
purified by reverse-phase HPLC with a C18 column to yield a
single clear peak in the elution profile. Mass spectroscopy (MALDITOF;
matrix-assisted laser desorption-time of flight) of the purified N40
peptide revealed a single molecular ion of the correct molecular mass
for the amino acid sequence indicated in Fig. 1. For bilayer
experiments, peptides were dissolved in cis solution (500 mM
NaCl buffered at pH 6.0 with 10 mM
2-[N-morpholino]ethanesulfonic acid [MES], 10 mM
mercaptoethanol) and added to the cis chamber to obtain
final peptide concentrations of 8 to 40 µM. For confocal laser
scanning microscopy (CLSM), peptides were dissolved in CHAPS buffer (20 mM Tris, 0.25% CHAPS, 10% glycerol, pH 7.0) at 6 mM.
Recording of ion channel activity.
Purified WT and mutant
Vpr and synthetic peptides were tested for their ability to induce
channel activity in planar lipid bilayers as described elsewhere
(27). Briefly, bilayers were formed from a mixture of
1-palmitoyl-2-oleoyl phosphatidylethanolamine and 1-palmitoyl-2-oleoyl
phosphatidylcholine (8:2 weight ratio; Avanti Polar Lipids) dissolved
in n-decane (50 mg/ml). For experiments with the C-terminal
peptides, the negatively charged lipid 1-palmitoyl-2-oleoyl phosphatidylserine (PS) was added to the lipid mixture (5:3:2 ratio of
phosphatidylethanolamine to PS to phosphatidylcholine, respectively).
The lipid mixture was painted onto 150- to 200-µm-diameter apertures
in the wall of a 2-ml Delrin cup separating cis and trans chambers containing 50 and 500 mM salt solutions,
respectively, adjusted to pH 6 with 10 mM MES. Voltages were measured
in the trans chamber with respect to the grounded
cis chamber with an Axopatch 200 amplifier (Axon
Instruments). An aliquot (10 to 100 µl) of HPLC fractions containing
mutant Vpr (in 20 mM Tris-HCl-20% glycerol-0.5% CHAPS and up to 415 mM NaCl) or an aliquot of synthetic Vpr peptides (in cis
solution) was added to the cis chamber, which was stirred
until channel activity was seen. Currents were recorded and analyzed as
described elsewhere (27). Buffer controls, including HPLC
column fractions not containing Vpr, failed to produce any channel
activity when tested in the bilayer assay. In addition, inhibition of
channel activity by the Vpr C-terminal specific antibody (AbC)
(27) was routinely checked as a means of confirming that the
activity was indeed caused by the Vpr polypeptide and not due to some
minor contaminant (see also Fig. 5).
Cell culture.
Rat hippocampal neurons were prepared from
neonatal rats as previously reported (31). Briefly, after
removal and trituration of the hippocampi from neonatal rats,
dissociated cells were plated on glass coverslips pretreated with
poly(L-lysine) and cultured for 5 to 15 days in a
humidified incubator (5% CO2) in minimal essential medium
supplemented with fetal bovine serum (10%), serum extender (0.1%),
glucose (6%), penicillin (2%), and streptomycin (2%).
Plasmalemma depolarization.
Depolarization of the
plasmalemma after extracellular addition of purified Vpr mutant
proteins or synthetic Vpr peptides was assessed qualitatively by CLSM
(15) in conjunction with the anionic potential-sensitive dye
bis(1,3-dibutylbarbituric acid)trimethine oxonol [DiBa-C4(3)]
(Molecular Probes) as described previously (28). Hippocampal
neurons grown on coverslips were exposed to 3 µl of 55% bath
solution (140 mM NaCl, 5 mM KCl, 3 mM CaCl2, 2 mM
MgCl2, 10 mM glucose, 10 mM TES
[N-tris(hydroxymethyl)methyl-2-aminoethanesulfonic acid], pH 7.3); 20% DiBa-C4(3) (final concentration of 1 µM); 83 mM
NaCl; and 16.7% either CHAPS buffer (negative control), WT Vpr in
CHAPS buffer (final concentration of 1 µM), or synthetic peptides in
CHAPS buffer (final concentration, 1 mM). Confocal images were recorded
at several time points up to 15 min at 37°C. As a positive control,
cultured hippocampal neurons were exposed to the above solutions,
substituting 1 M KCl for the 16.7% CHAPS buffer (final concentration
of 200 mM KCl), which depolarizes the transmembrane potential
(26).
Cytotoxic effects.
The cytotoxic effect of purified Vpr
mutant protein (1 µM) or synthetic Vpr peptides (1 mM) on cultured
rat hippocampal neurons was assessed with CLSM with the
membrane-impermeable, nucleic acid-staining fluorescent dye propidium
iodide (PI; Molecular Probes) as described previously (28).
Cells were prepared for CLSM as described above for plasmalemma
depolarization experiments, except that PI (400 mg/ml in
H2O) was added instead of DiBa-C4(3). For analysis, cells
showing intense nuclear staining, indicative of cell death, were
counted at various time points and expressed as a percentage of the
total number of cells as previously described (28).
 |
RESULTS |
Mutations in the N-terminal region change ion selectivity.
