Previous Article | Next Article ![]()
Journal of Virology, May 1999, p. 4197-4207, Vol. 73, No. 5
Department of Pediatrics, Stanford University
School of Medicine, Stanford, California 94305
Received 23 November 1998/Accepted 8 February 1999
Varicella-zoster virus (VZV) is an alphaherpesvirus that is the
causative agent of chickenpox and herpes zoster. VZV open reading frame
5 (ORF5) encodes glycoprotein K (gK), which is conserved among
alphaherpesviruses. While VZV gK has not been characterized, and its
role in viral replication is unknown, homologs of VZV gK in herpes
simplex virus type 1 (HSV-1) and pseudorabies virus (PRV) have been
well studied. To identify the VZV ORF5 gene product, we raised a
polyclonal antibody against a fusion protein of ORF5 codons 25 to 122 with glutathione S-transferase and used it to study the
protein in infected cells. A 40,000-molecular-weight protein was
detected in cell-free virus by Western blotting. In immunogold electron
microscopic studies, VZV gK was in enveloped virions and was evenly
distributed in the cytoplasm in infected cells. To determine the
function of VZV gK in virus growth, a series of gK deletion mutants
were constructed with VZV cosmid DNA derived from the Oka strain. Full
and partial deletions in gK prevented viral replication when the gK
mutant cosmids were transfected into melanoma cells. Insertion of the
HSV-1 (KOS) gK gene into the endogenous VZV gK site did not compensate
for the deletion of VZV gK. The replacement of VZV gK at a nonnative AvrII site in the VZV genome restored the phenotypic
characteristics of intact recombinant Oka (rOka) virus. Moreover, gK
complementing cells transfected with a full gK deletion mutant
exhibited viral plaques indistinguishable from those of rOka. Our
results are consistent with the studies of gK proteins of HSV-1 and PRV
showing that gK is indispensable for viral replication.
Varicella-zoster virus (VZV) is a
human herpesvirus. It is the causative agent of chickenpox and
shingles; the latter disease is a recurrent infection after a prolonged
latency (2). VZV contains a 125-kb genome which encodes the
six glycoproteins gB, gC, gE, gH, gI, and gL as well as two putative
glycoproteins, gK and gM (9). VZV open reading frame 5 (ORF5) is the homolog of gK proteins in alphaherpesviruses. Although gK
proteins in herpes simplex virus type 1 (HSV-1) and pseudorabies virus
(PRV) have been characterized and their functions in viral replication have been studied (17, 20, 22), the VZV ORF5 gene product has not been described previously. Glycoprotein K is considered to be
essential for viral replication in HSV-1 and PRV, since mutant viruses
with insertions or deletions in the UL53 ORF cannot grow in tissue
culture (17, 22). Viruses with mutations in gK genes can be
recovered only from gK complementing cells, indicating that gK proteins
in HSV-1 and PRV are indispensable for viral replication. Function
studies of HSV-1 gK partial deletion mutants indicated that gK is
required for viral egress as well as for capsid envelopment (17,
20). Two PRV gK insertion mutants, in which the UL53 ORF was
truncated after codon 164, produced very few extracellular virions.
Although the plating efficiencies of wild-type and gK mutant PRV were
similar, the gK mutant formed only single infected cells or smaller
plaques, indicating that PRV gK is essential for virus egress but not
for entry. A possible role for gK in blocking viral reinfection was
also suggested (22).
The formation of syncytia is the hallmark of VZV infection in tissue
culture cells. VZV spreads only by cell-cell fusion in tissue culture.
VZV glycoproteins gE, gH, gI, and gL are thought to be involved in cell
fusion. Full or partial deletions of gI resulted in the inhibition of
syncytium formation, indicating that gI acts as a fusion regulator or
is directly involved in membrane fusion (24). VZV gH is
defined as a fusogenic protein, since an anti-gH monoclonal antibody
blocks cell-cell spread (32). The fusogenic property of gH
may be regulated by gL (12). In addition to viral
glycoproteins, disruption of the VZV dUTPase and the adjacent
ORF9A also results in reduced syncytium formation in vitro
(34). In contrast to VZV, wild-type HSV does not form syncytia in cell culture. In some HSV strains, the majority of syncytial (syn) mutations analyzed were mapped to the gK gene, although
other syn mutations are located in the gene products gB, UL20, and UL24
(3, 5, 6, 11, 19, 25, 31). HSV-1 gK may play a role in
regulating the cell fusion process, but it is still unclear how the gK
syn mutations affect other functions of the protein.
The predicted amino acid sequence of the VZV ORF5 protein contains
putative glycosylation sites and hydrophobic domains that are similar
in structure and position to those of gK homologs (Table
1) in the alphaherpesvirus subfamily
(26). VZV gK has 28 and 33% amino acid identity with its
HSV-1 and PRV homologs, respectively (4, 10). The purpose of
this study was to characterize the homolog of HSV-1 gK by in vitro
translation, by using anti-gK antibody to identify the ORF5 gene
product in infected cells, and to study the functions of VZV
glycoprotein K in viral replication and its effects on the formation of
syncytia. Our data suggest that VZV gK is essential for viral
replication and is a component of the virion. In cell culture or skin
tissue, gK is located in the cytoplasm as well as on the cell surface.
Transfection of recombinant Oka (rOka) or gK deletion cosmids into
gK-expressing cells produced smaller plaques, suggesting that the
constitutive expression of gK may inhibit cell-to-cell spread and cell
fusion.
