INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

The Rel family of transcription factors plays an important role in the transactivation of several viral genes, including those of human immunodeficiency virus (HIV) type 1 (HIV-1) (25, 38). HIV-1 replication is regulated, in part, at the transcriptional level through the interplay of viral regulatory proteins with cellular transcription factors interacting with the viral long terminal repeat (LTR) (39). Since the identification and functional characterization of NF-B cis-acting sequences within the HIV LTR (38), multiple studies have addressed the essential or dispensable role that this transcription factor plays in the reactivation of HIV from a true latent state and in the control of viral persistence (1, 10, 27, 31, 54, 55). Unfortunately, these studies have yielded conflicting results as to the role of NF-B in these two steps of the viral life cycle in infected host cells. Differences in the type of host cells studied, HIV strain or genetic constructs used, and methodological approaches may explain these conflicting results.

Understanding the potential impact of NF-B on the regulation of HIV latency has again become a priority, as recent studies suggest that NF-B controls the reactivation of latent HIV in T cells from HIV-infected patients undergoing highly active antiretroviral therapy (19). An additional reservoir of HIV, separate from that of T cells harboring latent HIV, are cells of the monocyte lineage in which persistent viral replication is observed (36). During all stages of HIV infection, tissue macrophages provide a unique viral reservoir. In these cells, HIV persistently replicates in the absence of cytopathicity, escapes immune surveillance, and spreads via cell-to-cell contact (reviewed in reference 36). The important role of macrophages in AIDS pathogenesis has prompted the investigation of the molecular mechanisms which regulate HIV-1 persistence in these immune cells; one of these mechanisms is thought to be NF-B dependent. Human macrophages express a constitutive level of NF-B in the nuclei in the absence of exogenous cellular activation (25). This constitutive pool of nuclear NF-B may be sufficient to allow for the initiation of HIV transcription immediately following infection. In addition, NF-B may be required to further sustain persistent HIV replication, as multiple studies have demonstrated that persistent HIV replication in human macrophages or monocytes further upregulates NF-B activity (2, 34, 40, 43, 48). However, the mechanisms by which HIV infection induces the activation of NF-B in cells of the monocyte lineage remains unknown. Their identification would greatly enhance the understanding of this process and allow future testing of whether inhibition of the virus-induced activation of NF-B may decrease viral persistence in cells of the monocyte lineage, hence eliminating an important reservoir of HIV replication in infected patients.

NF-B is a heterodimeric protein composed of different combinations of members of the Rel family of transcription factors. A well-characterized form of NF-B is a heterodimer of p50 and Rel-A (p65) (reviewed in references 3 and 4). In the majority of cells studied, NF-B is anchored in the cytosol by an inhibitory protein, IB. An extensively studied IB molecule, IB, has previously been shown to physically interact with NF-B and to mask the nuclear localization signal of p50 and Rel-A (6). Following cell activation by one of an array of extracellular stimuli, IB undergoes a hyperphosphorylation event that renders the inhibitory molecule susceptible to degradation (7, 13, 47). This process results in the release of NF-B, which undergoes nuclear translocation and drives gene transcription. Significant advances in the understanding of the molecular mechanisms and the structure-function of the phosphorylation and degradation of IB have recently been made. IB is constitutively phosphorylated at its COOH terminus by protein kinase-casein kinase II (PK-CK2) (5, 33, 35, 45). While the exact function of this phosphorylation is poorly understood, it appears that phosphorylation at the COOH terminus may play a role in the constitutively rapid protein turnover of IB in resting cells, thus potentially favoring a low degree of continuous NF-B translocation. On the contrary, the N terminus contains two series (S³² and S³⁶) which are required for stimulus-dependent phosphorylation (8, 9, 11, 15, 46, 49, 50, 52) by specific kinases, such as the ones present in the I complex (I and I) or p90^rsk (12, 16, 20, 24, 37, 42, 44, 53, 57). Phosphorylation at these sites primes IB to undergo ubiquitination and subsequent degradation by the proteosome.

