Previous Article | Next Article 
Journal of Virology, May 1999, p. 3893-3903, Vol. 73, No. 5
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
I
Mediates NF-
B Activation in Human
Immunodeficiency Virus-Infected Cells
Susana
Asin,1
Julie A.
Taylor,1
Sergey
Trushin,1
Gary
Bren,1 and
Carlos
V.
Paya1,2,*
Department of
Immunology1 and Division of Infectious
Diseases,2 Mayo Clinic, Rochester, Minnesota
55905
Received 16 September 1998/Accepted 27 January 1999
 |
ABSTRACT |
Human monocytes and macrophages are persistent reservoirs of human
immunodeficiency virus (HIV) type-1. Persistent HIV infection of these
cells results in increased levels of NF-
B in the nucleus secondary
to increased I
B
, I
B
, and I
B
degradation, a mechanism postulated to regulate viral persistence. To characterize the molecular
mechanisms regulating HIV-mediated degradation of I
B, we have sought
to identify the regulatory domains of I
B
targeted by HIV
infection. Using monocytic cells stably expressing different transdominant molecules of I
B
, we determined that persistent HIV
infection of these cells targets the NH2 but not the COOH terminus of I
B
. Further analysis demonstrated that
phosphorylation at S32 and S36 is necessary for
HIV-dependent I
B
degradation and NF-
B activation. Of the
putative N-terminal I
B
kinases, we demonstrated that the I
complex, but not p90rsk, is activated by HIV
infection and mediates HIV-dependent NF-
B activation. Analysis of
viral replication in cells that constitutively express I
B
negative transdominant molecules demonstrated a lack of correlation
between virus-induced NF-
B (p65/p50) nuclear translocation and
degree of viral persistence in human monocytes.
 |
INTRODUCTION |
The Rel family of transcription
factors plays an important role in the transactivation of several viral
genes, including those of human immunodeficiency virus (HIV) type 1 (HIV-1) (25, 38). HIV-1 replication is regulated, in part,
at the transcriptional level through the interplay of viral regulatory
proteins with cellular transcription factors interacting with the viral
long terminal repeat (LTR) (39). Since the identification
and functional characterization of NF-
B cis-acting
sequences within the HIV LTR (38), multiple studies have
addressed the essential or dispensable role that this transcription
factor plays in the reactivation of HIV from a true latent state and in
the control of viral persistence (1, 10, 27, 31, 54, 55).
Unfortunately, these studies have yielded conflicting results as to the
role of NF-
B in these two steps of the viral life cycle in infected
host cells. Differences in the type of host cells studied, HIV strain
or genetic constructs used, and methodological approaches may explain
these conflicting results.
Understanding the potential impact of NF-
B on the regulation of HIV
latency has again become a priority, as recent studies suggest that
NF-
B controls the reactivation of latent HIV in T cells from
HIV-infected patients undergoing highly active antiretroviral therapy
(19). An additional reservoir of HIV, separate from that of
T cells harboring latent HIV, are cells of the monocyte lineage in
which persistent viral replication is observed (36). During
all stages of HIV infection, tissue macrophages provide a unique viral
reservoir. In these cells, HIV persistently replicates in the absence
of cytopathicity, escapes immune surveillance, and spreads via
cell-to-cell contact (reviewed in reference 36). The
important role of macrophages in AIDS pathogenesis has prompted the
investigation of the molecular mechanisms which regulate HIV-1 persistence in these immune cells; one of these mechanisms is thought
to be NF-
B dependent. Human macrophages express a constitutive level
of NF-
B in the nuclei in the absence of exogenous cellular activation (25). This constitutive pool of nuclear NF-
B
may be sufficient to allow for the initiation of HIV transcription immediately following infection. In addition, NF-
B may be required to further sustain persistent HIV replication, as multiple studies have
demonstrated that persistent HIV replication in human macrophages or
monocytes further upregulates NF-
B activity (2, 34, 40, 43,
48). However, the mechanisms by which HIV infection induces the
activation of NF-
B in cells of the monocyte lineage remains unknown.
Their identification would greatly enhance the understanding of this
process and allow future testing of whether inhibition of the
virus-induced activation of NF-
B may decrease viral persistence in
cells of the monocyte lineage, hence eliminating an important reservoir
of HIV replication in infected patients.
NF-
B is a heterodimeric protein composed of different combinations
of members of the Rel family of transcription factors. A
well-characterized form of NF-
B is a heterodimer of p50 and Rel-A
(p65) (reviewed in references 3 and
4). In the majority of cells studied, NF-
B is
anchored in the cytosol by an inhibitory protein, I
B. An extensively
studied I
B molecule, I
B
, has previously been shown to
physically interact with NF-
B and to mask the nuclear localization
signal of p50 and Rel-A (6). Following cell activation by
one of an array of extracellular stimuli, I
B
undergoes a hyperphosphorylation event that renders the inhibitory molecule susceptible to degradation (7, 13, 47). This process results in the release of NF-
B, which undergoes nuclear translocation and
drives gene transcription. Significant advances in the understanding of
the molecular mechanisms and the structure-function of the phosphorylation and degradation of I
B
have recently been made. I
B
is constitutively phosphorylated at its COOH terminus by protein kinase-casein kinase II (PK-CK2) (5, 33, 35, 45). While the exact function of this phosphorylation is poorly understood, it appears that phosphorylation at the COOH terminus may play a role in
the constitutively rapid protein turnover of I
B
in resting cells,
thus potentially favoring a low degree of continuous NF-
B
translocation. On the contrary, the N terminus contains two series
(S32 and S36) which are required for
stimulus-dependent phosphorylation (8, 9, 11, 15, 46, 49, 50,
52) by specific kinases, such as the ones present in the I
complex (I