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Characterization of Varicella-Zoster Virus
Glycoprotein K (Open Reading Frame 5) and Its Role in Virus
Growth
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
VZV ORF5 homologsa
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cells and gK-expressing cell line. Human melanoma cells were grown in Dulbecco minimal essential medium supplemented with 12% fetal calf serum, penicillin-streptomycin, and amphotericin B (Fungizone). The complementing cell line containing the ORF5 gene was constructed by inserting a PCR fragment containing the VZV gK-coding region into TA cloning sites of the pCR3.1 plasmid vector (Invitrogen, Carlsbad, Calif.) to make the plasmid pCRgK. Subconfluent melanoma cell monolayers were transfected with pCRgK by the Lipofectin method. G418 was added to the medium, and colonies of G418-resistant cells were isolated. Genomic DNAs from gK-transformed cells were analyzed by PCR by using primers gKf and gKb. The expected 1.1-kb ORF5 DNA fragment was detected. K9 is one the cell lines used for cosmid transfection.
Construction of plasmids. The entire VZV genome of the Oka strain is contained in the following four overlapping SuperCos 1 cosmid vectors: pvFsp4 (nucleotides [nt] 1 to 33211), pvSpe5 (nt 21875 to 62008), pvPme19 (nt 53877 to 96188), and pvSpe21 nt 94208 to 124884) (24). ORF5 spans VZV nt 4252 to 5274, located within the unique long region in the cosmid pvFsp4. An XhoI-SacI 11.4-kb fragment (nt 23 to 11433) containing the gK ORF was subcloned into the plasmid vector pBS to generate pBS-XhoSac11.4. VZV gK was amplified from pBS-XhoSac11.4 with a T7 promoter sequence added at the upstream of ORF5, using primers gKf and gKb (5'-TAATACGACTCACTATAGGGATGCAGGCTTTAGGAATC-3' and 5'-TTAATGCTTCTGGGAGTTTTC-3'). The PCR DNA was ligated into the pCR3.1 TA cloning vector, forming plasmid pCRgK.
In vitro transcription.
Plasmid DNA pCRgK was digested with
EcoRI, and the fragment containing the T7 promoter and gK
ORF was used as the template; mRNA was transcribed by using an in vitro
T7 transcription kit (MEGAscript; Ambion, Austin, Tex.). Briefly, each
transcription reaction contained 1 µg of DNA template, 1×
transcription buffer, 7.5 mM (each) nucleoside triphosphate, 1× T7 RNA
polymerase mix, and nuclease-free water in a total volume of 20 µl.
The transcription mixture was incubated at 37°C for 2 h. Then
mRNAs were precipitated by 10 µl of LiCl at
80°C. RNA pellets
were washed with 50 µl of 80% ethanol and redissolved in
nuclease-free water. RNA transcripts were analyzed by agarose gel
electrophoresis before being used for in vitro translation reactions.
In vitro translation. RNAs were translated in vitro by using a reticulocyte lysate system (Promega, Madison, Wis.). Typically, a 25-µl translational mixture contained 1 to 2 µg of RNA, 2.5 µCi of [35S]methionine (Amersham, Arlington Heights, Ill.), 20 U of RNasin ribonuclease inhibitor, 0.01 mM amino acid mixture (without methionine), and 12.5 µl of rabbit reticulocyte lysate (30). Nuclease-treated microsome membranes (3.5 µl) were added to certain reaction mixtures when posttranslational processing was needed. After 90 min of incubation at 30°C, samples were analyzed on sodium dodecyl sulfate (SDS)-polyacrylamide gels.
Glycosidase treatment.
Endoglycosidase H (endo H) and
O-glycosidase (Boehringer Mannheim, Indianapolis, Ind.) were
used for carbohydrate digestion of gK proteins. To test for endo H
sensitivity, samples of translation reactions were digested by adding 1 µl of 1-U/µl endo H or O-glycosidase with 1 M
-mercaptoethanol and 1% Triton X-100. These samples were incubated
at 37°C for 2 h before SDS-polyacrylamide gel electrophoresis (PAGE) analysis.
Preparation of GST-gK fusion proteins and antisera.
The gK
amino-terminal region was amplified from pBS-XhoSac11.4 by PCR with
primers containing BamHI sites. The PCR product was digested
with BamHI and inserted into the expression vector pGEX-2T
(Pharmacia Biotech, Milwaukee, Wis.). The resulting plasmid, pGSTNgK,
contained nt 75 to 366 of ORF5 fused to the glutathione S-transferase (GST) gene. Plasmid DNA with the proper insert
orientation was used to transform Escherichia coli DH5
for expression of GST fusion proteins. Induced proteins were obtained
by the method of Frangioni and Neel (14). The GSTNgK fusion
protein was separated on a preparative SDS-polyacrylamide gel. The gel
fragment containing the 36-kDa fusion protein was excised, homogenized
in phosphate-buffered saline (PBS), and used to raise anti-gK antibody.
After an initial intramuscular injection of 200 µg of 36-kDa fusion
protein, one rabbit was immunized four times at 2-week intervals with
100 µg of the fusion protein. Sera were collected before and after
immunization and stored at
20°C.
Western blot analysis.
Protein samples were separated on a
15% Laemmli gel and electrotransferred to a nitrocellulose membrane
(Immobilon P; Millipore, Bedford, Mass.). Polyclonal rabbit antiserum
(
gKN) at a dilution of 1:500 was used as the probe and detected with
donkey anti-rabbit antibody conjugated with horseradish peroxidase
(HRP; Amersham, Buckinghamshire, England) at a dilution of 1:1,000.
Virion purification. At 48 h postinfection, rOka-infected cells were harvested by trypsinization and divided into two portions. Part of the cell suspension was sonicated to release the highly cell-associated virus and then filtered through a 0.2-µm-pore-size filter. Cell-free virions were recovered from the filtrate. The purity of the cell-free virus preparation was verified by Western blot analysis with antibodies specific for VZV gE, the most abundant VZV glycoprotein on the cell surface (28), or ORF61, a heterogeneous phosphoprotein in the nucleus of infected cells (36).
Fluorescence microscopy.