Inspection of the Vpr amino acid sequence by predictive algorithms
indicates three clear structural regions: a basic C-terminal region, a
hydrophobic region (amino acids 53 to 71), and an N-terminal region
containing a predicted amphipathic
-helix (amino acids 16 to
35). The Vpr mutations generated in this study (Table
1 and Fig.
1A) were designed to investigate the
importance of these three regions for ion channel formation by Vpr in
planar lipid bilayers. The mutant forms of Vpr were expressed in
E. coli and purified as described in Materials and Methods
(Fig. 1C) before reconstitution into planar lipid bilayers
(27).


View larger version (33K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Amino acid sequence of Vpr. The hydrophobic region
is in boldface italics, the H(F/S)RIG motifs are underlined, and the
sites of point mutations are indicated in boldface. The synthetic
peptides are indicated underneath the sequence, as are the sites of the
deletions in Vpr 1 and Vpr 2. (B) Purity of WT Vpr preparation.
Lanes 1 and 2, Coomassie blue-stained gel of the Vpr preparation and
molecular mass markers, respectively; lane 3, Western blot with
antibody specific to the C terminus of Vpr. (C) Western blots of
HPLC-purified fractions of Vpr mutant proteins probed with AbN. The
arrows indicate the sizes of full-length Vpr and C-terminally truncated
forms of Vpr (Vpr 1). Numbers at left show molecular masses in
kilodaltons.
|
|
C-terminal mutations.
We have previously reported that the
C-terminal 8 or 9 amino acids of Vpr are not necessary for channel
activity (27). C-terminally truncated Vpr (Vpr
1 [Table
1]) was found to form channels with an ion selectivity similar to that
of WT Vpr, but they do not rectify at positive potentials (Fig.
2B). Originally, we proposed, based on a
computer-generated structural model, a number of specific electrostatic
interactions between positively charged amino acids in the C-terminal
region and negatively charged residues in the N-terminal region
(27). In particular, arginine 95 appeared to be involved in
three salt-bridge interactions with N-terminal glutamates (E6, E13, and
E17). To test the role of these proposed interactions in channel
function, the mutant VprR95Q was constructed. Rather than altering
channel properties, this mutant Vpr protein exhibited ion channel
activity indistinguishable from that of WT Vpr in planar lipid bilayers
(Fig. 2C and D). While further mutations are required in this region to
identify the key residues of the Vpr C terminus that affect
rectification, the results support the idea that the C terminus is not
necessary for ion channel formation.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 2.
C-terminal mutants: examples of currents generated in
planar lipid bilayers by Vpr 1 (A) and VprR95Q (C) at different
holding potentials. The dashed lines indicate the zero current levels.
The average currents are plotted versus holding potential for Vpr 1
(filled circles) (B), VprR95Q (filled squares) (D), and, for
comparison, WT Vpr (open circles).
|
|
Hydrophobic region mutations.
By analogy with other viral ion
channels such as M2 from influenza A virus (14, 29), NB from
influenza B virus (35), and Vpu from HIV-1 (10,
33), it seemed likely that the hydrophobic region of Vpr (amino
acids 53 to 71) might form the transmembrane pore of the channel in the
form of a bundle of
-helices. To test the role of this hydrophobic
region in Vpr channel formation, the following two mutants were
designed. The mutant Vpr
2 was designed to curtail the hydrophobic
region so that the proposed hydrophobic
-helix would be too
short to span the bilayer. VprE58Q was designed to disrupt the putative
salt bridge in the proposed hydrophobic
-helix, leaving an unpaired
positively charged residue to be buried in the bilayer. In all
experiments in which either purified Vpr
2 (n = 38)
or purified VprE58Q (n = 12) was tested in planar lipid
bilayers, currents similar to those caused by WT Vpr were observed.
Figure 3 shows typical channel recordings at different potentials and current-voltage relationships for Vpr
2
(A and B) and VprE58Q (C and D), respectively. It was concluded that
the hydrophobic domain of Vpr was unlikely to play a role in ion
channel function by forming a transmembrane
-helix.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 3.
Hydrophobic region mutants: examples of currents
generated in planar lipid bilayers by Vpr 2 (A) and VprE58Q (C) at
different holding potentials. The dashed lines indicate the zero
current levels. The average currents are plotted versus holding
potential for Vpr 2 (filled circles) (B), VprE58Q (filled inverted
triangles) (D), and, for comparison, WT Vpr (open circles).
|
|
N-terminal mutations.
Since both the C terminus and
hydrophobic region of Vpr appeared not to be necessary for ion channel
formation by Vpr, the Vpr N-terminal region was examined. It has
previously been noted (8, 25, 38) that the N-terminal region
of Vpr has the propensity to form an
-helix based on structural
predictive methods, and this is strongly supported by circular
dichroism analysis of synthetic peptides corresponding to residues 17 to 34 of Vpr (20). Rather than attempting to completely
disrupt the putative helical structure and hence severely impairing
function without yielding any information as to which specific residues
of the helix might be important, we chose to target residues that might
be expected to be involved in lining the pore and/or interacting with
the cations moving through the channel. To that end, point mutations in
the N-terminal region, VprE21Q and VprE24Q, were designed to remove
negative charges from the hydrophilic face of the proposed amphipathic
-helix. Both of these mutant proteins formed ion channels (22 and 20 experiments, respectively) that were less cation selective than those
formed by WT Vpr. They both had reversal potentials more negative than
+20 mV compared with +35 mV for WT Vpr channels (Fig.