Our group has previously determined that a mechanism whereby HIV infection results in an increase in the nuclear translocation of NF-B involves modification and enhancement of IB turnover (34). The half-life of IB in HIV-infected cells is reduced by at least 50% compared to that in uninfected cells, and this fact directly correlates with increased levels of the nuclear pool of NF-B in HIV-infected cells. That IB is the target of persistent HIV infection in monocytic cells has been further confirmed by other groups (14, 27); one of those groups further demonstrated that inhibition of IB degradation with proteosome inhibitors decreases HIV-induced NF-B activation (27). What remain to be elucidated are the molecular mechanisms whereby HIV infection targets IB. Potential mechanisms regulated by HIV infection could target the COOH terminus of IB, favoring an enhanced "basal" turnover of this inhibitor molecule by activating PK-CK2 or the proteolytic machinery. Alternatively, HIV infection could result in the activation of other IB kinases that target S³² and S³⁶, thus continuously priming IB to be degraded via the proteosome. Lastly, HIV could target other regulatory sites of IB or even other molecules, such as Rel-A, that could result in the dissociation of NF-B from IB, thus rendering IB less stable.

To investigate these possibilities, we have used a cell model of monocytic cells in which persistent HIV replication results in NF-B activation and a variety of genetically modified tagged IB molecules can be constitutively overexpressed. Our results indicate that HIV infection targets the NH₂ terminus of IB, specifically S³² and S³⁶, causing the enhanced degradation of IB and hence increased NF-B nuclear translocation. The I complex kinase activity is selectively activated and is shown to mediate increased NF-B activation in HIV-infected cells. In addition, we demonstrate that HIV-mediated NF-B activation is not necessary to maintain viral persistence in monocytic cells.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Reagents and antibodies. Tumor necrosis factor (TNF) was purchased from Genzyme (Cambridge, Mass.) and stored in aliquots at 70°C. Cycloheximide was purchased from Sigma (St. Louis, Mo.) and stored at 20°C. Calpain inhibitor I (N-acetyl-Leu-Leu-norleucinal or ALLN) was purchased from Boehringer Mannheim Biochemicals (Indianapolis, Ind.), solubilized in ethyl alcohol, and stored in aliquots at 20°C. Bay 11-7082 (41) was purchased from Biomol (Plymouth Meeting, Pa.), solubilized in ethyl alcohol, and stored at 20°C. G418 was purchased from Calbiochem-Novabiochem Corporation (La Jolla, Calif.), solubilized in RPMI medium, and stored in aliquots at 20°C.

DNA constructs. pCMV2-FLAG-IB-wt consisted of the full-length "wild-type" sequence of human IB (26) cloned into the SmaI-HindIII sites of pCMV2FLAG (Kodak) to generate N-terminally Flag-tagged IB-wt (Flag-IB-wt). Flag-IB-wt was used as a template for subsequent mutations and deletions by PCR-based techniques. Flag-IB-N consisted of an N-terminal deletion lacking the first 37 amino acids. This construct was generated with the sense primer wt-FLAG (5'CGGAATTCATGGACTACAAAGACGAT3') and the antisense primer wt-B (5'GGAATTCCTCATAACGTCAGACGCTG3'). EcoRI sites were created upstream and downstream of the coding sequence. Flag-IB-C consisted of a C-terminal deletion lacking the last 40 amino acids and was generated with the sense primer wt-FLAG and the antisense primer C (5'GCGAATTCTCAAAGGTTTTCTAGTGTC3'). This construct contained an EcoRI site downstream of the coding sequence. Flag-IB-2N consisted of the full-length sequence of IB-wt in which S³² and S³⁶ were mutated to alanine residues. To generate these mutations, a sense primer with the sequence 5'GACGCAGGCCTGGACGCAATG3' and an antisense primer with the sequence 5'CATTGCGTCCAGGCCTGCGTC3' were used. Flag-IB-4C was created by mutation of S²⁸³, S²⁸⁸, S²⁹³, and T²⁹¹ to alanine residues in the PEST sequence (35), cloning into the HindIII-EcoRI site of pCMV2FLAG, and then PCR amplifying with the sense primer wt-FLAG and the antisense primer wt-B. Flag-IB-wt, Flag-IB-N, Flag-IB-C, Flag-IB-2N, and Flag-IB-4C were then digested and cloned into the EcoRI site of SFFV-Neo under the transcriptional regulation of the Friend spleen focus-forming virus (SFFV) 5' LTR (22). All of the cloning was verified by DNA sequencing.