Melanoma cell monolayers growing on
glass coverslips were either mock infected or inoculated with
VZV-infected cells at a dilution of 1:8. After 48 h, the cells
were fixed with 1% formaldehyde and permeabilized with 0.2% Triton
X-100. The cells were incubated with rabbit preimmune serum or
polyclonal rabbit anti-gK serum (
gKN) before the second antibody,
fluorescein isothiocyanate (FITC)-conjugated goat anti-rabbit
immunoglobulin G (IgG) (Molecular Probes, Eugene, Oreg.), was added.
Cells were examined with a Nikon fluorescence microscope.
gKN and goat
anti-rabbit FITC-conjugated antibody.
Confocal microscopy. Melanoma cell monolayers growing on glass coverslips were inoculated with VZV-infected cells at a dilution of 1:8. After 48 h, the cells were fixed with 1% formaldehyde and either permeabilized with 0.2% Triton X-100 or not permeabilized. The cells were incubated with primary anti-gI (6B5) and anti-gK sera containing 10% goat normal serum and subsequently washed with PBS-bovine serum albumin before incubation with Texas red-conjugated goat anti-mouse IgG and FITC-conjugated goat anti-rabbit IgG (Molecular Probes). The coverslips were washed with PBS and mounted on glass slides. Cells were examined with a Molecular Dynamics MultiProbe 2010 laser scanning confocal microscope.
Immunogold electron microscopy of VZV-infected melanoma
cells.
Melanoma cell monolayers were inoculated with VZV-infected
cells at a dilution of 1:8. After incubation for 72 h, cells with 4+ cytopathic effect (CPE) were harvested and resuspended in PBS buffer. To make cryosections for immunogold labeling, cells were fixed
with 4% paraformaldehyde and 0.5% glutaraldehyde. Then, the cell
pellet was embedded in 10% gelatin. The sample was cut into small
pieces and incubated in 2.6 M sucrose and 10% polyvinylpyrrolidone overnight. The sample on the specimen stub was frozen down and cut in
the cryochamber. The section was placed on a coated specimen grid
covered with a polyvinyl Formvar support film. The section-mounted grids were incubated in primary antibody
gKN at 1:50 or 1:100 dilution in PBS. After the section was washed four times with PBS,
10-nm-diameter gold-conjugated anti-rabbit goat serum (TED PELLA, Inc.,
Redding, Calif.) at 1:10 dilution was added.
Construction of VZV cosmids.
Unlike UL53 in HSV-1 or PRV,
the gK gene sequence does not overlap with its adjacent genes, ORF4 and
ORF6. For full deletion of VZV gK, primers Eag@2893
(GCAAAACGGCTGTAGGTCAA) and gKstop4896 (GAAGCATTGGCCATGTGACT) and primers gK@5919Msc
(TGCATGGCCAGTGGAAGA) and Hind3@8850
(CCCACTCGCTGTTGTTGCTT) were designed to amplify two sequence
fragments adjacent to the gK coding region. Mutagenized sequences are
underlined. Nucleotides were mutated to introduce MscI
restriction sites into primers gKstop4896 and gK@5919Msc. The PCR
product generated by Eag@2893 and gKstop4896 was digested with
EagI and MscI. The PCR product of gK@5919Msc and
Hind3@8850 was digested with MscI and
HindIII. pBS-XhoSac11.4 was digested with
EagI and HindIII, and the 8.3-kb fragment
containing the plasmid backbone was isolated. These three fragments
were ligated together to generate pBS
gK, which is deleted for the
entire gK coding region (VZV nt 4251 to 5279).
NgK, has a deletion in VZV nt 4738 to 5271, which encodes 178 amino acids of the N terminus. One hundred eighty-nine amino acids of the C terminus were deleted by PCR mutagenesis with primers Eag@2893 and delCgK4902 (CTCCCGCTAGCATTAATCAT) and
primers delCgK5460
(TGGGGGATGCTAGCTAACAG) and Hind3@8850. The PCR products were digested with
EagI/NheI and
NheI/HindIII, respectively. Ligation of the
two PCR fragments with the 8.3-kb fragment from pBS-XhoSac11.4 yielded
pBS
CgK, containing a deletion of VZV nt 4259 to 4822. Similarly,
primers Eag@2893 and delCgK4902 and primers delCgK5251
(ATGAGCGCTAGCCTACAAAA) and Hind3@8850 were used to delete 122 amino acids of the C
terminus of gK. Triple ligation of the PCR fragments with the plasmid
backbone generated pBS
CgK5251, containing a deletion of VZV nt 4259 to 4620.
Cosmid Fsp-HSVgK was constructed to replace VZV gK with HSV-1 gK. The
endogenous VZV gK coding region within pvFsp4 was deleted in a similar
manner, except for the creation of an NheI site at the
deleted gK site. PCR amplification of the surrounding regions was
performed with primers Eag@2893 and delCgK4902 and primers delNgK5910
and Hind3@8850. Triple ligation with the 8.3-kb
EagI-HindIII fragment from pBS-XhoSac11.4
generated a deletion of the VZV gK coding region (nt 4259 to 5271),
with an NheI restriction site introduced at the site of
deletion. The HSV gK coding region was PCR amplified from the plasmid
vector CMVgK PCR3.1, a kind gift from K. G. Kousoulas, Louisiana
State University. PCR primers HSVgK@2083
(CCATGCTAGCCGTCCGTTCC) and HSVgK@3104
(TTCCGCTAGCCTGGATGTGA) were designed to amplify
the 1.0-kb HSV gK coding region, with NheI sites introduced
at both termini. The HSV gK coding region was inserted into the
endogenous VZV gK site in the negative orientation to generate
pBS-HSVgK. The XhoI-SacI fragments within
plasmids pBS
gK, pBS
NgK, pBS
CgK, pBS
CgK5251, and pBS-HSVgK
were then subcloned back into the cosmid vector to generate Fsp
gK,
Fsp
NgK, Fsp
CgK, Fsp
CgK5251, and Fsp-HSVgK, respectively.
