Previous Article | Next Article 
Journal of Virology, May 1999, p. 3789-3799, Vol. 73, No. 5
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Modulation of Phosphate Uptake and Amphotropic
Murine Leukemia Virus Entry by Posttranslational Modifications
of PIT-2
Pierre
Rodrigues and
Jean Michel
Heard*
Laboratoire Rétrovirus et Transfert
Génétique, CNRS URA 1157, Institut Pasteur, 75724 Paris, France
Received 4 September 1998/Accepted 19 January 1999
 |
ABSTRACT |
PIT-2 is a type III sodium phosphate cotransporter and the receptor
for amphotropic murine leukemia viruses. We have investigated the
expression and the functions of a tagged version of PIT-2 in CHO cells.
PIT-2 remained equally abundant at the cell surface within 6 h
following variation of the phosphate supply. In contrast, the efficiency of phosphate uptake and retrovirus entry was inversely related to the extracellular phosphate concentration, indicating that PIT-2 activities are modulated by posttranslational modifications of cell surface molecules induced by phosphate. Conformational changes
of PIT-2 contribute to both activities, as shown by the inhibitory
effect of sulfhydryl reagents known as inhibitors of type II
cotransporters. A physical association of PIT-2 with actin was
demonstrated. Modifications of the actin network were induced by
variations of the concentrations of extracellular phosphate, cytochalasin D, or lysophosphatidic acid. They revealed that the formation of actin stress fibers determines the cell surface
distribution of PIT-2, the internalization of the receptor in response
to virus binding, and the capacity to process retrovirus entry. Thus,
the presence of PIT-2 at the cell surface is not sufficient to ensure phosphate transport and susceptibility to amphotropic retrovirus infection. Further activation of cell surface PIT-2 molecules is
required for these functions.
 |
INTRODUCTION |
Three families of sodium-dependent
phosphate (NaPi) cotransporters have been identified in
eukaryotes. The type I NaPi cotransporter (NaPi-1) is expressed mostly in the kidneys and liver
(15). Type II NaPi cotransporters
(NaPi-2 to NaPi-7) are present in the
brush border membrane of renal proximal tubules and intestine microvilli (21). Type III NaPi
cotransporters include the mammalian PIT-1 and PIT-2
cotransporters and the Pho-4 protein of the filamentous fungus
Neurospora crassa. PIT-1 and PIT-2 are widely expressed in mammalian tissues (2). No significant homology has been found for type I and type II NaPi cotransporters, but
structural similarities may exist. Predicted amino acid sequences
indicate 10 potential transmembrane domains and a large hydrophilic
loop near the center of the molecule. These molecules were originally identified as cell surface receptors for oncoretroviruses
(20). PIT-2 serves as a receptor for murine leukemia viruses
(MLV) coated with the amphotropic envelope (amphotropic MLV [A-MLV]).
Although A-MLV-derived vectors are now broadly used for gene therapy
purposes, very little is known about the biology of their receptor.
Retrovirus entry is initiated by the binding of envelope glycoproteins
to cell surface receptors. Subsequent refolding of the heterotrimeric
envelope glycoproteins reveals fusogenic epitopes. Following
fusion of the viral envelope with the plasma membrane, the viral
core is released in the cytosol. The fusion reaction may require
a low-pH environment, as for ecotropic MLV and MLV pseudotypes bearing
the vesicular stomatitis virus envelope glycoprotein (VSV-G), or
may be independent of pH, as for A-MLV. With regard to pH dependence,
it is thought that fusion occurs in endosomal vesicles for ecotropic
and VSV-G envelopes, whereas it could take place at the cell surface
for amphotropic viruses (30). However, how receptors
contribute to the entry process is not understood.
The regulation of the transmembrane transport of inorganic phosphate
(Pi) is crucial for the maintenance of the intracellular Pi pool and for the homeostatic control of the phosphate
concentration. Phosphate uptake is adjusted in response to changes in
extracellular Pi supply. Chronic deprivation increases the
synthesis of type II (22) and type III (3, 4, 23)
cotransporters. In contrast, the adaptation of type II cotransporters
to acute changes occurs within minutes, without de novo protein
synthesis (27). It involves conformational changes of the
cotransporters (25, 26) as well as sorting, endocytosis,
recycling, and degradation, which are partly controlled by parathormone
(28). Microtubules and microfilaments play a role in this
process (18). Recently, indirect evidence has suggested that
posttranslational modifications may also affect PIT-1 and PIT-2
activities (2, 32). However, this phenomenon has not been
directly investigated.