Gene transfection and generation of cell lines. The U937 promonocytic cell line was purchased from the American Type Culture Collection and grown in RPMI 1640 supplemented with 5% heat-inactivated fetal bovine serum (Intergen), 1% glutamine, and 1% penicillin-streptomycin. To generate IB-expressing cell lines, 10⁷ freshly thawed and exponentially growing U937 cells were resuspended in RPMI 1640 and electroporated with 20 µg of previously linearized DNA by use of a BTX cell electroporator at 250 V for 10 ms. U937 cells electroporated without DNA were used as controls. At 24 h after transfection, cells were resuspended in selection medium containing 5% fetal bovine serum and 700 µg of G418 per ml. After 3 to 4 weeks, upon the incipient growth of neomycin-resistant bulk cultures, cells were cloned by limiting dilution (30). Stable integration and expression of the transfected genes within each monoclonal population were verified by serial passages of the cultures in the absence of the selective antibiotic and by immunoblotting with anti-Flag antibodies.

HIV infection and measurement of HIV replication. U937 cells expressing SFFV, Flag-IB-wt, Flag-IB-N, Flag-IB-C, Flag-IB-2N, and Flag-IB-4C were infected with the HIV LAV-Bru strain as previously described (2, 34, 40). Briefly, 10⁷ exponentially growing U937 cells were sedimented by low-speed centrifugation and resuspended overnight in 10 ml of infective supernatant containing 360 ng of p24 per ml. Mock-infected cells were used as a control. After 24 h, cells were extensively washed and resuspended in culture medium. Cells were passaged twice a week at 0.25 × 10⁶ cells/ml and used from day 30 through day 90 postinfection. During this period, cell supernatants were collected, precleared by centrifugation at 1,500 rpm for 5 min at 4°C, and stored for future analysis of HIV p24 antigen content by an enzyme-linked immunosorbent assay (Coulter-Immunotech Immunology, Westbrook, Maine). At least eight consecutive infections were used for each of these experiments. All the cell lines studied maintained HIV persistence and 100% viability during the study period, except for the U937 clones expressing Flag-IB-C, which maintained viability and normal growth while uninfected which underwent immediate and massive cytopathicity upon HIV infection in four consecutive attempts. Therefore, a U937 cell line expressing Flag-IB-C could not support a persistent HIV infection. In addition, in some experiments, HIV gp120 expression was determined by immunoblotting with anti-gp120 antibodies.

Nuclear and cytosolic extracts, electrophoretic mobility shift assays, and immunoblotting. Nuclear and cytosolic extracts were prepared by a modification of the method of Dignam et al. (17). A total of 10⁷ cells were washed with ice-cold phosphate-buffered saline and then with buffer A (10 mM HEPES [pH 7.9], 1.5 mM MgCl₂, 10 mM KCl). Cells were then lysed for 10 min on ice in the same buffer containing 0.1% Nonidet P-40, 0.5 mM dithiothreitol (DTT), 0.5 mM phenylmethylsulfonyl fluoride (PMSF), 2 µg of aprotinin per ml, 2 µg of leupeptin per ml, and 2 µg of pepstatin per ml. After centrifugation, cells were washed twice with buffer A. Nuclei were pelleted by centrifugation, lysed by resuspension in 25 µl of buffer C (20 mM HEPES, 25% glycerol, 0.42 M NaCl, 1.5 mM MgCl₂, 0.2 mM EDTA, DTT, PMSF, aprotinin, leupeptin, pepstatin) and rotated at 4°C for 30 min. After centrifugation, the supernatants were diluted in 50 µl of buffer D (20 mM HEPES, 20% glycerol, 0.05 M KCl, 0.2 M EDTA, DTT, PMSF, aprotinin, leupeptin, pepstatin) and stored at 70°C.