Cosmid gK-Spe21 was constructed to place the VZV gK coding region into
a unique AvrII site in pvSpe21 (24). The VZV gK
coding region as well as approximately 400 bp of surrounding noncoding sequence (nt 4144 to 5559) containing putative promoter sequences and a
polyadenylation site was amplified from the template pBS-XhoSac13.4, with AvrII sites introduced at the termini with
primers gK@4779Avr (GAGGCCTAGGCTGCAAAATA) and
gK@6200Avr (ATCGCCATCCCTAGGGACTG). The
PCR fragment and pvSpe21 were both digested with AvrII, and ligation of two AvrII fragments generated gK-Spe21.
Transfections. Twenty-four hours prior to transfection, 106 human melanoma cells were seeded into a 25-cm2 flask to generate a 25 to 50% confluency on the day of transfection. Five micrograms of pvFsp4, pvSpe5, and pvPme19 and 2.5 µg of pvSpe21 were digested with AscI to release the inserted VZV fragments from the cosmids. DNA from the four cosmids was pooled to a final volume of 200 µl. Transfection was performed with 80 or 120 µl of cosmid mix in 31.5 µl of 2 M CaCl2 in water and HEPES buffer. Cells were incubated at 37°C and passaged every 3 to 5 days for 4 weeks or until plaques were detected. DNAs from transfected cells were harvested when flasks showed a CPE of 3 to 4+ or at 3 weeks if no plaques were visible. DNA isolation was performed with DNazol reagent (Gibco BRL, Gaithersburg, Md.) as per manufacturer instructions.
Sequencing.
Transfections of the full gK deletion mutant
yielded no plaques. No viral DNA was detected by PCR amplification with
primers Eag@2893 and Hind3@8850. Consequently, cosmid DNA from
Fsp
gK was used to amplify the gK region for sequencing. The PCR
product was purified on Qiagen columns and quantified by gel
electrophoresis. The gK region of the PCR product was sequenced with
primer gKseq6200 (CGCCATCAAAAGGGACTG), a lower-strand
oligonucleotide primer designed to anneal 280 nt upstream of the gK
start codon. The gK regions of Fsp
NgK, Fsp
CgK, Fsp
CgK5251, and
FspHSVgK were also amplified from cosmid DNA with primers Eag@2893 and
Hind3@8850. Fsp
NgK was sequenced with primer gKseq6200. Fsp
CgK
and Fsp
CgK5251 were sequenced with primer gKseq4705
(AAGGTTCGTCTGGTAGCA), an upper-strand primer starting 200 nt
downstream of the gK stop codon. FspHSVgK was sequenced with both
primers gKseq6200 and gKseq4705. Cotransfection of Fsp
gK, pvSpe5,
pvPme19, and gK-Spe21 resulted in live virus. The gK region was PCR
amplified with primers Eag@2893 and Hind3@8850 to verify the deletion
in gK at the endogenous site. This region was sequenced with primer
gKseq6200. The AvrII region was PCR amplified with primers
VZV116194 and VZV117317 to verify the insertion of the gK cassette. The
DNA product was sequenced with primer Seq116936 as previously described
(24).
| |
RESULTS |
|---|
|
|
|---|
In vitro characterization of VZV ORF5 protein (gK).
The amino
acid sequence predicted from nucleotide sequence analysis of VZV ORF5
consists of 340 amino acids with putative glycosylation sites and
several hydrophobic domains (Fig. 1). To
study the ORF5 gene product by in vitro translation, the
EcoRI DNA fragment from pCRgK containing the T7 promoter and
the ORF5 sequence was used as a template for in vitro transcription.
The mRNA containing ORF5 was translated in vitro in the presence or absence of microsomal membranes. Protein samples were analyzed by
SDS-PAGE 15% (gel) (Fig. 2). A
glycosylation control (
-mating factor) was shown in lanes 1 to 4. In
the absence of microsomes, gK was synthesized as a
32,000-molecular-weight (32K) protein (lane 5). A few bands larger than
32 kDa were observed in the absence of microsomes. These appear to be
ubiquitin-conjugated gK proteins as described in HSV-1 gK studies
(26). In the presence of microsomes, the majority of this
protein was processed to a 37K form (lane 6).
|
|
Identification of the VZV ORF5 gene product, gK. To make antiserum against the ORF5 gene product, the BamHI fragment containing the amino-terminal amino acids 25 to 122 of gK was cloned into the pGEX-2T vector and the GSTgKN fusion protein was expressed in E. coli. The 36K fusion protein was gel purified and used for raising anti-gK antibody. This serum was tested by Western blot analysis. GST protein was detected at 26K in the extract from cells transformed with a GST expression vector (Fig. 3A, lane 1). GSTgKN is detected at 36K in the extract from GSTgKN-expressing cells and gel-purified gK fusion proteins (Fig. 3A, lanes 2 and 3). Only a single protein band at 40K is observed in the extracts from gK-transformed cells (Fig. 3B, lane 2) or rOKa-infected cells (lane 3). These proteins were not recognized by the preimmune serum. The results indicated that the rabbit polyclonal antibody can specifically recognize VZV gK as well as GST fusion protein. To determine whether gK was glycosylated, protein lysates from gK-expressing cells or virus-infected cells were subjected to endo H digestion. Most of the gK protein was resistant to glycosidase digestion as determined by Western blot analysis, indicating that N-linked oligosaccharides on gK are processed (data not shown).