In this study, we have focused on the rapid changes of PIT-2 activities
in response to acute changes in phosphate supply. We observed that both
phosphate uptake and A-MLV entry were affected by the phosphate
concentration and by impairment of conformational changes of cell
surface molecules. Variations of extracellular Pi
concentrations ([Pi]) also modified the organization of
the actin cytoskeleton, with which PIT-2 was found to be physically associated. This association determined to a significant extent the
distribution of cell surface PIT-2 and appeared crucial for the
internalization of the receptor in response to virus binding and for
processing virus entry.
 |
MATERIALS AND METHODS |
Antibodies and reagents.
Monoclonal antibodies (MAb) AC-40,
P5D4 (12), Cy3-conjugated P5D4 (P5D4-Cy3), and fluorescein
isothiocyanate-conjugated phalloidin (phalloidin-FITC) were from Sigma
(St. Louis, Mo.). Phycoerythrin (RPE)-conjugated goat anti-mouse and
anti-rat immunoglobulin G (IgG) antibodies were from Southern
Biotechnology (Birmingham, Ala.). MAb 83A25 (6) was obtained
from R. Evans (Rocky Mountain Laboratory, Hamilton, Mont.). The rabbit
polyclonal serum against human PIT-2 was a gift from J. V. Garcia
(St. Jude Research Hospital, Memphis, Tenn.) (3).
Cytochalasin D, lysophosphatidic acid (LPA), 4-chloromercuribenzoic
acid (PCMB), and 4-(chloromercuri)benzene-sulfonic acid (PCMBS) were
from Sigma-Aldrich (St. Louis, Mo.).
C-terminal VSV-tagged PIT-2 (PIT-2V) construction.
The
11-residue epitope of the VSV-G C terminus (12) was fused to
the C terminus of human PIT-2 by PCR. The C-terminal half of PIT-2,
without the stop codon, was amplified with
5'-GAGCTGCGGACTCATCGG-3' and
5'-CCCGGAATTCTCATTTTCCTA ATCGATTCATTTCTATGTCTGTGTATGGGCCTGGTGGGCCCACATAT GGAAGGATCCCATACATGAGAAG-3'
as positive- and negative-strand primers, respectively. The latter contained sequences encoding a spacer peptide
(G-P-P-G-P), the VSV-G epitope, and a stop codon, followed by an EcoRI restriction site. Amplification products were
digested with XhoI and EcoRI and inserted in
plasmid pCDNA3 into which the PIT-2 cDNA of pOJ74 (33) had
been previously transferred.
Cell lines.
TE671 and TelcEB6 cells were cultured in
Dulbecco modified Eagle medium (DMEM), and CHO and CEAR 13 cells
(10) were cultured in Ham F-12 medium supplemented with 10%
fetal bovine serum. Media with defined [Pi] were based on
phosphate-free RPMI 1640 (ICN, Costa Mesa, Calif.)
supplemented with 10% dialyzed fetal bovine serum and
various molarities of Na2HPO4 and
NaH2PO4. CHO cell clones expressing PIT-2V
(CHO-PIT-2V), selected with G418 (1 mg/ml), were screened for cell
surface PIT-2V expression and susceptibility to amphotropic virus infection.
Retroviruses.
Amphotropic and VSV-G pseudotype stocks of a
retrovirus vector containing the nls-lacZ gene expressed
under the control of the long terminal repeat were prepared from a
stable
-CRIP cell clone and from TelcEB6 cells (5)
transiently transfected with plasmid DNA encoding VSV-G
(35), respectively. Twenty-four-hour supernatants of
confluent cultures were collected, filtered through 0.45-µm-pore-size
filters, and stored at
80°C until use. Infectious titers, as
determined on NIH 3T3 cells, were 107 and 105
-galactosidase focus-forming units (FFUs) per ml for the A-MLV and
VSV-G pseudotypes, respectively. Amphotropic vector stocks contained soluble amphotropic envelope surface components (SUs) which
are detectable by Western blotting, which can bind cell surface
receptors, and which are detectable by MAb 83A25 in binding assays.
Immunoprecipitation and Western blotting.
For
immunoprecipitation, CHO-PIT-2V or TE671 cells were incubated for
2 h with defined [Pi]. Cells were washed with HBS
(10 mM HEPES-buffered saline) with adjusted [Pi] and
lysed in 1 ml of HBS with adjusted [Pi]-0.5% Triton
X-100-protease inhibitors. Cell extracts were recovered with a cell
scraper, kept on ice for 15 min, frozen-thawed, and incubated overnight
at 4°C with AC-40 (1:300 dilution) or a control IgG2a MAb. Immune
complexes were precipitated with protein A-agarose for 2 h at
4°C, washed with ice-cold phosphate-buffered saline (PBS), run on a
sodium dodecyl sulfate-10% polyacrylamide gel, and analyzed by
Western blotting.