and I

) or p90rsk
(12, 16, 20, 24, 37, 42, 44, 53, 57). Phosphorylation at
these sites primes I
B
to undergo ubiquitination and subsequent degradation by the proteosome.
Our group has previously determined that a mechanism
whereby HIV infection results in an increase in the nuclear
translocation of NF-
B involves modification and enhancement of
I
B
turnover (34). The half-life of I
B
in
HIV-infected cells is reduced by at least 50% compared to that in
uninfected cells, and this fact directly correlates with increased
levels of the nuclear pool of NF-
B in HIV-infected cells. That
I
B
is the target of persistent HIV infection in monocytic cells
has been further confirmed by other groups (14, 27); one of
those groups further demonstrated that inhibition of I
B
degradation with proteosome inhibitors decreases HIV-induced NF-
B
activation (27). What remain to be elucidated are the
molecular mechanisms whereby HIV infection targets I
B
.
Potential mechanisms regulated by HIV infection could target the
COOH terminus of I
B
, favoring an enhanced "basal" turnover of
this inhibitor molecule by activating PK-CK2 or the proteolytic
machinery. Alternatively, HIV infection could result in the activation
of other I
B
kinases that target S32 and
S36, thus continuously priming I
B
to be degraded via
the proteosome. Lastly, HIV could target other regulatory sites of
I
B
or even other molecules, such as Rel-A, that could result in
the dissociation of NF-
B from I
B
, thus rendering I
B
less stable.
To investigate these possibilities, we have used a cell model of
monocytic cells in which persistent HIV replication results in NF-
B
activation and a variety of genetically modified tagged I
B
molecules can be constitutively overexpressed. Our results indicate
that HIV infection targets the NH2 terminus of I
B
, specifically S32 and S36, causing the enhanced
degradation of I
B
and hence increased NF-
B nuclear
translocation. The I
complex kinase activity is selectively
activated and is shown to mediate increased NF-
B activation in
HIV-infected cells. In addition, we demonstrate that HIV-mediated
NF-
B activation is not necessary to maintain viral persistence in
monocytic cells.
 |
MATERIALS AND METHODS |
Reagents and antibodies.
Tumor necrosis factor (TNF) was
purchased from Genzyme (Cambridge, Mass.) and stored in aliquots at
70°C. Cycloheximide was purchased from Sigma (St. Louis, Mo.) and
stored at
20°C. Calpain inhibitor I
(N-acetyl-Leu-Leu-norleucinal or ALLN) was purchased from
Boehringer Mannheim Biochemicals (Indianapolis, Ind.), solubilized in
ethyl alcohol, and stored in aliquots at
20°C. Bay 11-7082 (41) was purchased from Biomol (Plymouth Meeting, Pa.),
solubilized in ethyl alcohol, and stored at
20°C. G418 was
purchased from Calbiochem-Novabiochem Corporation (La Jolla, Calif.),
solubilized in RPMI medium, and stored in aliquots at
20°C.
The expression of the Flag-tagged I
B constructs was monitored with
an anti-Flag monoclonal antibody (Kodak, New Haven, Conn.). To control
for equal loading of proteins in sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) analysis, an
anti-
-actin polyclonal antibody (Sigma) and an
anti-p90rsk antibody (Santa Cruz Biotechnology,
Santa Cruz, Calif.) were used. Polyclonal anti-I
B
serum was
generated with a glutathione S-transferase (GST)-MAD3
fusion protein (34). The viral envelope protein gp120 was
detected with an anti-gp120 polyclonal antibody (Center for Biologics
Evaluation and Research, Food and Drug Administration, Bethesda, Md.).
The identity of the complexes binding DNA in the gel shift assays was
determined with polyclonal antibodies against the different members of
the Rel family (Santa Cruz Biotechnology). Antibodies against
p90rsk, I

, I

, Raf-1, and
NF-
B were purchased from Santa Cruz Biotechnology.
DNA constructs.
pCMV2-FLAG-I
B
-wt consisted of the
full-length "wild-type" sequence of human I
B
(26)
cloned into the SmaI-HindIII sites of
pCMV2FLAG (Kodak) to generate N-terminally Flag-tagged I
B
-wt (Flag-I
B
-wt). Flag-I
B
-wt was used as a template for
subsequent mutations and deletions by PCR-based techniques.
Flag-I
B
-
N consisted of an N-terminal deletion lacking the
first 37 amino acids. This construct was generated with the sense
primer wt-FLAG (5'CGGAATTCATGGACTACAAAGACGAT3') and the
antisense primer wt-B (5'GGAATTCCTCATAACGTCAGACGCTG3').
EcoRI sites were created upstream and downstream
of the coding sequence. Flag-I
B
-
C consisted of a C-terminal
deletion lacking the last 40 amino acids and was generated with the
sense primer wt-FLAG and the antisense primer
C
(5'GCGAATTCTCAAAGGTTTTCTAGTGTC3'). This construct
contained an EcoRI site downstream of the coding
sequence. Flag-I
B
-2N consisted of the full-length sequence of
I
B
-wt in which S32 and S36 were mutated
to alanine residues. To generate these mutations, a sense primer with
the sequence 5'GACGCAGGCCTGGACGCAATG3' and an antisense
primer with the sequence 5'CATTGCGTCCAGGCCTGCGTC3' were
used. Flag-I
B
-4C was created by mutation of S283,
S288, S293, and T291 to alanine
residues in the PEST sequence (35), cloning into the
HindIII-EcoRI site of pCMV2FLAG, and then PCR
amplifying with the sense primer wt-FLAG and the antisense primer wt-B.
Flag-I
B
-wt, Flag-I
B
-
N, Flag-I
B
-
C,
Flag-I
B
-2N, and Flag-I
B
-4C were then digested and cloned
into the EcoRI site of SFFV-Neo under the transcriptional
regulation of the Friend spleen focus-forming virus (SFFV) 5' LTR
(22). All of the cloning was verified by DNA sequencing.
Plasmid
B-luc contains three tandem copies of the
B motif of the
HIV LTR cloned upstream of the minimal conalbumin-luciferase (con-luc)
promoter reporter gene. Plasmid pBLCAT 2 is a mammalian reporter vector
designed for the expression of chloramphenicol acetyltransferase (CAT)
in mammalian cells transcribed by the minimal thymidine kinase (TK)
promoter (Promega, Madison, Wis.). Plasmids I