Preparation of recombinant IB. The IB-MAD3 cDNA (26) plasmid was obtained from Cetus Corporation and was used as a template for subsequent PCR amplification.

Immunoprecipitation of IB kinases and in vitro kinase assays. Whole-cell extracts were prepared for immunoprecipitation and in vitro kinase assays as follows. Aliquots of 10⁷ exponentially growing U937 cells were washed twice with cold phosphate-buffered saline, resuspended in lysis buffer containing 40 mM Tris-HCl (pH 8), 0.3 M NaCl, 0.1% Nonidet P-40, 6 mM EDTA, 6 mM EGTA, 10 mM NaF, 10 mM p-nitrophenyl phosphate (PNPP), 10 mM -glycerolphosphate, 300 µM sodium orthovanadate, 1 mM DDT, 2 µM PMSF, 10 µg of aprotinin per ml, 1 µg of leupeptin per ml, and 1 µg of pepstatin per ml, and incubated on ice. Cells were then centrifuged at 12,000 × g for 15 min at 4°C. The resultant supernatant contained total cellular proteins, which were quantitated with a Bio-Rad protein assay.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Increased degradation of Flag-IB-wt in HIV-infected cells. To confirm the expression and functionality of the Flag-IB constructs, pooled clones expressing equal levels of Flag-IB constructs were treated or not treated with TNF, followed by the analysis of the cytosolic extracts by SDS-PAGE and immunoblotting with anti-Flag antibodies. As shown in Fig. 1A, TNF stimulation led to the rapid hyperphosphorylation and subsequent degradation of Flag-IB-wt. In contrast, Flag-IB-N and Flag-IB-2N were refractory to TNF-induced hyperphosphorylation and subsequent degradation. Flag-IB-4C behaved similarly to Flag-IB-wt in that it was susceptible to TNF-mediated hyperphosphorylation and degradation. These results confirm that the constitutively overexpressed Flag-IB molecules are regulated as previously described for native IB and highlight the functional relevance of the N terminus containing S³² and S³⁶ in TNF-induced IB hyperphosphorylation and degradation.

View larger version (24K): [in this window] [in a new window]   FIG. 1.   Functional characterization of Flag-IB molecules in U937 cells. (A) Pooled clones of U937 cells expressing the different Flag-IB constructs were stimulated with TNF for different time periods, and the cell lysates were analyzed by immunoblotting with anti-Flag antibodies. The hyperphosphorylated form of IB is indicated by a small circle. (B) Immunoblotting of cell lysates from mock-infected (NI) or HIV-infected (HIV), SFFV-expressing U937 cells with anti-IB, anti-IB, anti-IB, and antiactin antibodies. The hyperphosphorylated form of IB is indicated by a small circle. (C) Immunoblotting of cell lysates from mock-infected (NI) or HIV-infected (HIV), SFFV- or Flag-IB-wt-expressing U937 cells with anti-Flag and antiactin antibodies. (D) The half-life of Flag-IB-wt was estimated by immunoblotting of cell lysates from mock-infected (NI) or HIV-infected (HIV), Flag-IB-wt-expressing U937 cells treated with cycloheximide (CHX) for different periods of time with anti-Flag antibodies. Equal protein loading was calculated by immunoblotting the same membrane with anti-p90rsk antibody. (E) The half-life of Flag-IB-wt was calculated by measuring with a densitometer the disintegrations per minute of Flag-IB-wt and normalizing them to those for p90rsk from each experimental time point shown in panel D.