4). The ratio of sodium to chloride ion
permeability (calculated with the Goldman-Hodgkin-Katz equation based
on ion activities) for VprE21Q and VprE24Q channels was at least four
times lower than that for WT Vpr channels (PNa/PCl ratio of 2.5 for
VprE21Q and VprE24Q and 11 for WT Vpr). This effect on sodium
permeability of these mutations indicates that these residues are
involved in the ion selectivity filter of the channel.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 4.
N-terminal mutants: examples of currents generated in
planar lipid bilayers by VprE21Q (A) and VprE24Q (C) at different
holding potentials. The dashed lines indicate the zero current levels.
The average currents are plotted versus holding potential for VprE21Q
(filled triangles) (B), VprE24Q (inverted filled triangles) (D), and,
for comparison, WT Vpr (open circles).
|
|
Another striking feature of the channels formed by the VprE21Q mutant
is that the currents do not rectify at positive potentials
(Fig.
4A and
B). It is possible that glutamate 21 may be involved
in electrostatic
interactions with residues in the C terminus
(presumably not arginine
95) that lead to the
rectification.
To confirm that the different channel properties observed in the
preparation of these mutant proteins were directly attributable
to Vpr,
inhibition by an antibody specific to the Vpr C terminus
(
27) was tested (Fig.
5). In
the case of both E21Q (data not
shown) and E24Q, channel activity was
abrogated by the presence
of the antibody, in a fashion identical to
that of either WT Vpr
or the E58Q mutant (included as a control). It
was concluded that
the altered channel activity of the mutants was
indeed due to
Vpr, confirming also that the mutant derivatives were
full length
and not C-terminally truncated.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 5.
Inhibition of activity by an antibody recognizing the C
terminus of Vpr. Shown are examples of currents generated in planar
lipid bilayers by WT Vpr (A), VprE58Q (B), and VprE24Q (C) at 0-mV
holding potential, before ("0mV") and after ("+AbC") addition
of 50 µl of affinity-purified antibodies raised against a peptide
(C21) comprising the C-terminal 21 amino acids of Vpr (see reference
27) to the trans chamber. The dashed
lines indicate the zero current levels. All-points histograms of the
data are plotted to the right of each trace.
|
|
The N-terminal region of Vpr forms ion channels and kills intact
neurons.
In an attempt to define a minimal region of Vpr that
could still form an ion channel, synthetic peptides consisting of the first 21 (N21) and 40 (N40) amino acids of Vpr (Table 1) were tested in
planar lipid bilayers. N21 did not cause any detectable currents in
planar lipid bilayers at various holding potentials in eight
experiments (Fig. 6B) in contrast to N40,
which produced ion channel activity in 22 experiments. Peptide
concentrations as low as 5 µM were observed to generate channel
activity. However, at this concentration, inconveniently long periods
of stirring were required before activity was observed. A 40 µM
concentration was found to produce activity within about 5 min after
addition to the cis chamber, and the size of the currents
was similar to those generated by full-length recombinant WT Vpr (at
approximately 2 to 20 nM). The channels had the same ion selectivity as
WT Vpr channels. Channels formed by N40 did not show rectification at positive potentials, consistent with the absence of the C-terminal region. Figure 6A depicts a typical example of currents induced by N40
at different holding potentials and the current-voltage relationship
(Fig. 6B). From these results, we conclude that the fundamental
channel-forming structure in Vpr is located in the N-terminal region of
the molecule and probably involves the predicted amphipathic
-helix
that includes amino acids 16 to 35.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 6.
Synthetic peptides: examples of currents generated in
planar lipid bilayers by N40 (A) and C21 (C and D) at different holding
potentials. The dashed lines indicate the zero current levels. The
average currents are plotted versus holding potential (B) for N40
(crosses), N21 (closed circles), and, for comparison, WT Vpr (open
circles). Currents generated by C21 are shown under normal experimental
conditions (C) or when phospholipids contained the negatively charged
lipid PS (D).
|
|
Qualitative assessments of transmembrane potential changes
in intact neurons were performed as previously described
with the
potential-sensitive dye DiBa-C4(3) (
28).
Extracellular addition
of N40 (at 1 mM) resulted in increased
fluorescence of the dye
as seen with WT Vpr (at approximately 1 µM
[Fig.
7A]), indicating
a similar level
of depolarization. The approximately 1,000-fold
relative potency
difference between full-length WT Vpr and N40
thus agreed very well
with the difference observed in the ability
to form channels in planar
lipid bilayers (see above).

View larger version (86K):
[in this window]
[in a new window]
|
FIG. 7.
Confocal images of hippocampal neurons in response to
the external application of purified Vpr (A), C21 (B), N40 (C), N21
(D), 200 mM KCl (E), and CHAPS buffer (F) with the potential-sensitive
dye DiBa-C4(3). Purified full-length Vpr or the synthetic peptides were
added to a final concentration of 1 µM or 1 mM, respectively. Images
were taken between 10 and 13 min after treatment at 37°C.
|
|
Exposure to N21 did not give an increased fluorescence (Fig.