wt and kinase
dead were kind gifts from Alain Israel, Institute Pasteur, Paris,
France. Plasmids I

wt and kinase dead were obtained from M. Roth (Tularik, San Jose, Calif.). I

kinase dead was generated
by mutation of aspartic acid 144 to asparagine. I

kinase dead
was created by mutation of lysine 44 to alanine. pcDNA3-I
expression vectors were generated by cloning the cDNA of wild-type
I

or I

or its respective mutant into the
cytomegalovirus expression vector pcDNA3 (Invitrogen).
Gene transfection and generation of cell lines.
The U937
promonocytic cell line was purchased from the American Type Culture
Collection and grown in RPMI 1640 supplemented with 5%
heat-inactivated fetal bovine serum (Intergen), 1% glutamine, and 1%
penicillin-streptomycin. To generate I
B
-expressing cell lines,
107 freshly thawed and exponentially growing U937 cells
were resuspended in RPMI 1640 and electroporated with 20 µg of
previously linearized DNA by use of a BTX cell electroporator at 250 V
for 10 ms. U937 cells electroporated without DNA were used as controls.
At 24 h after transfection, cells were resuspended in selection
medium containing 5% fetal bovine serum and 700 µg of G418 per ml.
After 3 to 4 weeks, upon the incipient growth of neomycin-resistant bulk cultures, cells were cloned by limiting dilution (30). Stable integration and expression of the transfected genes within each
monoclonal population were verified by serial passages of the cultures
in the absence of the selective antibiotic and by immunoblotting with
anti-Flag antibodies.
Separate clones expressing equal levels of Flag-I
B
constructs
were selected, and their CD4 surface expression was verified by flow
cytometry analysis. Thereafter, three clones expressing each of the
Flag-I
B
constructs were pooled, and exponentially growing cells
were mock or HIV infected. The level of expression of each of the
tagged I
B
constructs was confirmed before and during the period
of HIV infection by immunoblotting of cytosolic extracts with anti-Flag antibodies.
Transient transfection of U937 cells was performed as follows. A total
of 107 exponentially growing U937 cells were incubated with
4 µg of the con-luc or
B-con-luc reporter construct, 6 µg of the
pDNA3-I
construct, 4 µg of the pBLCAT2 reporter, and 300 µg
of DEAE-dextran (Pharmacia, Piscataway, N.J.) per ml for 90 min at room
temperature. Dimethyl sulfoxide (10%) was then added for 3 min,
followed by extensive washing and plating at 0.5 × 107/cells/ml. Two days later, cells were harvested.
Luciferase levels were measured with the Promega luciferase assay
system, and CAT activity was measured with a CAT enzyme-linked
immunosorbent assay kit (Boehringer).
HIV infection and measurement of HIV replication.
U937 cells
expressing SFFV, Flag-I
B
-wt, Flag-I
B
-
N,
Flag-I
B
-
C, Flag-I
B
-2N, and Flag-I
B
-4C were
infected with the HIV LAV-Bru strain as previously described (2,
34, 40). Briefly, 107 exponentially growing U937
cells were sedimented by low-speed centrifugation and resuspended
overnight in 10 ml of infective supernatant containing 360 ng of p24
per ml. Mock-infected cells were used as a control. After 24 h,
cells were extensively washed and resuspended in culture medium. Cells
were passaged twice a week at 0.25 × 106 cells/ml and
used from day 30 through day 90 postinfection. During this period, cell
supernatants were collected, precleared by centrifugation at 1,500 rpm
for 5 min at 4°C, and stored for future analysis of HIV p24 antigen
content by an enzyme-linked immunosorbent assay (Coulter-Immunotech
Immunology, Westbrook, Maine). At least eight consecutive infections
were used for each of these experiments. All the cell lines studied
maintained HIV persistence and 100% viability during the study period,
except for the U937 clones expressing Flag-I
B
-
C, which
maintained viability and normal growth while uninfected which underwent
immediate and massive cytopathicity upon HIV infection in four
consecutive attempts. Therefore, a U937 cell line expressing
Flag-I
B
-
C could not support a persistent HIV infection. In
addition, in some experiments, HIV gp120 expression was determined by
immunoblotting with anti-gp120 antibodies.
Nuclear and cytosolic extracts, electrophoretic mobility shift
assays, and immunoblotting.
Nuclear and cytosolic extracts were