For Western blotting, samples were electrophoresed on sodium dodecyl
sulfate-10% polyacrylamide gels, transferred to nitrocellulose membranes, incubated overnight at 4°C with the primary antibody (rabbit anti-PIT-2 serum, 1:250 dilution, or AC-40, 1:1,000 dilution), washed, and revealed with a horseradish peroxidase-coupled secondary antibody and enhanced chemiluminescence (ECL kit from Amersham).
Virus infection experiments.
Cells (5 × 104) maintained at physiological [Pi] were
switched to medium containing various [Pi] or drug
concentrations. After 30 min at 37°C, 100 FFUs of the vector
preparation was added for 30 min in the presence of 8 µg of Polybrene
per ml. Cells were incubated for 5 h with fresh medium containing
equivalent [Pi] or drug concentrations. Cells were washed
and further cultivated for 24 h in normal culture medium prior to
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal)
staining and scoring of
-galactosidase-positive foci.
Phosphate uptake measurements.
Cells (2 × 105) were seeded on 24-well plates and cultured overnight.
After preincubation with or without phosphate, cytochalasin D, PCMB, or
PCMBS for 30 min at 37°C followed by three washes with HBS, cells
were incubated with 300 µl of
NaH232PO4 (5 µCi/ml; specific
activity, 200 mCi/mmol) in phosphate-free medium for 1 min at room
temperature. Cells were immediately washed once with 40 mM
NaH2PO4 in PBS and twice with PBS. Cell
extracts were prepared in PBS with 1% Triton X-100, and radioactivity
was counted with a 1450 Microbeta Trilux (Wallac). Data were expressed relative to the total protein concentration measured in cell extracts (bicinchoninic acid kit; Pierce, Rockford, Ill.). All experiments were
performed in triplicate.
Immunofluorescence.
For PIT-2 and actin determinations,
105 cells were seeded on coverslips and cultured
overnight. After incubation in defined [Pi] for 2 h,
cells were fixed in 3% formaldehyde in the same medium for 20 min at
room temperature and quenched with 50 mM NH4Cl in PBS for
10 min. Permeabilization was performed with 0.1% Triton X-100-3%
formaldehyde in culture medium for 5 min at room temperature before
quenching. Coverslips were placed on a 25-µl drop containing P5D4-Cy3
(1:500 dilution in 1% bovine serum albumin [BSA]-0.1% azide in PBS
[PBA]) and/or phalloidin-FITC (0.25 µg/ml). The same procedure was
used for internalization assays, except that cells were exposed to 30 µl of the amphotropic vector stock (multiplicity of infection
[MOI], 3) for 2 h at 37°C prior to fixation and
permeabilization. When used, drugs were added 30 min prior to fixation.
Images were acquired with a Zeiss confocal fluorescence microscope and
contrast enhanced with Adobe Photoshop 4.0 software.
Flow cytometry analysis.
Virus binding assays were performed
on confluent cells after incubation at various [Pi] or in
the presence of various drugs for 30 min at 37°C. Cells were
collected with 2 mM EDTA in HBS and exposed to the amphotropic vector
stock in defined [Pi] for 30 min at 37°C or 16 h
at 4°C (MOI, 3). After being washed with ice-cold PBS, cells were
either labeled immediately or incubated at 37°C for various periods
of time prior to being washed and labeled with MAb 83A25 (1:2
dilution) (6) for 1 h at 4°C. After being washed with
ice-cold PBS, cells were stained with RPE-conjugated goat anti-rat IgG
in PBA (1:150 dilution), washed, and fixed (1% formaldehyde in PBA)
before analysis on a FACScan (Becton Dickinson).
Analysis of PIT-2V expression was performed by incubating cells for
3 h at 4°C with P5D4 (1:500 dilution in PBA) and then
staining
them with an RPE-conjugated secondary antibody. For PIT-2V
internalization studies, cells were treated as for virus binding
assays, except that labeling was done with MAb P5D4 (1:500
dilution).