|
VZV gK is distributed throughout the cytoplasm and surface membrane. Confocal microscopy was used to compare the localization of VZV gK and gI. VZV gI is found in the plasma membrane, the trans-Golgi network, and the endoplasmic reticulum (ER) (1). rOka-infected melanoma cells were grown on glass coverslips for 2 days, and cells were tested for surface immunofluorescence (Fig. 4A to C) or permeabilized to examine the internal distribution of gK and gI (Fig. 4D to I). When the cells were not permeabilized, there was granular, surface fluorescence (Fig. 4A and B) and gK was found to colocalize with gI (Fig. 4C). In permeabilized cells, gK was evenly distributed throughout the cytoplasm and surface membranes, whereas gI was localized primarily on the cell surface (F and I). VZV gK could be detected in infected skin tissue sections by anti-gK antibody. The staining pattern is the same as that seen in tissue culture cells (data not shown).
|
VZV gK is a component of the virion. Since VZV is highly associated with cells, cell-free virions were recovered from the filtrate passing through a 0.2-µm-pore-size filter. The purity of cell-free virus was verified by Western blot analysis with antibodies specific for gE, an envelope glycoprotein, or ORF61, a heterogeneous phosphoprotein in VZV-infected cell nuclei. The 98K gE protein was detected in the virion preparation as well as in infected cell lysate (Fig. 5C). On the other hand, a 62K protein was recognized by anti-ORF61 antibody in cell lysate but not in cell-free virus (Fig. 5B). To determine whether gK exists in the virion, Western blot analysis was done with anti-gK serum as the probe (Fig. 5A). The gK protein (arrow) was detected at 40K in the purified virions (rOka, F) as well as in infected cells (rOka, C). A gK-transformed cell line (K9) which expresses cell-associated gK was used as a control. A 40K protein was detected only in the cell lysate of K9 (C) but not in the filtrate of K9 (F). These data indicate that VZV gK may be a component of the virion.
|
|
Failure to generate infectious VZV from cosmids with full or
partial deletions of gK.
To determine the requirement of VZV gK
for virus growth, a series of gK deletion mutants were constructed with
VZV cosmid DNA derived from the Oka strain. Removal of VZV nt 4251 to
5279 from pvFsp4 resulted in a complete deletion of the gK coding
region (Fig. 7, line 4). Cotransfection
of cosmid clones containing full deletions of gK (Fsp
gK) with
pvSpe5, pvPme19, and pvSpe21 yielded no detectable viral plaques.
Transfections of Fsp
gK clones were repeated three times, with the
same negative result. DNA harvested from transfected cells at 3 weeks
posttransfection showed no detectable VZV DNA by PCR analysis. As a
positive control, intact cosmids pvFsp4, pvSpe5, pvPme19, and pvSpe21
were cotransfected in parallel with Fsp
gK. The wild-type cosmids
consistently yielded infectious virus, with plaques visible 6 days
posttransfection.
|
NgK has a 530-nt N-terminal deletion, removing 178 of the 340 amino acids of the gK coding region, including the first putative
transmembrane domain. The methionine start site is followed by
leucine-180. While several nucleotides were mutagenized to create the
NheI site, the leucine was preserved due to the degeneracy of the genetic code. The remainder of the triplet coding sequence was
retained in frame (Fig. 7, line 5). Fsp
CgK has a 560-nt/189-aa deletion of the C terminus, encompassing the second and third putative
transmembrane regions. A single base mutation designed in primer
delCgK5460 resulted in a stop codon immediately following cysteine-151
(Fig. 7, line 6). Fsp
CgK5251 possesses a 360-nt/122-aa C-terminal
deletion that also includes the second and third transmembrane regions.
A nucleotide substitution in primer delCgK5251 introduced a stop codon
immediately after leucine-218 (Fig. 7, line 7). Fsp
NgK, Fsp
CgK,
and Fsp
CgK5251 were transfected in parallel along with positive and
negative controls. As with the full deletion experiments, only the
transfection of overlapping intact rOka cosmids yielded plaques. These
results suggested that the intact gK protein was essential for viral
replication in melanoma cells.
To examine the possibility of overlapping function(s) between HSV and
VZV gK, VZV gK was replaced by the HSV gK coding sequence, generating a
transgenic clone that used the promoter and regulatory sequence of VZV
gK to drive the transcription of HSV gK. The HSV gK fragment was
inserted in a negative orientation because VZV ORF5 is transcribed from
the lower strand. Nucleotide substitutions to generate NheI
sites for insertional purposes did not alter the amino acid sequence
(Fig. 7, line 8). Cotransfection of Fsp-HSVgK was performed twice and
yielded no detectable viral plaques up to 4 weeks posttransfection,
indicating that HSV gK may not compensate for the deletion of VZV gK.
It should be noted that the transcription and translation of HSV gK
were not evaluated.
Generation and replication characteristics of rOka gK@AvrII with
insertion of the gK gene into a nonnative AvrII site.
gK-Spe21 contains ORF5 with 0.4 kb of surrounding noncoding sequence
(282 bp of upstream sequence) inserted into the AvrII site
at VZV nt 112853 in the negative orientation (Fig. 7, line 3).
Cotransfection of cosmids Fsp
gK (containing the full deletion of
gK), pvSpe5, pvPme19, and gK-Spe21 resulted in plaques that appeared
indistinguishable from those of rOka. PCR detection of DNA harvested
from these transfected cells showed the expected 1.0-kb deletion at the
endogenous gK site in pvFsp4 (PCR fragment size decreased from 6.0 to
5.0 kb) and the expected 1.4-kb insertion at the AvrII site
in pvSpe21 (PCR fragment size increased from 1.1 to 2.5 kb [data not
shown]). Our data suggest that gK might be indispensable for viral replication.
Plaque morphology of rOka and rOka gK deletion mutant.
To
further prove that VZV gK is essential for viral replication, we made
gK-expressing cell lines. Genomic DNAs from gK-transformed cells were
analyzed by PCR with primers gKf and gKb. The
expected 1.1-kb ORF5 DNA fragment was detected (data not shown). When
the protein lysate from gK-transformed cells was analyzed by Western blot analysis, a 40K protein band was observed with anti-gK antibody (Fig. 3B). Cotransfection of gK deletion cosmids into gK-complementing cells yielded viral plaques indistinguishable from those of intact rOka
cosmids. Compared with rOka in melanoma cells (Fig.