prepared by a modification of the method of Dignam et al.
(17). A total of 107 cells were washed with
ice-cold phosphate-buffered saline and then with buffer A (10 mM HEPES
[pH 7.9], 1.5 mM MgCl2, 10 mM KCl). Cells were then lysed
for 10 min on ice in the same buffer containing 0.1% Nonidet P-40, 0.5 mM dithiothreitol (DTT), 0.5 mM phenylmethylsulfonyl fluoride (PMSF), 2 µg of aprotinin per ml, 2 µg of leupeptin per ml, and 2 µg of
pepstatin per ml. After centrifugation, cells were washed twice with
buffer A. Nuclei were pelleted by centrifugation, lysed by resuspension
in 25 µl of buffer C (20 mM HEPES, 25% glycerol, 0.42 M NaCl, 1.5 mM
MgCl2, 0.2 mM EDTA, DTT, PMSF, aprotinin, leupeptin,
pepstatin) and rotated at 4°C for 30 min. After centrifugation, the
supernatants were diluted in 50 µl of buffer D (20 mM HEPES, 20%
glycerol, 0.05 M KCl, 0.2 M EDTA, DTT, PMSF, aprotinin, leupeptin,
pepstatin) and stored at
70°C.
For electrophoretic mobility shift assays, 6 µg of nuclear extract
was incubated with a [
-32P]ATP-labeled double-stranded
NF-
B oligonucleotide probe in 15 µl of DNA binding buffer for 15 min at room temperature as previously described (2, 34, 40).
Components of the HIV-induced DNA binding protein complexes were
identified by incubation of the extract with specific polyclonal
antibodies against p50 and Rel-A prior to addition of the labeled
probe. The resulting protein-DNA complexes were resolved on a 5%
polyacrylamide gel and visualized by autoradiography.
To characterize the level of expression of the Flag-I
B
constructs
in uninfected and infected cells, 40 µg of cytosolic protein was
analyzed by SDS-10% PAGE. Proteins were transferred to Immobilon-P membranes (Millipore) by standard procedures and blotted with an
anti-Flag monoclonal antibody, followed by incubation with rabbit
anti-mouse immunoglobulin G (Pierce) and then horseradish peroxidase
(Amersham, Buckinghamshire, England). Immunoreactive proteins were
detected with an ECL Western blotting detection kit (Amersham).
-Actin and p90rsk were used as internal
controls for equal loading in all experiments.
Preparation of recombinant I
B
.
The I
B
-MAD3 cDNA
(26) plasmid was obtained from Cetus Corporation and was
used as a template for subsequent PCR amplification.
The amino-terminal I
B
-MAD3 (positions 1 to 54) sequence was
amplified with wild-type primer A (5'CGGGATCCATGTTCCAGGCGGCCGAG3') as the sense primer, creating a BamHI site upstream of
the coding sequence, and wild-type primer B
(5'GGAATTCCTCAGCGGATCTCCTGCAGCT3') as the antisense primer,
creating an EcoRI site downstream of the coding sequence. An
S32/36A double mutant was amplified from the full-length
cDNA by use of primers to create alanines at S32 and
S36. Following digestion with
BamHI-EcoRI, these sequences were ligated into
pGEX-KG (derived from pGEX-2T, from Pharmacia, Piscataway, N.J.). These
constructs were transformed into Escherichia coli DH5
cells, which were grown exponentially. After 60 min of stimulation with
isopropylthiogalactopyranoside (Sigma), cells were lysed. Proteins were
isolated by affinity chromatography on glutathione-bonded 4%
cross-linked agarose (Sigma). The purity of GST-I
B
(positions 1 to 54) containing the first 54 amino acids of I
B
and GST-I
B
(positions 1 to 54) containing S32/36A was analyzed by
SDS-10% PAGE and subsequent Coomassie blue staining. The purity of
both proteins was greater than 90%.
Immunoprecipitation of I
B
kinases and in vitro kinase
assays.
Whole-cell extracts were prepared for immunoprecipitation
and in vitro kinase assays as follows. Aliquots of 107
exponentially growing U937 cells were washed twice with cold phosphate-buffered saline, resuspended in lysis buffer containing 40 mM
Tris-HCl (pH 8), 0.3 M NaCl, 0.1% Nonidet P-40, 6 mM EDTA, 6 mM EGTA,
10 mM NaF, 10 mM p-nitrophenyl phosphate (PNPP), 10 mM
-glycerolphosphate, 300 µM sodium orthovanadate, 1 mM DDT, 2 µM
PMSF, 10 µg of aprotinin per ml, 1 µg of leupeptin per ml, and 1 µg of pepstatin per ml, and incubated on ice. Cells were then
centrifuged at 12,000 × g for 15 min at 4°C. The
resultant supernatant contained total cellular proteins, which were
quantitated with a Bio-Rad protein assay.
For immunoprecipitation of the I
complex,
p90rsk, or Raf-1, 100 µg of cell extract was
incubated with anti-I