 |
RESULTS |
We investigated the expression and the NaPi
cotransporter and amphotropic retrovirus receptor functions of
PIT-2. Tagged versions of human PIT-2 (PIT-2V) were
generated with the aim of detecting extracellular epitopes. The
11-amino-acid (YTDIEMNRLGK) epitope of VSV-G recognized by
MAb P5D4 (13) was used for tagging. Modified PIT-2 coding sequences were inserted downstream of the human
cytomegalovirus promoter and expressed in CHO cells. Immunofluorescence
and flow cytometry analysis with P5D4 indicated that the tagging
epitope was detectable at the outer side of the plasma membrane when
inserted at the C terminus of PIT-2. This finding was not
predicted by sequence analysis, which located the C terminus of
PIT-2 intracellularly. Other constructs gave negative results. A
cell clone stably expressing the C-terminally tagged version of
PIT-2 (PIT-2V) was isolated. Immunoprecipitation
of 35S-methionine- and
35S-cysteine-labeled CHO-PIT-2V cell extracts
with P5D4 revealed a 70-kDa PIT-2-specific signal (data not
shown). PIT-2V could not be detected by Western blotting with
P5D4, but a strong signal was specifically revealed with a rabbit serum
raised against the intracellular loop of human PIT-2
(3). Whereas the endogenous PIT-2 molecule is not
functional for amphotropic virus binding and infection in parental CHO
cells, CHO-PIT-2V clones bound amphotropic envelope glycoproteins
efficiently (Fig. 1B, E, and H). Binding was threefold higher than in human TE671 cells, which express 1.4 × 105 amphotropic receptors at the surface (data
not shown) (1). Exposure of CHO-PIT-2V clones to an
amphotropic pseudotype of a retrovirus vector carrying
nls-lacZ induced
-galactosidase-positive foci
(Fig. 1C, F, and I). The uptake of extracellular
Na2H32PO4 was eightfold
higher in CHO-PIT-2V clones than in parental CHO cells (Fig.
1A), indicating that PIT-2V participated significantly in
transmembrane Pi transport in CHO-PIT-2V cells. Taken
together, these data indicated that PIT-2V was efficiently
expressed and functioned as a phosphate transporter and as a receptor
for amphotropic retroviruses in CHO-PIT-2V cells.

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 1.
Extracellular [Pi] and inhibitors of
Pi transport affect PIT-2V functions. (A to C) Control
experiments performed with 1 mM [Pi] in the absence of
drug. (A) Increased Pi uptake in CHO-PIT-2V cells (CRAV)
compared to parental CHO cells (CHO). (B) Flow cytometry revealed
amphotropic envelopes bound to CHO-PIT-2V cells (solid line and no
asterisks) but not to parental CHO cells (broken line). Asterisks
indicate signals without viral envelopes. (C) Exposure to an
amphotropic lacZ retrovirus vector induced
-galactosidase-positive foci on CHO-PIT-2V cells but not parental
CHO cells (data not shown). Equal numbers were scored with various
concentrations (x axis) of NaCl (closed circles) or
NaHCO2 (open circles). (D to F) CHO-PIT-2V cells maintained
at physiological [Pi] (1 mM) were switched to medium
containing the indicated [Pi] (x axis) for 30 min at 37°C. (D) NaH232PO4 uptake
was affected by changing the Na2HPO4
concentration (closed circles; sulfate, 0.4 mM) but not the
Na2SO4 concentration (open circles; phosphate,
0 mM). (E) Equivalent binding of amphotropic envelopes at 0 mM (solid
line) and 40 mM (broken line) [Pi]. (F) Infection
efficiency for CHO-PIT-2V cells (closed circles; 100%, 97 ± 9 FFUs) or CEAR 13 cells (closed squares; 100%, 265 ± 21 FFUs)
with an amphotropic vector and different [Pi]. In
contrast, infection of CHO-PIT-2V cells with a VSV-G pseudotype (open
circles; 100%, 90 ± 7 FFUs) or of CEAR 13 cells with an
ecotropic pseudotype (open squares; 100%, 179 ± 5 FFUs) was
unaffected. (G to I) To CHO-PIT-2V cells maintained at physiological
[Pi] (1 mM) were added the indicated concentrations of
PCMB (squares) or PCMBS (circles) for 30 min at 37°C. (G) Drugs
inhibited Na2HPO4 uptake. (H) Unmodified
binding of amphotropic envelopes (solid line, no drug; broken line, 200 µM PCMB; dotted line, 200 µM PCMBS). (I) Drugs inhibited infection
with an amphotropic (Ampho) vector (closed symbols; 100%, 125 ± 12 FFUs) but not with a VSV-G pseudotype (open symbols; 100%, 95 ± 17 FFUs). Data are means ± standard deviations for triplicate
experiments.
|
|
Effects of extracellular [Pi] on PIT-2
functions.