8a), rOka or
gKrOka replication in
gK-complementing cells formed smaller plaques and caused less CPE (Fig.
8c and d), suggesting that constitutive expression of gK may inhibit
syncytium formation.
|
| |
DISCUSSION |
|---|
|
|
|---|
In this first characterization of VZV ORF5, we found that it encoded a 40K glycosylated protein in VZV-infected cells and in gK-transformed melanoma cells. The apparent molecular weight of the protein was 32,000 when ORF5 was translated in vitro. In the presence of microsomes, most of the 32K product was processed to a form with a mass of 37K. Processed gK was sensitive to heat denaturation and contained N-linked oligosaccharides, as predicted from the protein sequence. VZV gK was distributed throughout the cytoplasm and was detected at cell surfaces after infection and in constitutively expressing cells. VZV gK was localized in a more punctate pattern, extending from the ER to the cell surface, compared with VZV gI, which was more diffuse on the surface of VZV-infected cells. The detection of VZV gK on the cell surface differed from the perinuclear pattern observed for HSV-1 gK (18). VZV gK was demonstrated to be a component of the virion, indicating that it could play a role in fusion of the virion envelope with the uninfected cell membrane. PRV gK has also been identified as a virion structural component, whereas HSV-1 gK has not been detected in virions (18, 22).
The differences in patterns of VZV and HSV-1 gK localization in cells and virions may imply that these related proteins contribute differently to the viral replication cycle and that some pathways required for viral assembly and egress are not common to these two human alphaherpesviruses (7, 15, 21). However, the characterization of herpesvirus gK gene products is hampered by the technical difficulties of generating potent antibodies that bind to these very hydrophobic membrane proteins. The antiserum against VZV gK, which was elicited with a fusion protein containing 98 amino acids of the gene product, may have enhanced detection of the relatively small quantities of this viral protein present in infected cells and virions by immunofluorescence and Western blot methods. HSV-1 gK has been detected primarily in perinuclear sites, consistent with the accepted model for HSV-1 assembly, in which viral nucleocapsids are enveloped at the inner nuclear membrane and then transported to the cell surface within vacuoles (7, 33). HSV gK appears to remain sensitive to endo H, indicating that it does not reach the Golgi but is retained in the ER and nuclear envelope (18). In our experiments, VZV gK was sensitive to endo H, but mature, resistant forms of the protein were also detected. The analysis of VZV replication indicates that the initial viral envelope, obtained at the inner nuclear membrane, does not contain any VZV glycoproteins (15, 16). Instead, the nascent viral particles appear to acquire VZV glycoproteins during transit through the trans-Golgi network. The generalized distribution of gK was similar to that of other VZV glycoproteins in infected cells and implies that gK is accessible for incorporation into virions at sites beyond the perinuclear area. The detection of VZV gK at multiple sites, including the ER, Golgi, and cytoplasm, indicates that VZV gK could act as a chaperone protein during viral egress. VZV gK was also detected diffusely in cutaneous epithelial cells in biopsies of varicella skin lesions, suggesting that the observations of gK trafficking in tissue culture cells were representative of its distribution during productive infection in vivo and were not associated only with the limited replication of VZV in vitro.
Although fusion has been considered to be a major function of the herpesvirus gK gene products, based on observations about the HSV-1 syn mutations, the biological activities of these proteins are not well understood. Recent HSV-1 gK and PRV gK experiments demonstrate that gK affects the movement of infectious virions from the regions of assembly to the cell surface and their release into extracellular spaces (20, 22). Our analysis of full and partial deletions of ORF5 demonstrated that VZV gK, like its homologs in HSV-1 and PRV, was critical for viral replication (17, 20, 22). HSV-1 gK mutants replicated to a limited degree in rapidly dividing cells, but these mutations were associated with accumulation of unenveloped virions in the cytoplasm (20). The requirement for VZV gK expression was documented by the restoration of infectivity by the insertion of the ORF5 sequence into a nonnative site in the Us region of the genome or by transfection into the gK-complementing cell line. The failure to generate infectious VZV from cosmid transfections when gK was deleted indicates that this glycoprotein must have an essential role in the VZV replication cycle in addition to any functions it may have related to viral entry. A connection between the occurrence of the HSV-1 syn mutation and the failure to release virus has been suggested (17). In the case of VZV, syncytium formation and cytoplasmic retention of virions, with extensive intracellular degradation, are characteristic of low-passage as well as tissue culture-adapted virus (2). Whether this phenotype reflects some specific interference with normal VZV gK function in vitro is of interest, since VZV replicates efficiently and infectious virus is released from differentiated T cells and skin in vivo (27). Of note, the residues to which HSV-1 gK syn mutations have been mapped are the same in VZV and wild-type HSV-1.
VZV gK and gB and the products of ORF35 and ORF39 are the homologs of HSV-1 gB and gK and the UL20 and UL24 proteins, to which fusion effects have been mapped (8, 35). In the case of HSV-1 gK, the fusion regulatory effect is considered to be inhibitory in nature, protecting against fusion with cellular membranes during intracellular transport. The syn mutation is thought to block an essential function of gK, allowing the enhanced expression of other HSV-1 proteins that make up the fusion complex on the cell surface. Our experiments indicate that VZV gK has some of the fusion inhibitory effects of HSV-1 gK. Plaques were smaller and cytopathic changes were more limited when infectious virus was generated by transfecting gK-expressing cells with intact rOka or with gK deletion cosmids. The overexpression of VZV gK in this cell line was associated with an inhibition of the characteristic syncytium formation expected with VZV replication in tissue culture cells.