, anti-I

, anti-p90rsk, or anti-Raf-1 antibodies for
1 h at 4°C, after which protein A-agarose beads (Life
Technologies, Gaithersburg, Md.) were added for 1 h. The beads
were then washed three times with 0.5 M NaCl-based lysis buffer,
followed by one wash with a buffer containing 50 mM Tris-HCl (pH 7.4)
and 40 mM NaCl. The washed beads were then incubated in 15 µl of
kinase buffer (20 mM HEPES [pH 7.4], 2 mM MgCl, 2 mM MnCl, 10 µM
ATP, 10 mM NaF, 10 mM PNPP, 10 mM
-glycerolphosphate, 300 µM
sodium orthovanadate, 2 µM PMSF, 10 µg of aprotinin per ml, 1 µg
of leupeptin per ml, 1 µg of pepstatin per ml, 1 mM DTT) with 2 µg
of GST-I
B
(positions 1 to 54) or GST-I
B
(positions 1 to 54)
containing S32/36A and 0.1 µCi of
[
-32P]ATP. The kinase reaction was performed for 30 min at 30°C, and samples were resolved by SDS-PAGE, transferred to
Immobilon-P membranes, and exposed to film.
 |
RESULTS |
Increased degradation of Flag-I
B
-wt in HIV-infected
cells.
To confirm the expression and functionality of the
Flag-I
B
constructs, pooled clones expressing equal levels of
Flag-I
B constructs were treated or not treated with TNF, followed by
the analysis of the cytosolic extracts by SDS-PAGE and immunoblotting with anti-Flag antibodies. As shown in Fig.
1A, TNF stimulation led to the rapid
hyperphosphorylation and subsequent degradation of Flag-I
B
-wt. In
contrast, Flag-I
B
-
N and Flag-I
B
-2N were refractory to
TNF-induced hyperphosphorylation and subsequent degradation.
Flag-I
B
-4C behaved similarly to Flag-I
B
-wt in that it was
susceptible to TNF-mediated hyperphosphorylation and degradation. These
results confirm that the constitutively overexpressed Flag-I
B
molecules are regulated as previously described for native I
B
and
highlight the functional relevance of the N terminus containing
S32 and S36 in TNF-induced I
B
hyperphosphorylation and degradation.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 1.
Functional characterization of Flag-I B molecules
in U937 cells. (A) Pooled clones of U937 cells expressing the different
Flag-I B constructs were stimulated with TNF for different time
periods, and the cell lysates were analyzed by immunoblotting with
anti-Flag antibodies. The hyperphosphorylated form of I B is
indicated by a small circle. (B) Immunoblotting of cell lysates from
mock-infected (NI) or HIV-infected (HIV), SFFV-expressing U937 cells
with anti-I B , anti-I B , anti-I B , and antiactin
antibodies. The hyperphosphorylated form of I B is indicated by a
small circle. (C) Immunoblotting of cell lysates from mock-infected
(NI) or HIV-infected (HIV), SFFV- or Flag-I B -wt-expressing U937
cells with anti-Flag and antiactin antibodies. (D) The half-life of
Flag-I B -wt was estimated by immunoblotting of cell lysates from
mock-infected (NI) or HIV-infected (HIV), Flag-I B -wt-expressing
U937 cells treated with cycloheximide (CHX) for different periods of
time with anti-Flag antibodies. Equal protein loading was calculated by
immunoblotting the same membrane with
anti-p90rsk antibody. (E) The half-life of
Flag-I B -wt was calculated by measuring with a densitometer the
disintegrations per minute of Flag-I B -wt and normalizing them to
those for p90rsk from each experimental time
point shown in panel D.
|
|
As expected (34), persistent HIV infection of U937
cells resulted in decreased cytosolic levels of native I
B
.
Moreover, I
B
and I
B
protein levels were also significantly
decreased in HIV-infected cells compared to uninfected cells (Fig. 1B).
Having determined that overexpressed Flag-I
B
constructs function
similarly to native I
B
upon stimulation with known inducers of
NF-
B and that HIV infection of U937 cells results in decreased steady-state levels of endogenous I
B, we next investigated whether Flag-I
B
-wt is also a target of HIV infection. Immunoblotting of cytosolic fractions from mock- and HIV-infected cells expressing Flag-I
B
-wt was performed with anti-Flag antibodies. U937 cells transfected with the parental empty retrovirus vector (SFFV) were also
mock or HIV infected and used as controls. As shown in Fig. 1C, the
steady-state protein levels of Flag-I
B
-wt were decreased in
the cytosolic fractions of HIV-infected cells compared to
mock-infected cells, confirming that HIV infection decreases
the cytosolic levels of Flag-I
B
and indicating that tagged
I
B
constructs can be used to study the regulatory domain(s)
targeted by persistent HIV infection in monocytes.
Having previously demonstrated that the decreased level of native
I
B
is a result of the enhanced rate of I
B
degradation in
persistently HIV-infected monocytes, we investigated whether this
process also accounted for the decreased level of Flag-I
B
-wt in
infected cells. The half-life of Flag-I
B
-wt was estimated by
immunoblotting Flag-I
B
-wt from cytosolic fractions from mock- and
HIV-infected cells treated for different time periods with cycloheximide. As shown in Fig. 1D, the turnover of Flag-I
B
-wt was increased in HIV-infected cells compared to mock-infected cells.
The half-lives of Flag-I
B
-wt calculated from Fig. 1D were found
to be approximately 60 min in HIV-infected cells and 128 min in
uninfected cells (Fig. 1E).
The NH2 terminus but not the PEST sequence present in
the COOH terminus of I
B
is necessary for I
B
degradation by
HIV infection.
To characterize which of the regulatory domains of
I
B
is targeted by HIV infection, we first focused on the
NH2-terminal domain of I
B
. We analyzed the turnover
and half-life of Flag-I
B
-
N. U937 cells stably transfected
with the empty retrovirus vector (SFFV), Flag-I
B
-wt, or
Flag-I
B
-
N were mock or HIV infected. The half-lives of
these constructs were measured by analyzing the levels of the
Flag-I
B
constructs in cytosolic extracts from cell cultures
treated for different time periods with cycloheximide (as for Fig. 1).
As shown in Fig. 2A, Flag-I
B
-
N
was very stable not only in mock-infected but also in HIV-infected U937
cells, with the resulting half-lives being estimated at greater than 4 h (Fig. 2B). The enhanced stability of Flag-I
B
-
N in
both mock- and HIV-infected cells contrasts with the more rapid
turnover of Flag-I
B
-wt in mock-infected cells and even more rapid
turnover in HIV-infected cells (Fig. 1D and Fig. 2A). These results
indicate that the increased degradation of I
B
that ensues in
HIV-infected cells appears to be dependent on the
NH2-terminal domain of the molecule. In addition, these
results highlight the potential relevance of this I
B
domain in
the regulation of the basal turnover of I
B
in unstimulated
transformed cells.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 2.
Deletion of the first 37 amino acids of I B conveys
resistance to HIV-mediated degradation. (A) Mock-infected (NI) or