We examined whether PIT-2V functions are affected when
extracellular [Pi] vary. Intracellular
Na2H32PO4 uptake, cell surface
binding of amphotropic envelope glycoprotein, and cell susceptibility
to retrovirus infection were examined less than 6 h after the
cells were switched from the physiological extracellular
Na2HPO4 concentration (1 mM) to medium
containing Na2HPO4 concentrations ranging from
0 to 40 mM. Na2H32PO4 uptake was
increased twofold 30 min after the cells were switched to 0 mM
Na2HPO4 (Fig. 1D). The level of infection
with an amphotropic vector increased to 125% ± 5% (n,
3) the initial value after 5 h (Fig. 1F). Both
Na2H32PO4 uptake and the level of
infection were rapidly reduced after the cells were switched
to high [Pi] (Fig. 1D and F). Reduction was not
observed in control experiments performed with equivalent concentrations of Na2SO4, NaCl, or
NaHCO2, indicating that this effect was not a consequence
of increased osmolality but rather was specific for phosphate (Fig. 1C
and D). Virus particles interacting with PIT-2V were specifically
affected, as shown by the absence of an effect of [Pi] on
control pseudotypes of MLV particles bearing VSV-G or ecotropic
viral envelopes incubated on CHO cells expressing the mCAT1 cell
surface receptor (CEAR 13) (10) (Fig. 1F). Amounts of
cell-bound viral envelopes were not affected at high [Pi]
(Fig. 1E), indicating that the reduction of phosphate transport and virus entry was due not to a decreased number but rather to a decreased
activity of cell surface PIT-2V molecules.
As the substrates for the transport reaction, Na and P
i
induce conformational changes of type II NaP
i
cotransporters, which
could be identified by tryptophan fluorescence
quenching (
24).
Depending on the residues with which they
react, sulfhydryl reagents,
such as PCMB and PCMBS, affect these
conformational changes and
operate as noncompetitive inhibitors of the
cotransport reaction
(
16,
26). We examined whether these
drugs also affect PIT-2V
functions.
Na
2H
32PO
4 uptake and susceptibility
to amphotropic virus infection were
measured with CHO-PIT-2V cells
exposed for 30 min to various concentrations
of these drugs. Fifty
percent inhibition of P
i uptake was observed
with 500 µM
PCMB or 250 µM PCMBS (Fig.
1G). Inhibition of amphotropic
virus
infection was obtained at much lower concentrations (50%
inhibitory
concentration, 10 µM) (Fig.
1I). Endogenous P
i transport
systems may account for this difference. In contrast, envelope
glycoprotein binding was unaltered at 200 µM PCMB or PCMBS (Fig.
1H),
and cell infection with control VSV-G pseudotypes was not
affected
(Fig.
1I). Thus, impairing substrate-induced conformational
changes of
cell surface PIT-2V affected both phosphate transport
and virus
entry but neither the number of molecules present at
the cell surface
nor the binding of amphotropic envelope glycoproteins.
These results
suggest that conformational changes of cell surface
PIT-2 affect
its
activity.
Effect of [Pi] on the association of PIT-2 with
the actin network.
We examined whether changes in extracellular
[Pi] modify the PIT-2V cell surface expression
pattern. CHO-PIT-2V cells maintained at physiological
[Pi] were switched to 0 or 40 mM
Na2HPO4 for 60 min and stained for cell surface
PIT-2V with P5D4 without permeabilization of the plasma membrane.
Cells were observed by immunofluorescence (Fig. 2A and
C). At 0 mM
Na2HPO4, confocal microscopy revealed linear
arrays of PIT-2V signals at the cell surface. Such images were not
observed at 40 mM. An intermediate phenotype was seen for cells
maintained at 1 mM (data not shown). Therefore, the cell surface
distribution of PIT-2V was affected by extracellular [Pi].

View larger version (73K):
[in this window]
[in a new window]
|
FIG. 2.
Effects of extracellular [Pi] on the cell
surface distribution of PIT-2V. CHO-PIT-2V cells maintained at
physiological [Pi] (1 mM) were switched to medium
containing the indicated [Pi] for 2 h at 37°C and
analyzed by confocal fluorescence microscopy for cell surface PIT-2V
expression with MAb P5D4-Cy3 (A and C) and for intracellular actin
filament structure with phalloidin-FITC (B and D). The same fields are
shown in panels A and B and in panels C and D. Inserts contain
enlargements of the same areas. Bar, 5 µm.
|
|
Since the PIT-2V pattern at 0 mM Na
2HPO
4
was reminiscent of that of membrane proteins associated with
intracellular actin
filaments, CHO-PIT-2V cells were doubly stained
with P5D4 and
fluorescein-conjugated phalloidin, which enters
nonpermeabilized
cells. Phosphate deprivation had a striking effect
on the actin
network (Fig.
3A to C). At 0 mM Na
2HPO
4, actin was distributed
as bright
linear arrays in stress fibers (Fig.
2B and
3A). At
40 mM
Na
2HPO
4, actin staining was diffuse, with few
visible structures
(Fig.
2D and
3C). Similar observations were made for
parental
CHO cells, indicating that this phenomenon was independent of
the presence of PIT-2V (data not shown). Cell treatment with PCMB
and PCMBS for 30 min did not affect the actin network (Fig.
3D
and E).

View larger version (119K):
[in this window]
[in a new window]
|
FIG. 3.