7D),
indicating that the plasmalemma was not significantly depolarized
by
this peptide. It was concluded that the N-terminal 40 amino
acids of
Vpr are mainly responsible for the ability of WT Vpr
to depolarize the
plasmalemma of
neurons.
Death of cultured hippocampal neurons after exposure to N21 and N40 was
determined with PI in combination with CLSM (see Materials
and
Methods). Exposure to N40 and WT Vpr resulted in similar rates
of cell
death, while exposure to N21 did not result in cell killing
at rates
higher than those in control experiments with CHAPS buffer
(Fig.
8). The killing of neurons by the N40
peptide and by WT
Vpr is consistent with their ability to form ion
channels (Fig.
6) and to cause plasmalemma depolarization (Fig.
7).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 8.
Cytotoxic effects of extracellular addition of WT Vpr (1 µM) and Vpr peptides (1 mM) on hippocampal neurons expressed as
percentages of dead neurons. The figure shows the effects of exposure
to WT Vpr (open circles), N40 (crosses), C21 (filled diamonds), N21
(filled squares), and CHAPS buffer (open squares).
|
|
Unfortunately, it was not possible to inhibit depolarization or cell
killing with the antibodies specific to the N (AbN) or
C (AbC) terminus
of Vpr. While AbN actually activates the channel
activity of Vpr, AbC
does not recognize the folded structure of
Vpr in CHAPS buffer but
rather recognizes the C terminus (which
would be on the cytoplasmic
side of the membrane) only after the
conformational change that occurs
upon membrane insertion (
27).
For that reason, AbC could
also not be used for immunodepletion
experiments. Our conclusion that
the observed effects on neurons
are a property of the Vpr N-terminal
domain is thus based primarily
on the high degree of purity of the
full-length protein and N40
peptide (see Materials and Methods and also
Fig.
1B). Because
the WT Vpr and synthetic peptide were purified from
completely
independent sources which could not contain the same
contaminating
molecules, we can conclude that the effects are directly
attributable
to the predominant, common, Vpr-specific sequences in the
preparations
of both and not to two completely unrelated minor
contaminating
species.
A C-terminal peptide kills intact neurons.
A peptide
corresponding to the last 21 amino acids at the C terminus of Vpr (C21)
was also synthesized to assess its capacity to form ion channels and to
affect intact neurons. Under our usual experimental conditions, the C21
peptide did not produce currents in planar lipid bilayers nor did
exposure of intact neurons to extracellular C21 result in membrane
depolarization detectable by DiBa-C4(3) fluorescence (Fig. 7B).
However, this peptide consistently resulted in the highest rates of
cell death as indicated by PI fluorescence (Fig. 8). This is consistent
with the observations of Macreadie et al. (21), who reported
that externally added peptides corresponding to the C-terminal 21 to 26 amino acids of Vpr kill yeast cells.
We decided to investigate further the effect of C21 on planar lipid
bilayers. It was found that ionic currents could indeed
be observed
when the
trans chamber was held at very high negative
potentials (

100 mV). These currents ceased upon returning to
more
positive potentials (Fig.
6C). It has been reported previously
(
1) that highly basic peptides more readily induce ionic
currents
in membranes containing phospholipids with negatively charged
head groups. Accordingly, we tested C21 in planar lipid bilayers
containing PS (Fig.
6D). Under these conditions, currents were
observed
at more moderate voltages. WT Vpr and the N40 peptide
formed channels
with identical characteristics in the presence
or absence of PS (data
not
shown).
In summary, the C-terminal peptide of Vpr was found to be highly
cytotoxic, but because the conditions needed to induce ion
channel
activity with C21 were not required for ion channel activity
by
full-length Vpr or N40, and because the C21 peptide did not
cause
membrane depolarization detectable with the fluorescent
dye, we
conclude that the cell killing by C21 may be caused by
a mechanism
different from that of WT Vpr. Further, while both
regions of Vpr have
cytotoxic effects on intact neurons, it appears
that the N-terminal
region of Vpr forms ion channels more readily
than does the C-terminal
region, which requires higher potentials
or the presence of negatively
charged phospholipids to form channels.
In addition, the cytotoxicity
of the C-terminal region is clearly
reduced when it is incorporated
into full-length Vpr. Therefore,
the N-terminal region is more likely
to be responsible for detrimental
effects of Vpr on neurons (which may
lead to AIDS dementia) during
human HIV
infection.
 |
DISCUSSION |
The results here identify the N-terminal region of Vpr, proposed
to contain an amphipathic
-helix (amino acids 16 to 35), as the
region responsible for ion channel formation by WT Vpr in planar lipid
bilayers. The N-terminal peptide, N40, causes gross depolarization of
the plasmalemma in neurons similar to that caused by WT Vpr and N40
kills cultured rat hippocampal neurons at a rate similar to that for WT
Vpr, suggesting that ion channels formed by the N-terminal region of
Vpr may be important for its depolarizing and cytotoxic effects. The
ability of Vpr to form ion channels, depolarize the plasmalemma, and
kill neurons could thus be mimicked by the first 40 N-terminal amino
acids of Vpr. The N-terminal region of Vpr is highly conserved
(36) and has been proposed to play important roles in other
Vpr functions such as nuclear localization (8, 38), virion
incorporation (8, 24, 25, 38), and oligomerization
(39). A link between ion channel formation by Vpr and any of
these roles requires further investigation.