HIV-infected (HIV), Flag-I B - N-expressing U937 cells were
treated with cycloheximide (CHX) for different time periods, after
which cell lysates were analyzed by immunoblotting with anti-Flag or
antiactin antibodies. (B) The half-life of Flag-I B - N was
calculated as described in the legend to Fig. 1E.
|
|
Previous studies have demonstrated that mutation of S283,
S288, T291, and S293 to alanines
eliminates the constitutive phosphorylation of I
B
mediated by
PK-CK2 and may influence the turnover of I
B
(5, 33, 35,
45). Based on this information, we analyzed the turnover and
half-life of Flag-I
B
-4C in mock- or HIV-infected U937 cells
and compared them to those of Flag-I
B
-wt. In mock-infected U937
cells, the basal turnover of Flag-I
B
-4C was slightly longer than
that of Flag-I
B
-wt (Fig. 3),
suggesting a potential role of the C-terminal amino acids
S283, S288, T291, and
S293 in the basal turnover of I
B
in unstimulated
monocytic cells. The half-life of Flag-I
B
-4C was shorter in
HIV-infected cells than in mock-infected cells but was similar to the
half-life of Flag-I
B
-wt in HIV-infected cells (Fig. 3). These
results demonstrate that the amino acids present in the PEST sequence
of I
B
are not involved in the HIV-mediated degradation and
turnover of I
B
.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 3.
Mutation of the phosphoamino acids present in the PEST
sequence does not alter the HIV-mediated degradation of I B . (A)
Mock-infected (NI) or HIV-infected (HIV), Flag-I B -4C- or
Flag-I B -wt-expressing U937 cells were treated for different time
periods with cycloheximide (CHX), and cell lysates were analyzed by
immunoblotting with anti-Flag and anti-p90rsk
antibodies. The lysates used for detecting
p90rsk levels were the same as those from
Flag-I B -4C-expressing U937 cells. Similar results were obtained
with Flag-I B -wt-expressing U937 cell lysates. (B) The half-lives
of Flag-I B -4C (left panel) and Flag-I B -wt (right panel)
were calculated as described in the legend to Fig. 1E.
|
|
HIV-induced degradation of Flag-I
B
requires phosphorylation
at the NH2-terminal residues S32 and
S36.
Several studies have identified S32
and S36 as targets of inducible I
B
kinases (8,
9, 11, 15, 46, 49, 50, 52). As shown in Fig. 1A, mutation of
S32 and S36 to alanines yields an I
B
construct that is refractory to the hyperphosphorylation and subsequent
degradation triggered by TNF in U937 cells. Having identified the
NH2-terminal domain of I
B
as a target of HIV-induced
degradation, we next questioned whether S32 and
S36 could be the amino acids that are targeted by HIV
infection. For this, we investigated the half-life and turnover of
Flag-I
B
-2N in mock- and HIV-infected U937 cells and compared them
to the half-life and turnover of Flag-I
B
-wt. Following the same
experimental design as that used for Fig. 2 and 3, we observed that in
mock-infected cells, mutation of S32 and S36 to
alanines significantly prolonged the half-life of I
B
(greater than 5 h) compared to the more rapid turnover of Flag-I
B
-wt (Fig. 4). This very low rate of basal
degradation of Flag-I
B
-2N is similar to that observed for
Flag-I
B
-
N (Fig. 2). Relevant to the focus of this study, we
demonstrate that the half-life of Flag-I
B
-wt is significantly
reduced in HIV-infected cells compared to mock-infected cells and that
Flag-I
B
-2N was refractory to HIV-mediated I
B
degradation
(Fig. 4). These results confirm that S32 and
S36 are the I
B
amino acids targeted by persistent HIV
infection to result in enhanced degradation of I
B
.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 4.
Mutation of S32 and S36 of
I B abrogates HIV-mediated I B degradation. (A) Mock-infected
(NI) or HIV-infected (HIV), Flag-I B -2N- or
Flag-I B -wt-expressing U937 cells were treated with cycloheximide
(CHX) for different time periods, after which cell lysates were
analyzed by SDS-PAGE and immunoblotted with anti-Flag and
anti-p90rsk antibodies. The
p90rsk lysates were the same as those from
Flag-I B -2N-expressing U937 cells. Similar results were obtained
with Flag-I B -wt-expressing U937 cell lysates. (B) The half-lives
of Flag-I B -2N and Flag-I B -wt were calculated as described
in the legend to Fig. 1E.
|
|
S32 and S36 are the targets of I
B
kinases
that are activated by a variety of stimuli, such as inflammatory
cytokines, and phosphorylation at these amino acids renders I
B
susceptible to degradation by the proteosome (8, 9, 11, 12, 15,
16, 24, 29, 37, 42, 43, 46, 49, 50, 52, 53, 57). To investigate whether HIV infection results in the hyperphosphorylation of I
B
, mock- or HIV-infected U937 cells expressing Flag-I
B
-wt were treated with the proteosome inhibitor ALLN for 3 h, after which cytosolic extracts were separated by SDS-PAGE and immunoblotted with
anti-Flag antibodies. To control for the accurate detection of
hyperphosphorylated I
B
, mock-infected Flag-I
B
-wt-expressing U937 cells were treated or not treated with TNF and/or a
pharmacological inhibitor previously shown to inhibit the TNF-induced
hyperphosphorylation of I
B
(Bay 11-7082) (41). As
shown in Fig. 5 (upper panel), a more
slowly migrating form of Flag-I
B
-wt was observed in
mock-infected, TNF-treated cells, specifically in the presence of ALLN
(lanes 3 and 4). In HIV-infected Flag-I
B
-wt-expressing U937
cells, a more slowly migrating form of Flag-I
B
-wt was
observed only when ALLN was used (compare lanes 6 with lane 5). These
effects are dependent on the presence of S32 and
S36 in the Flag-I
B
construct, as their mutation
to alanines abrogated both TNF-induced and HIV-dependent
I
B
hyperphosphorylation (Fig. 5, lower panel). Altogether, these
results indicate that the enhanced degradation of I
B
that is
observed in HIV-infected monocytes is a result of specific
hyperphosphorylation of I
B
at S32 and
S36. Whether the differences in the kinetics of I
B
hyperphosphorylation at S32 and S36
between transient stimuli, such as TNF, and chronic stimuli, such as
persistent HIV infection, are due to the use of different I
B
kinases or simply different upstream control mechanisms is currently
unknown.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 5.
HIV infection of U937 cells induces hyperphosphorylation
of I B which is dependent on S32 and S36.
Mock-infected (NI) or HIV-infected (HIV), Flag-I B -wt- or
Flag-I B -2N-expressing U937 cells were treated (+) or not treated
( ) with Bay 11-7082 (Bay 11), TNF, or ALLN, after which the cell
lysates were analyzed by SDS-PAGE and immunoblotted with anti-Flag
antibodies. The supershifted hyperphosphorylated I B form of
Flag-I B -wt is indicated by a bullet.
|
|
The I
complex mediates HIV-dependent I
B
degradation and
NF-
B activation.
Two kinases in the I
complex (I