Effects of extracellular [Pi], PCMB,
PCMBS, and LPA on the actin network. CHO-PIT-2V cells maintained at
physiological [Pi] (1 mM) were switched to the indicated
conditions for 30 min, stained with phalloidin-FITC, and examined by
fluorescence microscopy. Bar, 5 µm.
|
|
In CHO-PIT-2V cells, PIT-2V staining was precisely localized
with that of actin stress fibers at 0 mM
Na
2HPO
4 (Fig.
2A and
B). Although some actin
structures were visible in cells incubated
with 40 mM
Na
2HPO
4, PIT-2V staining was not localized
with these
structures (Fig.
2C and D). These data indicated that
phosphate
deprivation stimulated the formation of actin stress fibers
and
resulted in the apparent colocalization of PIT-2V and actin
filaments.
The colocalization of PIT-2V with actin suggested that the
molecules can be physically associated. This possibility was
investigated
by coimmunoprecipitation experiments. CHO-PIT-2V cells
were incubated
for 2 h with 0, 1, or 40 mM
Na
2HPO
4, and cell extracts were prepared
at the
same [P
i]. PIT-2V was revealed by Western blotting
with
rabbit anti-PIT-2 antiserum. The amounts of PIT-2V were
independent
of [P
i] (Fig.
4A), confirming the observation made by
immunofluorescence.
Actin was revealed in the same extracts with MAb
AC-40. The actin
signal was slightly more intense at 0 mM than at 1 or
40 mM Na
2HPO
4.
Cell extracts were
precipitated with the antiactin MAb AC-40,
and immune complexes were
analyzed for the presence of PIT-2V
by Western blotting. A 70-kDa
signal comigrating with PIT-2V was
detected in CHO-PIT-2V
cells (Fig.
4B) but not in control CHO
cells (data not shown),
indicating the existence of PIT-2V-actin
molecular
complexes. This signal was more intense in extracts
prepared from cells
incubated at 0 mM rather than at 1 or 40 mM
Na
2HPO
4. Similar experiments were
performed with TE671 cells.
The detection of an endogenous human
PIT-2 signal required a much
longer exposure than that of PIT-2V in
CHO cells (Fig.
4A). A
70-kDa signal comigrating with PIT-2 was
detected by coimmunoprecipitation
at 0 mM but not at 1 or 40 mM (Fig.
4B), confirming the existence
of PIT-2-actin complexes, which
were more easily detected under
phosphate-deprived conditions.


View larger version (94K):
[in this window]
[in a new window]
|
FIG. 4.
Association of PIT-2 with actin. (A and B)
CHO-PIT-2V and TE671 cells were incubated at the indicated
[Pi] for 2 h. Cytochalasin D (Cyt. D) (1 µg/ml)
was added (+) or not added ( ) 45 min prior to analysis. (A) Western
blot with rabbit anti-PIT-2 serum (top panel; exposures:
CHO-PIT-2V, 15 s, and TE671, 15 min) and MAb AC-40 (bottom
panel; exposure: 15 s). (B) Immunoprecipitation (IP) with AC-40 or
a nonrelevant MAb (IgG2a) followed by Western blotting with rabbit
anti-PIT-2 serum. Signals corresponding to PIT-2 and IgG are
indicated. Exposures: CHO-PIT-2V, 3 min, and TE671, 10 min. (C)
Confocal immunofluorescence microscopy of CHO-PIT-2V cells treated
with cytochalasin D. Top panels show P5D4-Cy3 staining (red); middle
panels show phalloidin-FITC staining (green); and bottom panels show
superimposed staining (yellow). Bar, 5 µm.
|
|
The association of PIT-2 with actin filaments was confirmed by
treating cells with cytochalasin D, a drug which penetrates
nonpermeabilized living cells and disorganizes the actin network.
CHO-PIT-2V cells were incubated for 2 h with 0 or 40 mM
Na
2HPO
4,
and cytochalasin D (1 µg/ml) was
added during the last 45 min.
Cells were doubly stained with P5D4 and
fluorescein-conjugated
phalloidin and then analyzed by confocal
microscopy. Cytochalasin
D had a dramatic effect on the cell surface
PIT-2V distribution
(Fig.
4C). At 0 mM
Na
2HPO
4, PIT-2V staining was
condensed in large
aggregates and at the cell margins. Similar aspects
were observed
at 40 mM Na
2HPO
4, except
that the aggregates were smaller and
the staining at the cell margins
was more intense. These results
showed that the cell surface
distribution of PIT-2V depended on
the organization of the
intracellular actin network. Since actin
and PIT-2V staining
colocalized in aggregates but not at the cell
margins, it is likely
that only a fraction of cell surface PIT-2V
molecules was
associated with actin. More apparent colocalization
at 0 mM than at 40 mM Na
2HPO
4 suggested that the proportion of
PIT-2V molecules associated with actin increased at low
[P
i].