The N40 peptide is approximately 1,000-fold less potent than
full-length WT Vpr, both in its ability to form channels in planar lipid bilayers and in its ability to depolarize and kill neurons. Presumably, this reflects the fact that parts of Vpr additional to the
N terminus play a role in either membrane insertion or maintenance of
Vpr in the membrane. That both activities indicate the same difference
in potency between full-length Vpr and N40 supports the notion that the
activities are interrelated.
Our data showing that both E21Q and E24Q mutations in Vpr alter the ion
selectivity of the channel, together with the circular dichroism
studies (20) which show that the N-terminal region is
-helical, are consistent with the idea that both E21 and E24 are on
the same hydrophilic face of an amphipathic helix that either lines the
internal surface of the pore or contributes to a region of negative
charge involved in the cation selection mechanism.
Results from this study demonstrate that the hydrophobic region of Vpr
(amino acids 53 to 71), previously predicted to be the ion
channel-forming region (27), is not essential for Vpr to
form ion channels in planar lipid bilayers. Mutations disrupting this
structural region of Vpr (Vpr
2 and VprE58Q) resulted in ion channel
activity similar to that caused by WT Vpr (Fig. 2). Similarly,
C-terminal truncation and a point mutation in the C terminus did not
alter the ability of the mutants to form ion channels. The fact that a
peptide comprising the C-terminal 21 residues of Vpr was able to
conduct ions in planar lipid bilayers only under certain
conditions
high negative potential or in the presence of negatively
charged lipids, neither of which was needed for WT Vpr to form ion
channels
supports our previous conclusion that the C terminus of Vpr
does not play a major role in ion channel formation in lipid bilayers
but is rather responsible for the rectification of currents in WT Vpr
channel activity (27). The C-terminal peptide also failed to
cause membrane depolarization detectable with the fluorescent dye in
hippocampal neurons.
It has recently been reported (2, 21) that the extracellular
application of synthetic peptides encompassing parts of the C-terminal
region of Vpr including the conserved H(F/S)RIG domain can cause
membrane permeabilization and cell death in yeast and mitochondrial
dysfunction in CD4+ lymphocytes. Interestingly, the
transmembrane potential in yeast and mitochondria is in the range of
150 to
200 mV (5, 37), which is similar to the
potentials required to initiate ion channel activity in planar lipid
bilayer experiments in this study. Neurons, in contrast, maintain
transmembrane potentials of
50 to
75 mV, which are below the
required potential for induction of ion channel activity observed with
C21. We were unable to detect plasmalemma depolarization with the
fluorescent dye in hippocampal neurons exposed to C21 (Fig. 7),
although we did observe cytotoxic effects (Fig. 8). Thus, although we
conclude that the Vpr N terminus is responsible for ion channel
formation, plasmalemma depolarization, and neuronal death caused by
full-length Vpr, we cannot exclude the possibility that the C terminus
has additional roles under certain conditions in particular cell types.
Further studies are needed to elucidate the cause of the cytotoxic
activity of the C-terminal region of Vpr and its physiological relevance.
In conclusion, our results clearly indicate that the N-terminal domain
of Vpr is the main region responsible for cation-selective channel
activity in planar lipid bilayers and, more importantly, for the
extracellular effects of Vpr on cultured hippocampal neurons including
gross plasmalemma depolarization and cell death. Interestingly, preliminary results suggest that these effects are cell specific as
they were not observed in cultured rat hepatoma cells exposed to WT Vpr
(see also reference 28). Vpr has been reported to be
present in the serum of AIDS patients (18), where because enzyme-linked immunosorbent assay quantification was not significantly affected by freezing and thawing or the presence of virus-disrupting agents, it was concluded that the majority of the Vpr was in a non-virus-associated form (1 to 100 pM). Although in this work we use a
relatively high concentration of Vpr (1 µM) to facilitate our assays,
in a previous study (28) we report that application of Vpr
at 0.6 nM to hippocampal neurons caused a large cation current to be
detected. It is feasible that, in vivo, long-term exposure to even
lower concentrations of free Vpr may be able to impair neuron function.
If the ion channel function of Vpr, which can cause plasmalemma
depolarization and cell death, proves to be involved in causing
neurological disorders observed in AIDS patients with high Vpr levels
in the cerebrospinal fluid in vivo, new therapeutic approaches to block
the Vpr ion channel may conceivably assist in treating these AIDS symptoms.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Membrane Biology
Program, John Curtin School of Medical Research, Australian National University, Canberra, ACT 2601, Australia. Phone: 612-6249-2759. Fax:
612-6249-0415. E-mail: Graeme.Cox{at}anu.edu.au.
Present address: Department of Microbiology, University of Alabama,
Birmingham, Ala.
 |
REFERENCES |
| 1.
|
Agawa, Y.,
S. Lee,
S. Ono,
H. Aoyagi,
T. Taniguchi,
K. Anzai, and Y. Kirino.
1991.