The NH₂ terminus but not the PEST sequence present in the COOH terminus of IB is necessary for IB degradation by HIV infection. To characterize which of the regulatory domains of IB is targeted by HIV infection, we first focused on the NH₂-terminal domain of IB. We analyzed the turnover and half-life of Flag-IB-N. U937 cells stably transfected with the empty retrovirus vector (SFFV), Flag-IB-wt, or Flag-IB-N were mock or HIV infected. The half-lives of these constructs were measured by analyzing the levels of the Flag-IB constructs in cytosolic extracts from cell cultures treated for different time periods with cycloheximide (as for Fig. 1). As shown in Fig. 2A, Flag-IB-N was very stable not only in mock-infected but also in HIV-infected U937 cells, with the resulting half-lives being estimated at greater than 4 h (Fig. 2B). The enhanced stability of Flag-IB-N in both mock- and HIV-infected cells contrasts with the more rapid turnover of Flag-IB-wt in mock-infected cells and even more rapid turnover in HIV-infected cells (Fig. 1D and Fig. 2A). These results indicate that the increased degradation of IB that ensues in HIV-infected cells appears to be dependent on the NH₂-terminal domain of the molecule. In addition, these results highlight the potential relevance of this IB domain in the regulation of the basal turnover of IB in unstimulated transformed cells.

View larger version (18K): [in this window] [in a new window]   FIG. 2.   Deletion of the first 37 amino acids of IB conveys resistance to HIV-mediated degradation. (A) Mock-infected (NI) or HIV-infected (HIV), Flag-IB-N-expressing U937 cells were treated with cycloheximide (CHX) for different time periods, after which cell lysates were analyzed by immunoblotting with anti-Flag or antiactin antibodies. (B) The half-life of Flag-IB-N was calculated as described in the legend to Fig. 1E.

View larger version (30K): [in this window] [in a new window]   FIG. 3.   Mutation of the phosphoamino acids present in the PEST sequence does not alter the HIV-mediated degradation of IB. (A) Mock-infected (NI) or HIV-infected (HIV), Flag-IB-4C- or Flag-IB-wt-expressing U937 cells were treated for different time periods with cycloheximide (CHX), and cell lysates were analyzed by immunoblotting with anti-Flag and anti-p90rsk antibodies. The lysates used for detecting p90rsk levels were the same as those from Flag-IB-4C-expressing U937 cells. Similar results were obtained with Flag-IB-wt-expressing U937 cell lysates. (B) The half-lives of Flag-IB-4C (left panel) and Flag-IB-wt (right panel) were calculated as described in the legend to Fig. 1E.

HIV-induced degradation of Flag-IB requires phosphorylation at the NH₂-terminal residues S³² and S³⁶. Several studies have identified S³² and S³⁶ as targets of inducible IB kinases (8, 9, 11, 15, 46, 49, 50, 52). As shown in Fig. 1A, mutation of S³² and S³⁶ to alanines yields an IB construct that is refractory to the hyperphosphorylation and subsequent degradation triggered by TNF in U937 cells. Having identified the NH₂-terminal domain of IB as a target of HIV-induced degradation, we next questioned whether S³² and S³⁶ could be the amino acids that are targeted by HIV infection. For this, we investigated the half-life and turnover of Flag-IB-2N in mock- and HIV-infected U937 cells and compared them to the half-life and turnover of Flag-IB-wt. Following the same experimental design as that used for Fig. 2 and 3, we observed that in mock-infected cells, mutation of S³² and S³⁶ to alanines significantly prolonged the half-life of IB (greater than 5 h) compared to the more rapid turnover of Flag-IB-wt (Fig. 4). This very low rate of basal degradation of Flag-IB-2N is similar to that observed for Flag-IB-N (Fig. 2). Relevant to the focus of this study, we demonstrate that the half-life of Flag-IB-wt is significantly reduced in HIV-infected cells compared to mock-infected cells and that Flag-IB-2N was refractory to HIV-mediated IB degradation (Fig. 4). These results confirm that S³² and S³⁶ are the IB amino acids targeted by persistent HIV infection to result in enhanced degradation of IB.