At 1 mM Na
2HPO
4,
coimmunoprecipitation experiments detected roughly
equivalent amounts
of PIT-2V associated with actin in the presence
and in the absence
of cytochalasin D (Fig.
4B), indicating that
cytochalasin D affected
the cell surface distribution of PIT-2V
but not the proportion of
molecules associated with
actin.
Effects of actin organization on PIT-2V functions.
We
examined whether drugs modifying the organization of the actin network
affect PIT-2V functions. CHO-PIT-2V cells were incubated with
cytochalasin D (1 µg/ml), an actin-desorganizing agent, or with LPA,
a drug stimulating actin stress fiber formation (11). Induction of actin polymerization by 10 µM LPA was verified for CHO-PIT-2V cells (Fig. 3E). Equivalent amounts of amphotropic retrovirus envelope bound to untreated cells and to cells treated with
cytochalasin D or LPA, indicating that these drugs did not modify the
number of receptors present at the cell surface (Fig. 5C).
Na2H32PO4 uptake was not
significantly modified by cytochalasin D or LPA (data
not shown). Susceptibility to amphotropic virus infection at 1 and 40 mM Na2HPO4 was studied (Fig. 5A). At 1 mM
Na2HPO4, the level of infection was strongly
decreased in the presence of cytochalasin D and increased 1.5-fold in
the presence of LPA. At 40 mM Na2HPO4,
actin-modifying drugs were not active for virus infection. Control
pseudotypes bearing VSV-G were not affected by cytochalasin D or LPA.
Since the effects of cytochalasin D are reversible, we determined the
window of time during which infection with amphotropic virus was
impaired. Data indicated that cytochalasin D was effective between 0 and 3 h after exposure to the virus (Fig. 5B). These data
indicated that the actin cytoskeleton plays a role in virus entry
through PIT-2 but not in the transmembrane transport of
Pi.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 5.
Effects of extracellular [Pi] and of
drugs modifying the actin network on A-MLV binding and infection.
CHO-PIT-2V cells were incubated at the indicated [Pi]
for 30 min without ( ) or with cytochalasin D (Cyt. D) (1 µg/ml) or
LPA (10 µM) prior to exposure to A-MLV (AMPHO) or VSV-G pseudotypes
for 30 min at 37°C under the same conditions. (A) Infection
efficiency. The virus input was 100 FFUs (MOI, 0.01). Cells were
incubated for 5 h under the same conditions, washed, and grown in
normal medium. -Galactosidase-positive foci at 1 mM Pi
were scored 24 h later. Reference values (100%) were 105 ± 8 foci for A-MLV and 95 ± 5 foci for VSV-G. Data are the mean
percentages of maximal infection ± standard deviations
(n = 3). (B) Kinetics of virus entry. The conditions were
the same as those in panel A, except that cytochalasin D (1 µg/ml) was added immediately after A-MLV exposure (time zero) or
after the indicated periods of time. The score at 24 h (100%
value) was 91 ± 7 foci. (C) Virus envelope binding assay.
Cell-bound A-MLV envelopes were analyzed by flow cytometry with MAb
83A25 30 min after the addition of the virus input (30 µl; MOI,
3). Solid line, no drug added; dotted line, cytochalasin D (1 µg/ml);broken line, LPA (10 µM). The asterisk
indicates staining without viral envelopes.
|
|
Internalization of PIT-2 in response to virus particle
binding.
We explored further the roles of extracellular
[Pi], PIT-2 conformational changes, and
actin microfilaments in amphotropic virus entry. Cell surface
PIT-2V expression in CHO-PIT-2V cells after exposure to
amphotropic virus was examined. Amphotropic virus particles were
allowed to bind receptors at 4°C. Virus binding was controlled by
staining with the anti-SU MAb 83A25 (data not shown). After the
elimination of unbound particles by washing, cells were warmed to
37°C for various periods of time and at various [Pi] in
order to trigger virus entry. Cell surface PIT-2V levels were
analyzed with P5D4 over time by flow cytometry (Fig.
6). In control experiments without
virus exposure, cell surface PIT-2V levels were stable over a 6-h
incubation period at 37°C. Analysis immediately after virus
exposure (time zero) indicated that PIT-2V was accessible to P5D4
when virus particles were attached to the cell surface. Cells
incubated with 0 mM Na2HPO4 showed a
decrease (65% reduction) of the cell surface PIT-2V signal at
1 h; the signal became almost undetectable after 4 h. At 1 mM
Na2HPO4, cell surface PIT-2V levels
decreased more slowly but were also undetectable after 6 h.