Interaction with phospholipid bilayers, ion channel formation, and antimicrobial activity of basic amphipathic alpha-helical model peptides of various chain lengths.
J. Biol. Chem.
266:20218-20222[Abstract/Free Full Text].
|
| 2.
|
Arunagiri, C.,
I. G. Macreadie,
D. Hewish, and A. A. Azad.
1997.
A C-terminal domain of HIV-1 accessory protein Vpr is involved in penetration, mitochondrial dysfunction and apoptosis of human CD4+ lymphocytes.
Apoptosis
2:69-76.
[Medline] |
| 3.
|
Balliet, J. W.,
D. L. Kolson,
G. Eiger,
F. M. Kim,
K. A. McGann,
A. Srinivasan, and R. Collman.
1994.
Distinct effects in primary macrophages and lymphocytes of the human immunodeficiency virus type 1 accessory genes vpr, vpu, and nef: mutational analysis of a primary HIV-1 isolate.
Virology
200:623-631[Medline].
|
| 4.
|
Bartz, S. R.,
M. E. Rogel, and M. Emerman.
1996.
Human immunodeficiency virus type 1 cell cycle control: Vpr is cytostatic and mediates G2 accumulation by a mechanism which differs from DNA damage checkpoint control.
J. Virol.
70:2324-2331[Abstract].
|
| 5.
|
Berry, E. A., and P. C. Hinkle.
1983.
Measurement of the electrochemical proton gradient in submitochondrial particles.
J. Biol. Chem.
258:1474-1486[Abstract/Free Full Text].
|
| 6.
|
Bodeus, M.,
F. Margottin,
H. Dyrand,
E. Rouer, and R. Benarous.
1997.
Inhibition of prokaryotic cell growth by HIV1 Vpr.
Res. Virol.
148:207-213[Medline].
|
| 7.
|
Cohen, E. A.,
E. F. Terwilliger,
Y. Jalinoos,
J. Proulx,
J. G. Sodroski, and W. A. Haseltine.
1990.
Identification of HIV-1 vpr product and function.
J. Acquired Immune Defic. Syndr.
3:11-18.
|
| 8.
|
Di Marzio, P.,
S. Choe,
M. Ebright,
R. Knoblauch, and N. R. Landau.
1995.
Mutational analysis of cell cycle arrest, nuclear localization, and virion packaging of human immunodeficiency virus type 1 Vpr.
J. Virol.
69:7909-7916[Abstract].
|
| 9.
|
Emerman, M.
1996.
HIV-1, Vpr and the cell cycle.
Curr. Biol.
6:1096-1103[Medline].
|
| 10.
|
Ewart, G. D.,
T. Sutherland,
P. W. Gage, and G. B. Cox.
1996.
The Vpu protein of human immunodeficiency virus type 1 forms cation-selective ion channels.
J. Virol.
70:7108-7115[Abstract/Free Full Text].
|
| 11.
|
Gallay, P.,
V. Stitt,
C. Mundy,
M. Oettinger, and D. Trono.
1996.
Role of the karyopherin pathway in human immunodeficiency virus type 1 nuclear import.
J. Virol.
70:1027-1032[Abstract].
|
| 12.
|
He, J.,
S. Choe,
R. Walker,
P. Di Marzio,
D. O. Morgan, and N. R. Landau.
1995.
Human immunodeficiency virus type 1 viral protein R (Vpr) arrests cells in the G2 phase of the cell cycle by inhibiting p34cdc2 activity.
J. Virol.
69:6705-6711[Abstract].
|
| 13.
|
Heinzinger, N. K.,
M. I. Bukrinsky,
S. A. Haggerty,
A. M. Ragland,
V. Kewalramani,
M. A. Lee,
H. E. Gendelman,
L. Ratner,
M. Stevenson, and M. Emerman.
1994.
The Vpr protein of human immunodeficiency virus type 1 influences nuclear localization of viral nucleic acids in nondividing host cells.
Proc. Natl. Acad. Sci. USA
91:7311-7315[Abstract/Free Full Text].
|
| 14.
|
Holsinger, L. J.,
D. Nichani,
L. H. Pinto, and R. A. Lamb.
1994.
Influenza A virus M2 ion channel protein: a structure-function analysis.
J. Virol.
68:1551-1563[Abstract/Free Full Text].
|
| 15.
|
Jans, D. A.,
P. Jans,
L. J. Briggs,
V. Sutton, and J. A. Trapani.
1996.
Nuclear transport of granzyme B (fragmentin-2)-dependence on perforin in vivo and cytosolic factors in vitro.
J. Biol. Chem.
271:30781-30789[Abstract/Free Full Text].
|
| 16.
|
Jowett, J. B.,
V. Planelles,
B. Poon,
N. P. Shah,
M. L. Chen, and I. S. Y. Chen.
1995.
The human immunodeficiency virus type 1 vpr gene arrests infected T cells in the G2 + M phase of the cell cycle.
J. Virol.
69:6304-6313[Abstract].
|
| 17.
|
Levy, D. N.,
Y. Refaeli,
R. R. MacGregor, and D. B. Weiner.
1994.
Serum Vpr regulates productive infection and latency of human immunodeficiency virus type 1.