The products of several VZV immediate-early genes, such as ORF61, ORF62, and ORF51, can complement the functions of their HSV-1 homologs (13, 29, 38). In contrast, the insertion of the HSV-1 gK sequence did not compensate for the deletion of VZV gK by restoring viral replication. This observation provides further evidence that while the glycoproteins of VZV and their homologs in HSV-1 have many structural similarities, their biological functions have important differences (8).
Our studies suggest an essential role for VZV gK, consistent with the observation that the gK homologs are almost as highly conserved as the gB homologs among alphaherpesvirus glycoproteins. VZV gK has four hydrophobic domains, indicating that it has a complex transmembrane structure. In HSV-1 gK, this complex tertiary structure was shown to be critical for its biological function (26). We found that relatively large partial deletions of the N-terminal or C-terminal residues of VZV gK which interfered with predicted extracellular domains were incompatible with viral replication. Important questions about gK function in VZV as well as in the other alphaherpesviruses remain to be addressed, including the role of gK in viral entry, membrane fusion between infected and adjacent cells, and virion transport out of the infected cell and the relationship of these putative functions to each other. The functional domains of gK that are required for VZV replication are being defined by site-directed mutagenesis in ORF5 constructs.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by Public Health Service grant AI20459 to A.M.A. C.M. was supported by a Medical School Dean's fellowship.
We thank Nafisa Ghori, Stanford University Department of Microbiology, for help with electron microscopy. We thank Chris Canfield and Susan Palmieri, Stanford University Cell Sciences Imaging Facility, for assistance with the confocal microscopy. We thank Charles Grose, University of Iowa, for providing anti-gI antibody and George Kemble, Aviron, Inc., for providing the VZV cosmids.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Pediatrics, Stanford University School of Medicine, 300 Pasteur Dr., Rm. S366, Stanford, CA 94305-5208. Phone: (650) 725-6555. Fax: (650) 725-8040. E-mail: cmo{at}cmgm.stanford.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Alconada, A.,
U. Bauer,
L. Baudoux,
J. Piette, and B. Hoflack.
1998.
Intracellular transport of the glycoproteins gE and gI of the varicella-zoster virus. gE accelerates the maturation of gI and determines its accumulation in the trans-Golgi network.
J. Biol. Chem.
273:13430-13436 |
| 2. | Arvin, A. M. 1996. Varicella-zoster virus, p. 2547-2585. In B. N. Fields, D. N. Knipe, P. M. Howley, R. M. Chanock, J. L. Melnick, T. P. Monath, B. Roizman, and S. E. Straus (ed.), Fields virology, 3rd ed. Lippincott-Raven, Philadelphia, Pa. |
| 3. |
Baines, J. D.,
P. L. Ward,
G. Campadelli-Fiume, and B. Roizman.
1991.
The UL20 gene of herpes simplex virus 1 encodes a function necessary for viral egress.
J. Virol.
65:6414-6424 |
| 4. | Baumeister, J., B. G. Klupp, and T. C. Mettenleiter. 1995. Pseudorabies virus and equine herpesvirus 1 share a nonessential gene which is absent in other herpesviruses and located adjacent to a highly conserved gene cluster. J. Virol. 69:5560-5567[Abstract]. |
| 5. | Bond, V. C., and S. Person. 1984. Fine structure physical map locations of alterations that affect cell fusion in herpes simplex virus type 1. Virology 132:368-376[Medline]. |
| 6. | Bzik, D. J., B. A. Fox, N. A. DeLuca, and S. Person. 1984. Nucleotide sequence of a region of the herpes simplex virus type 1 gB glycoprotein gene: mutations affecting rate of virus entry and cell fusion. Virology 137:185-190[Medline]. |
| 7. |
Campadelli-Fiume, G.,
F. Farabegoli,
S. Di Gaeta, and B. Roizman.
1991.
Origin of unenveloped capsids in the cytoplasm of cells infected with herpes simplex virus 1.
J. Virol.
65:1589-1595 |
| 8. | Cohen, J. I., and S. E. Straus. 1996. Varicella-zoster virus and its replication, p. 2525-2545. In B. N. Fields, D. N. Knipe, P. M. Howley, R. M. Chanock, J. L. Melnick, T. P. Monath, B. Roizman, and S. E. Straus (ed.), Fields virology, 3rd ed. Lippincott-Raven, Philadelphia, Pa. |
| 9. |
Davison, A. J., and J. E. Scott.
1986.
The complete DNA sequence of varicella-zoster virus.
J. Gen. Virol.
67:1759-1816 |
| 10. | Debroy, C., N. Pederson, and S. Person. 1985. Nucleotide sequence of a herpes simplex virus type 1 gene that causes cell fusion. Virology 145:36-48[Medline]. |
| 11. | DeLuca, N., D. J. Bzik, V. C. Bond, S. Person, and W. Snipes. 1982. Nucleotide sequences of herpes simplex virus type 1 (HSV-1) affecting virus entry, cell fusion, and production of glycoprotein gB (VP7). Virology 122:411-423[Medline]. |
| 12. | Duus, K. M., and C. Grose. 1996. Multiple regulatory effects of varicella-zoster virus (VZV) gL on trafficking patterns and fusogenic properties of VZV gH. J. Virol. 70:8961-8971[Abstract]. |
| 13. |
Felser, J. M.,
S. E. Straus, and J. M. Ostrove.
1987.
Varicella-zoster virus complements herpes simplex virus type 1 temperature-sensitive mutants.
J. Virol.
61:225-228 |
| 14. | Frangioni, J. V., and B. G. Neel. 1993. Solubilization and purification of enzymatically active glutathione S-transferase (pGEX) fusion proteins. Anal. Biochem. 210:179-187[Medline]. |
| 15. |
Gershon, A. A.,
D. L. Sherman,
Z. Zhu,
C. A. Gabel,
R. T. Ambron, and M. D. Gershon.
1994.