View larger version (32K): [in this window] [in a new window]   FIG. 4.   Mutation of S32 and S36 of IB abrogates HIV-mediated IB degradation. (A) Mock-infected (NI) or HIV-infected (HIV), Flag-IB-2N- or Flag-IB-wt-expressing U937 cells were treated with cycloheximide (CHX) for different time periods, after which cell lysates were analyzed by SDS-PAGE and immunoblotted with anti-Flag and anti-p90rsk antibodies. The p90rsk lysates were the same as those from Flag-IB-2N-expressing U937 cells. Similar results were obtained with Flag-IB-wt-expressing U937 cell lysates. (B) The half-lives of Flag-IB-2N and Flag-IB-wt were calculated as described in the legend to Fig. 1E.

View larger version (28K): [in this window] [in a new window]   FIG. 5.   HIV infection of U937 cells induces hyperphosphorylation of IB which is dependent on S32 and S36. Mock-infected (NI) or HIV-infected (HIV), Flag-IB-wt- or Flag-IB-2N-expressing U937 cells were treated (+) or not treated () with Bay 11-7082 (Bay 11), TNF, or ALLN, after which the cell lysates were analyzed by SDS-PAGE and immunoblotted with anti-Flag antibodies. The supershifted hyperphosphorylated IB form of Flag-IB-wt is indicated by a bullet.

The I complex mediates HIV-dependent IB degradation and NF-B activation. Two kinases in the I complex (I and I) have recently been shown to phosphorylate S³² and S³⁶ of IB and to be the targets of inflammatory cytokines, such as TNF and interleukin 1 (12, 16, 29, 37, 42, 53, 57). Having identified S³² and S³⁶ as the regulatory amino acids of IB which are targeted by HIV, we questioned whether the I complex is activated by HIV infection and mediates the increased levels of nuclear NF-B activation in infected cells. Mock-infected and persistently HIV-infected U937 cells were lysed, followed by immunoprecipitation of the I complex, p90^rsk, or Raf-1. The kinase activities of these immunoprecipitates were analyzed in an in vitro kinase reaction with GST-IB (positions 1 to 54) or GST-IB (positions 1 to 54) containing S^32/36A as a substrate. In HIV-infected samples, increased IB kinase activity was present in the I complex immunoprecipitate but not in the p90^rsk (Fig. 6A) or the Raf-1 (data not shown) immunoprecipitate. This kinase activity was specific for S³² and S³⁶, as their mutation eliminated the basal and HIV-induced I complex activity. Also, as shown in Fig. 6A, there was no difference in the amounts of I complex immunoprecipitated with anti-I antibodies in mock- and HIV-infected U937 cells, thus eliminating the possibility that HIV infection simply increases the pool of I kinases. These data indicate that HIV infection activates the I complex, resulting in phosphorylation at S³² and S³⁶.

View larger version (25K): [in this window] [in a new window]   FIG. 6.   The I complex but not p90rsk mediates the HIV-induced activation of NF-B. (A) In vitro kinase assay of I and p90rsk. Immunoprecipitates (IP) from mock-infected (NI), mock-infected and TNF treated (TNF), and HIV-infected (HIV), SFFV-expressing U937 cells were lysed, and the I complex and p90rsk were immunoprecipitated with anti-I and anti-p90rsk antibodies, respectively. Immunoprecipitates were analyzed in an in vitro kinase (IVK) assay with recombinant protein IB-wt (positions 1 to 54) or IB S32/36A (positions 1 to 54) as a substrate (32P-IB). The membrane was subsequently stained with Coomassie blue (stained IB) or immunoblotted (Immunoblot) with anti-I, anti-I, or anti-p90rsk antibodies. (B) SFFV-expressing, HIV-infected U937 cells were transiently transfected with con-luc () or B-con-luc () together with expression vectors for wild-type (WT) or negative dominant (nd) forms of I or I and a TK CAT reporter gene. Luciferase units were normalized to CAT units. The NF-B luciferase activity of uninfected, SFFV-expressing cells was similar to that of con-luc in HIV-infected cells, and none of the I or I (wt or nd) expression vectors modified the basal level of plasmid B-luc activity in uninfected cells (data not shown). This experiment is representative of three additional ones. Each transfection point was determined in duplicate, and error bars indicate ± standard deviations.