Proc. Natl. Acad. Sci. USA
91:10873-10877[Abstract/Free Full Text].
|
| 18.
|
Levy, D. N.,
Y. Refaeli, and D. B. Weiner.
1995.
The vpr regulatory gene of HIV.
Curr. Top. Microbiol. Immunol.
193:209-236[Medline].
|
| 19.
|
Lu, Y. L.,
P. Spearman, and L. Ratner.
1993.
Human immunodeficiency virus type 1 viral protein R localization in infected cells and virions.
J. Virol.
67:6542-6550[Abstract/Free Full Text].
|
| 20.
|
Luo, Z.,
D. J. Butcher,
R. Murali,
A. Srinivasan, and Z. Huang.
1998.
Structural studies of synthetic peptide fragments derived from the HIV-1 Vpr protein.
Biochem. Biophys. Res. Commun.
244:732-736[Medline].
|
| 21.
|
Macreadie, I. G.,
C. K. Arunagiri,
D. R. Hewish,
J. F. White, and A. A. Azad.
1996.
Extracellular addition of a domain of HIV-1 Vpr containing the amino acid sequence motif H(S/F)RIG causes cell membrane permeabilization and death.
Mol. Microbiol.
19:1185-1192[Medline].
|
| 22.
|
Macreadie, I. G.,
D. R. Thorburn,
D. M. Kirby,
L. A. Castelli,
N. L. Rozario, and A. A. Azad.
1997.
HIV-1 protein Vpr causes gross mitochondrial dysfunction in the yeast Saccharomyces cerevisiae.
FEBS Lett.
410:145-149[Medline].
|
| 23.
|
Mahalingam, S.,
R. G. Collman,
M. Patel,
C. E. Monken, and A. Srinivasan.
1995.
Functional analysis of HIV-1 Vpr: identification of determinants essential for subcellular localization.
Virology
212:331-339[Medline].
|
| 24.
|
Mahalingam, S.,
S. A. Khan,
M. A. Jabbar,
C. E. Monken,
R. G. Collman, and A. Srinivasan.
1995.
Identification of residues in the N-terminal acidic domain of HIV-1 Vpr essential for virion incorporation.
Virology
207:297-302[Medline].
|
| 25.
|
Mahalingam, S.,
S. A. Khan,
R. Murali,
M. A. Jabbar,
C. E. Monken,
R. G. Collman, and A. Srinivasan.
1995.
Mutagenesis of the putative alpha-helical domain of the Vpr protein of human immunodeficiency virus type 1: effect on stability and virion incorporation.
Proc. Natl. Acad. Sci. USA
92:3794-3798[Abstract/Free Full Text].
|
| 26.
|
Mandler, R. N.,
A. E. Schaffner,
E. A. Novotny,
G. D. Lange, and J. L. Barker.
1988.
Flow cytometric analysis of membrane potential in embryonic rat spinal cord cells.
J. Neurosci. Methods
22:203-213[Medline].
|
| 27.
|
Piller, S. C.,
G. D. Ewart,
A. Premkumar,
G. B. Cox, and P. W. Gage.
1996.
Vpr protein of human immunodeficiency virus type 1 forms cation-selective channels in planar lipid bilayers.
Proc. Natl. Acad. Sci. USA
93:111-115[Abstract/Free Full Text].
|
| 28.
|
Piller, S. C.,
P. Jans,
P. W. Gage, and D. A. Jans.
1998.
Extracellular HIV-1 virus protein R causes a large inward current and cell death in cultured hippocampal neurons: implications for AIDS pathology.
Proc. Natl. Acad. Sci. USA
95:4595-4600[Abstract/Free Full Text].
|
| 29.
|
Pinto, L. H.,
G. R. Dieckmann,
C. S. Gandhi,
C. G. Papworth,
J. Braman,
M. A. Shaughnessy,
J. D. Lear,
R. A. Lamb, and W. F. DeGrado.
1997.
A functionally defined model for the M2 proton channel of influenza A virus suggests a mechanism for its ion selectivity.
Proc. Natl. Acad. Sci. USA
94:11301-11306[Abstract/Free Full Text].
|
| 30.
|
Planelles, V.,
J. B. Jowett,
Q. X. Li,
Y. Xie,
B. Hahn, and I. S. Chen.
1996.
Vpr-induced cell cycle arrest is conserved among primate lentiviruses.
J. Virol.
70:2516-2524[Abstract].
|
| 31.
|
Premkumar, L. S.,
P. W. Gage, and S. H. Chung.
1990.
Coupled potassium channels induced by arachidonic acid in cultured neurons.
Proc. R. Soc. Lond. B Biol. Sci.
242:17-22[Medline].
|
| 32.
|
Re, F.,
D. Braaten,
E. K. Franke, and J. Luban.
1995.
Human immunodeficiency virus type 1 Vpr arrests the cell cycle in G2 by inhibiting the activation of p34cdc2-cyclin B.
J. Virol.
69:6859-6864[Abstract].
|
| 33.
|
Schubert, U.,
A. V. Ferrer Montiel,
M. Oblatt Montal,
P. Henklein,
K. Strebel, and M. Montal.
1996.
Identification of an ion channel activity of the Vpu transmembrane domain and its involvement in the regulation of virus release from HIV-1-infected cells.