Intracellular transport of newly synthesized varicella-zoster virus: final envelopment in the trans-Golgi network.
J. Virol.
68:6372-6390 |
| 16. | Harson, R., and C. Grose. 1995. Egress of varicella-zoster virus from the melanoma cell: a tropism for the melanocyte. J. Virol. 69:4994-5010[Abstract]. |
| 17. | Hutchinson, L., and D. C. Johnson. 1995. Herpes simplex virus glycoprotein K promotes egress of virus particles. J. Virol. 69:5401-5413[Abstract]. |
| 18. | Hutchinson, L., C. Roop-Beauchamp, and D. C. Johnson. 1995. Herpes simplex virus glycoprotein K is known to influence fusion of infected cells, yet is not on the cell surface. J. Virol. 69:4556-4563[Abstract]. |
| 19. |
Jacobson, J. G.,
S. L. Martin, and D. M. Coen.
1989.
A conserved open reading frame that overlaps the herpes simplex virus thymidine kinase gene is important for viral growth in cell culture.
J. Virol.
63:1839-1843 |
| 20. | Jayachandra, S., A. Baghian, and K. G. Kousoulas. 1997. Herpes simplex virus type 1 glycoprotein K is not essential for infectious virus production in actively replicating cells but is required for efficient envelopment and translocation of infectious virions from the cytoplasm to the extracellular space. J. Virol. 71:5012-5024[Abstract]. |
| 21. |
Johnson, D. C., and P. G. Spear.
1982.
Monensin inhibits the processing of herpes simplex virus glycoproteins, their transport to the cell surface, and the egress of virions from infected cells.
J. Virol.
43:1102-1112 |
| 22. |
Klupp, B. G.,
J. Baumeister,
P. Dietz,
H. Granzow, and T. C. Mettenleiter.
1998.
Pseudorabies virus glycoprotein gK is a virion structural component involved in virus release but is not required for entry.
J. Virol.
72:1949-1958 |
| 23. | Kyte, J., and R. F. Doolittle. 1982. A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157:105-132[Medline]. |
| 24. | Mallory, S., M. Sommer, and A. M. Arvin. 1997. Mutational analysis of the role of glycoprotein I in varicella-zoster virus replication and its effects on glycoprotein E conformation and trafficking. J. Virol. 71:8279-8288[Abstract]. |
| 25. |
McGeoch, D. J.,
M. A. Dalrymple,
A. J. Davison,
A. Donlan,
M. C. Frame,
D. McNab,
L. J. Perry,
J. E. Scott, and P. Taylor.
1988.
The complete DNA sequence of the long unique region in the genome of herpes simplex virus type 1.
J. Gen. Virol.
69:1531-1574 |
| 26. |
Mo, C., and T. C. Holland.
1997.
Determination of the transmembrane topology of herpes simplex virus type 1 glycoprotein K.
J. Biol. Chem.
272:33305-33311 |
| 27. |
Moffat, J. F.,
L. Zerboni,
P. R. Kinchington,
C. Grose,
H. Kaneshima, and A. M. Arvin.
1998.
Attenuation of the vaccine Oka strain of varicella-zoster virus and role of glycoprotein C in alphaherpesvirus virulence demonstrated in the SCID-hu mouse.
J. Virol.
72:965-974 |
| 28. |
Montalvo, E. A.,
R. T. Parmley, and C. Grose.
1985.
Structural analysis of the varicella-zoster virus gp98-gp62 complex: posttranslational addition of N-linked and O-linked oligosaccharide moieties.
J. Virol.
53:761-770 |
| 29. |
Moriuchi, H.,
M. Moriuchi,
H. A. Smith,
S. E. Straus, and J. I. Cohen.
1992.
Varicella-zoster virus open reading frame 61 protein is functionally homologous to herpes simplex virus type 1 ICP0.
J. Virol.
66:7303-7308 |
| 30. | Pelham, H. R., and R. J. Jackson. 1976. An efficient mRNA-dependent translational system from reticulocyte lysates. Eur. J. Biochem. 67:247-256[Medline]. |
| 31. | Pogue-Guile, K. L., and P. G. Spear. 1987. The single base pair substitution responsible for the syn phenotype of herpes simplex virus type 1, strain MP. Virology 157:67-74[Medline]. |
| 32. | Rodriguez, J. E., T. Moninger, and C. Grose. 1993. Entry and egress of varicella virus blocked by same anti-gH monoclonal antibody. Virology 196:840-844[Medline]. |
| 33. | Roizman, B., and A. E. Sears. 1996. Herpes simplex viruses and their replication, p. 1043-1107. In B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fundamental virology, 3rd ed. Lippincott-Raven Publishers, Philadelphia, Pa. |
| 34. | Ross, J., M. Williams, and J. I. Cohen. 1997. Disruption of the varicella-zoster virus dUTPase and the adjacent ORF9A gene results in impaired growth and reduced syncytia formation in vitro. Virology 234:186-195[Medline]. |
| 35. | Spear, P. G. 1993. Membrane fusion induced by herpes simplex virus, p. 201-232. In J. Bentz (ed.), Viral fusion mechanisms. CRC Press, Boca Raton, Fla. |
| 36. |
Stevenson, D.,
K. L. Colman, and A. J. Davison.
1992.
Characterization of the varicella-zoster virus gene 61 protein.
J. Gen. Virol.
73:521-530 |
| 37. |
von Heijne, G.
1986.
A new method for predicting signal sequence cleavage sites.
Nucleic Acids Res.
14:4683-4690 |
| 38. | Webster, C. B., D. Chen, M. Horgan, and P. D. Olivo. 1995. The varicella-zoster virus origin-binding protein can substitute for the herpes simplex virus origin-binding protein in a transient origin-dependent DNA replication assay in insect cells. Virology 206:655-660[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»