HIV-1 replication in U937 cells expressing different transdominant mutants of IB. Having determined that S³² and S³⁶ of IB are required for HIV-mediated IB degradation, we next questioned whether U937 cells expressing Flag-IB-N or Flag-IB-2N (constructs that are refractory to HIV-dependent degradation) would inhibit HIV-mediated NF-B activation, and if so, whether this inhibition would result in decreased viral replication. Nuclear extracts and cell-free supernatants were obtained from mock- or HIV-infected cells stably transfected with the SFFV vector, Flag-IB-N or Flag-IB-2N at the same time as the cytosolic fractions were analyzed to determine the half-lives of the respective IB constructs (Fig. 2 and 4). Nuclear extracts were analyzed by a gel shift assay with an oligonucleotide containing NF-B DNA binding motifs, and viral replication was monitored by measuring p24 levels in culture supernatants. As shown in Fig. 7A and B, left panels, HIV infection of SFFV-expressing U937 cells led to nuclear translocation of a DNA binding protein complex composed of p50 and Rel-A (p65); this finding was not observed in HIV-infected cells expressing either Flag-IB-N or Flag-IB-2N (Fig. 7A and B, right panels). These observations directly correlate with the inability of these two Flag-IB constructs to undergo HIV-mediated degradation, as demonstrated in Fig. 2 and 4.

View larger version (28K): [in this window] [in a new window]   FIG. 7.   Genetic interference with HIV-mediated NF-B activation does not result in reduced HIV replication. (A) Gel shift assays of nuclear extracts from mock-infected (NI) or HIV-infected (HIV), SFFV- or Flag-IB-N-expressing U937 cells. Antibodies against p50 (p50) or p65 (p65) were added to the gel shift assay. The corresponding molecular complex is indicated. (B) Same panel A, except that nuclear extracts from SFFV-expressing U937 cells were compared in parallel to those from Flag-IB--2N-expressing U937 cells. (C) The HIV p24 content in supernatants of HIV-infected, SFFV-expressing U937 cells () or cells expressing Flag-IB-N () and Flag-IB-2N () was calculated in duplicate. This experiment is representative of two additional ones. Error bars indicate standard deviations.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Using an HIV-susceptible promonocytic cell line which can support persistent viral replication, we have determined that the IB residues S³² and S³⁶ and the I complex (12, 16, 29, 37, 42, 53, 57) are required to mediate HIV-dependent IB degradation and, hence, NF-B activation. The identification of a transdominant negative IB molecule which is refractory to HIV-dependent degradation and thus is capable of blocking the HIV-mediated activation of NF-B extends and confirms previous studies from our group indicating that IB is a target molecule and that persistent HIV infection leads to increased NF-B activation (34). In addition, it provides supporting data that HIV-mediated NF-B (p50/p65) activation is not necessary to support viral persistence in the U937 monocytic cell line.

The use of pooled clones of monocytic cells that constitutively express genetically modified IB constructs has proven to be a valuable tool with which to study the role of NF-B replication in HIV persistence. Different from punctual stimuli (inflammatory cytokines or transient expression of human T-cell leukemia virus type 1 tax), the activation of NF-B by HIV infection is dependent on the establishment of viral persistence, achieved only after 6 to 10 days of viral infection (2, 34, 40). Due to this unique virus-host cell interaction, the experimental approaches which can be utilized to address the mechanisms by which HIV activates NF-B have been significantly limited. Previous attempts have used nonmonocytic cell lines which a