FEBS Lett.
398:12-18[Medline].
|
| 34.
|
Stewart, S. A.,
B. Poon,
J. B. Jowett, and I. S. Chen.
1997.
Human immunodeficiency virus type 1 Vpr induces apoptosis following cell cycle arrest.
J. Virol.
71:5579-5592[Abstract].
|
| 35.
|
Sunstrom, N. A.,
L. S. Premkumar,
A. Premkumar,
G. Ewart,
G. B. Cox, and P. W. Gage.
1996.
Ion channels formed by NB, an influenza B virus protein.
J. Membr. Biol.
150:127-132[Medline].
|
| 36.
|
Tristem, M.,
C. Marshall,
A. Karpas, and F. Hill.
1992.
Evolution of the primate lentiviruses: evidence from vpx and vpr.
EMBO J.
11:3405-3412[Medline].
|
| 37.
|
Vacata, V.,
A. Kotyk, and K. Sigler.
1981.
Membrane potentials in yeast cells measured by direct and indirect methods.
Biochim. Biophys. Acta
643:265-268[Medline].
|
| 38.
|
Yao, X. J.,
R. A. Subbramanian,
N. Rougeau,
F. Boisvert,
D. Bergeron, and E. A. Cohen.
1995.
Mutagenic analysis of human immunodeficiency virus type 1 Vpr: role of a predicted N-terminal alpha-helical structure in Vpr nuclear localization and virion incorporation.
J. Virol.
69:7032-7044[Abstract].
|
| 39.
|
Zhao, L. J.,
L. Wang,
S. Mukherjee, and O. Narayan.
1994.
Biochemical mechanism of HIV-1 Vpr function. Oligomerization mediated by the N-terminal domain.
J. Biol. Chem.
269:32131-32137[Abstract/Free Full Text].
|
| 40.
|
Zhou, Y.,
Y. Lu, and L. Ratner.
1998.
Arginine residues in the C-terminus of HIV-1 Vpr are important for nuclear localization and cell cycle arrest.
Virology
242:414-424[Medline].
|
Journal of Virology, May 1999, p. 4230-4238, Vol. 73, No. 5
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Romani, B., Engelbrecht, S.
(2009). Human immunodeficiency virus type 1 Vpr: functions and molecular interactions. J. Gen. Virol.
90: 1795-1805
[Abstract]
[Full Text]
-
Kroemer, G., Galluzzi, L., Brenner, C.
(2007). Mitochondrial Membrane Permeabilization in Cell Death. Physiol. Rev.
87: 99-163
[Abstract]
[Full Text]
-
Chanturiya, A. N., Basanez, G., Schubert, U., Henklein, P., Yewdell, J. W., Zimmerberg, J.
(2004). PB1-F2, an Influenza A Virus-Encoded Proapoptotic Mitochondrial Protein, Creates Variably Sized Pores in Planar Lipid Membranes. J. Virol.
78: 6304-6312
[Abstract]
[Full Text]
-
Griffin, S. D. C., Harvey, R., Clarke, D. S., Barclay, W. S., Harris, M., Rowlands, D. J.
(2004). A conserved basic loop in hepatitis C virus p7 protein is required for amantadine-sensitive ion channel activity in mammalian cells but is dispensable for localization to mitochondria. J. Gen. Virol.
85: 451-461
[Abstract]
[Full Text]
-
Bruns, K., Fossen, T., Wray, V., Henklein, P., Tessmer, U., Schubert, U.
(2003). Structural Characterization of the HIV-1 Vpr N Terminus: EVIDENCE OF cis/trans-PROLINE ISOMERISM. J. Biol. Chem.
278: 43188-43201
[Abstract]
[Full Text]
-
Coeytaux, E., Coulaud, D., Le Cam, E., Danos, O., Kichler, A.
(2003). The Cationic Amphipathic alpha -Helix of HIV-1 Viral Protein R (Vpr) Binds to Nucleic Acids, Permeabilizes Membranes, and Efficiently Transfects Cells. J. Biol. Chem.
278: 18110-18116
[Abstract]
[Full Text]
-
Garden, G. A., Budd, S. L., Tsai, E., Hanson, L., Kaul, M., D'Emilia, D. M., Friedlander, R. M., Yuan, J., Masliah, E., Lipton, S. A.
(2002). Caspase Cascades in Human Immunodeficiency Virus-Associated Neurodegeneration. J. Neurosci.
22: 4015-4024
[Abstract]
[Full Text]
-
Basanez, G., Zimmerberg, J.
(2001). HIV and Apoptosis: Death and the Mitochondrion. JEM
193: f11-f14
[Full Text]
-
Jacotot, E., Ravagnan, L., Loeffler, M., Ferri, K. F., Vieira, H. L.A., Zamzami, N., Costantini, P., Druillennec, S., Hoebeke, J., Briand, J. P., Irinopoulou, T., Daugas, E., Susin, S. A., Cointe, D., Xie, Z. H., Reed, J. C., Roques, B. P., Kroemer, G.
(2000). The HIV-1 Viral Protein R Induces Apoptosis via a Direct Effect on the Mitochondrial Permeability Transition Pore. JEM
191: 33-46
[Abstract]
[Full Text]