and I

) have recently been shown to phosphorylate
S32 and S36 of I
B
and to be the targets
of inflammatory cytokines, such as TNF and interleukin 1 (12, 16,
29, 37, 42, 53, 57). Having identified S32 and
S36 as the regulatory amino acids of I
B
which are
targeted by HIV, we questioned whether the I
complex is activated
by HIV infection and mediates the increased levels of nuclear NF-
B
activation in infected cells. Mock-infected and persistently
HIV-infected U937 cells were lysed, followed by immunoprecipitation of
the I
complex, p90rsk, or Raf-1. The
kinase activities of these immunoprecipitates were analyzed in an in
vitro kinase reaction with GST-I
B
(positions 1 to 54) or
GST-I
B
(positions 1 to 54) containing
S32/36A as a substrate. In HIV-infected samples,
increased I
B
kinase activity was present in the I
complex
immunoprecipitate but not in the p90rsk (Fig.
6A) or the Raf-1 (data not shown)
immunoprecipitate. This kinase activity was specific for
S32 and S36, as their mutation eliminated the
basal and HIV-induced I
complex activity. Also, as shown in Fig.
6A, there was no difference in the amounts of I
complex
immunoprecipitated with anti-I

antibodies in mock- and
HIV-infected U937 cells, thus eliminating the possibility that HIV
infection simply increases the pool of I
kinases. These data
indicate that HIV infection activates the I
complex, resulting in
phosphorylation at S32 and S36.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 6.
The I complex but not
p90rsk mediates the HIV-induced activation of
NF- B. (A) In vitro kinase assay of I and
p90rsk. Immunoprecipitates (IP) from
mock-infected (NI), mock-infected and TNF treated (TNF), and
HIV-infected (HIV), SFFV-expressing U937 cells were lysed, and the
I complex and p90rsk were
immunoprecipitated with anti-I  and
anti-p90rsk antibodies, respectively.
Immunoprecipitates were analyzed in an in vitro kinase (IVK) assay with
recombinant protein I B -wt (positions 1 to 54) or I B
S32/36A (positions 1 to 54) as a substrate
(32P-I B ). The membrane was subsequently stained with
Coomassie blue (stained I B ) or immunoblotted (Immunoblot) with
anti-I  , anti-I  , or anti-p90rsk
antibodies. (B) SFFV-expressing, HIV-infected U937 cells were
transiently transfected with con-luc ( ) or B-con-luc ( )
together with expression vectors for wild-type (WT) or negative
dominant (nd) forms of I  or I  and a TK CAT reporter
gene. Luciferase units were normalized to CAT units. The NF- B
luciferase activity of uninfected, SFFV-expressing cells was similar to
that of con-luc in HIV-infected cells, and none of the I  or
I  (wt or nd) expression vectors modified the basal level of
plasmid B-luc activity in uninfected cells (data not shown). This
experiment is representative of three additional ones. Each
transfection point was determined in duplicate, and error bars
indicate ± standard deviations.
|
|
The potential relevance of the I
complex in mediating the
HIV-dependent activation of NF-
B was further analyzed in transient transfection experiments. Transcription from an NF-
B-dependent luciferase reporter gene was analyzed with both mock- and HIV-infected U937 cells in the presence or absence of wild-type or dominant negative
forms of I

and I

. A minimal TK promoter driving the
expression of CAT was used to normalize for transfection efficiency differences that might be present between mock- and HIV-infected cells.
The results of these experiments demonstrated that the increased
NF-
B activity that is observed in HIV-infected cells is reduced by
an I

dominant negative expression vector but not by a dominant
negative form of I

or the wild-type form of either kinase
(Fig. 6B). Altogether, these studies demonstrate that the I
complex is activated by HIV infection and mediates virus-induced
I
B
hyperphosphorylation and NF-
B activation.
HIV-1 replication in U937 cells expressing different transdominant
mutants of I
B
.
Having determined that S32 and
S36 of I
B
are required for HIV-mediated I
B
degradation, we next questioned whether U937 cells expressing
Flag-I
B
-
N or Flag-I
B
-2N (constructs that are
refractory to HIV-dependent degradation) would inhibit HIV-mediated
NF-
B activation, and if so, whether this inhibition would result in decreased viral replication. Nuclear extracts and cell-free
supernatants were obtained from mock- or HIV-infected cells stably
transfected with the SFFV vector, Flag-I
B
-
N or
Flag-I
B
-2N at the same time as the cytosolic fractions were
analyzed to determine the half-lives of the respective I
B
constructs (Fig. 2 and 4). Nuclear extracts were analyzed by a gel
shift assay with an oligonucleotide containing NF-
B DNA binding
motifs, and viral replication was monitored by measuring p24 levels in
culture supernatants. As shown in Fig. 7A
and B, left panels, HIV infection of SFFV-expressing U937 cells led to
nuclear translocation of a DNA binding protein complex composed of p50
and Rel-A (p65); this finding was not observed in HIV-infected cells
expressing either Flag-I
B
-
N or Flag-I
B
-2N (Fig. 7A and
B, right panels). These observations directly correlate with the
inability of these two Flag-I
B
constructs to undergo HIV-mediated
degradation, as demonstrated in Fig. 2 and 4.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 7.
Genetic interference with HIV-mediated NF- B
activation does not result in reduced HIV replication. (A) Gel shift
assays of nuclear extracts from mock-infected (NI) or HIV-infected
(HIV), SFFV- or Flag-I B - N-expressing U937 cells. Antibodies
against p50 (p50) or p65 (p65) were added to the gel shift assay. The
corresponding molecular complex is indicated. (B) Same panel A, except
that nuclear extracts from SFFV-expressing U937 cells were compared in
parallel to those from Flag-I B - -2N-expressing U937 cells. (C)
The HIV p24 content in supernatants of HIV-infected, SFFV-expressing
U937 cells ( ) or cells expressing Flag-I B - N ( ) and
Flag-I B -2N ( ) was calculated in duplicate. This experiment is
representative of two additional ones. Error bars indicate standard
deviations.
|
|
The levels of HIV replication in the cells expressing SFFV,
Flag-I
B
-
N, or Flag-I
B
-2N were then analyzed by measuring HIV p24 levels in supernatants from the same cultures as those used to
study the I
B
half-life (Fig. 2 and 4) and NF-
B nuclear translocation (Fig. 7A and B). The results of these experiments indicated that there was no significant reduction in the levels of p24
in supernatants of U937 cells expressing Flag-I
B
-
N or Flag-I
B
-2N compared to supernatants of control cultures (SFFV expressing) (Fig. 7C).
 |
DISCUSSION |
Using an HIV-susceptible promonocytic cell line which can support
persistent viral replication, we have determined that the I
B
residues S32 and S36 and the I
complex
(12, 16, 29, 37, 42, 53, 57) are required to mediate
HIV-dependent I
B
degradation and, hence, NF-
B activation. The
identification of a transdominant negative I
B
molecule which is
refractory to HIV-dependent degradation and thus is capable of blocking
the HIV-mediated activation of NF-
B extends and confirms previous
studies from our group indicating that I
B
is a target molecule
and that persistent HIV infection leads to increased NF-
B activation
(34). In addition, it provides supporting data that
HIV-mediated NF-
B (p50/p65) activation is not necessary to support
viral persistence in the U937 monocytic cell line.
The use of pooled clones of monocytic cells that constitutively express
genetically modified I
B
constructs has proven to be a valuable
tool with which to study the role of NF-
B replication in HIV
persistence. Different from punctual stimuli (inflammatory cytokines or
transient expression of human T-cell leukemia virus type 1 tax), the activation of NF-
B by HIV infection is
dependent on the establishment of viral persistence, achieved only
after 6 to 10 days of viral infection (2, 34, 40). Due to
this unique virus-host cell interaction, the experimental approaches which can be utilized to address the mechanisms by which HIV activates NF-
B have been significantly limited. Previous attempts have used
nonmonocytic cell lines which a