In contrast, the cell surface PIT-2V signal was stable over time at
40 mM Na2HPO4. Intermediate behaviors were observed at intermediate [Pi] (5 and 20 mM). After
previous treatment with cytochalasin D (1 µg/ml), cell surface
PIT-2V expression was stable over time in medium containing 1 mM
Na2HPO4.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 6.
Analysis of cell surface PIT-2V after exposure to
A-MLV. CHO-PIT-2V cells were incubated at the indicated
[Pi] for 2 h in the absence or in the presence of
cytochalasin D (CD) (1 µg/ml), detached, and exposed to medium
containing A-MLV particles (MOI, 3) and soluble envelopes at 4°C for
16 h, and then extensively washed. Cells were stained with
P5D4-Cy3 and analyzed by flow cytometry immediately, providing the
100% reference fluorescence level, or after incubation under defined
[Pi] and cytochalasin D conditions for the indicated
periods of time at 37°C (hours at 37°C). Data are from one
representative experiment of at least three.
|
|
We examined whether the disappearance of cell surface PIT-2V was
due to receptor internalization. CHO-PIT-2V cells incubated
with 0 or 40 mM Na
2HPO
4 were exposed to amphotropic
virus particles
for 2 h at 37°C, washed, and permeabilized
before PIT-2V staining
with P5D4 and immunofluorescence
microscopy. In cells exposed
to virus at 40 mM
Na
2HPO
4, PIT-2V staining was diffuse,
with a
slightly more intense signal at the cell margins. This aspect
was very similar to that observed for control cells not exposed
to
virus (Fig.
7C and D). In contrast, cell
surface staining disappeared
in cells exposed to
virus at 0 mM Na
2HPO
4; the
signal was concentrated
in perinuclear spots (Fig.
7A and B). This
aspect was highly suggestive
of the internalization of PIT-2V in
intracellular vesicles.

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 7.
Internalization of PIT-2 in response to A-MLV
exposure. CHO-PIT-2V cells were incubated at the indicated
[Pi] for 4 h at 37°C and not exposed (left panels)
or exposed (right panels) to medium containing A-MLV particles (MOI, 3)
and soluble envelopes for the last 2 h. When indicated, drugs were
added for 30 min prior to virus exposure. Cyt. D, cytochalasin D. After
fixation and permeabilization, cells were stained with P5D4-Cy3 and
analyzed by confocal fluorescence microscopy. Data are from one
representative experiment of three. Bar, 5 µm.
|
|
PIT-2V internalization in response to virus exposure was
investigated in the presence of drugs affecting phosphate transport
or
actin organization. Cells were incubated with 0 mM
Na
2HPO
4 for 1 h, with or without drugs
during the second 30 min, and then
exposed to virus particles in the
same medium for 2 h at 37°C
before fixation, permeabilization,
and staining of PIT-2V with
P5D4. Receptor internalization was
abolished in the presence of
the phosphate transport inhibitors PCMB
and PCMBS (100 µM) (Fig.
7E to H). This result suggested that drugs
affecting PIT-2V conformational
changes also affect receptor
internalization in response to virus
particle binding. Similar
observations were made for cells treated
with cytochalasin D (1 µg/ml) (Fig.
7I and J), indicating that
the integrity of the actin
network was required for receptor internalization
in response to virus
binding as well as for cell
infection.
 |
DISCUSSION |
We have obtained evidence for posttranslational regulation of the
activity of PIT-2, a type III NaPi cotransporter also
involved in the entry of amphotropic retroviruses into target cells.
Posttranslational modifications modulating the transmembrane transport
of Pi have been described previously for type II
NaPi cotransporters (14, 17, 21). Our
experiments were performed with a tagged version of human PIT-2
expressed in CHO cells. Both activities of PIT-2, namely, the
transmembrane transport of Pi and the entry of amphotropic retroviruses, were rapidly modulated following changes in
extracellular [Pi]. Modulation involved changes in
neither the total amounts of PIT-2 nor the number of cell surface
molecules, as shown by Western blotting with cell extracts and by flow
cytometry analysis of amphotropic envelope glycoprotein binding.
Therefore, we assumed that the modulation of PIT-2 activities
resulted from modifications of the conformation and/or the organization
of cell surface molecules. This hypothesis was supported by the
inhibition of both activities in the presence of drugs impairing
conformational changes of NaPi cotransporters and by the
observed modification of the cell surface distribution pattern of a
tagged version of PIT-2 in response to changes in extracellular
[Pi].
The redistribution of cell surface PIT-2 in response to
Pi deprivation was associated with a reorganization of the
actin network. In parental CHO cells as well as in CHO-PIT-2V and
TE671 cells, the abundance of actin stress fibers was inversely related
to extracellular [Pi]. A similar observation has been
reported previously (29). PIT-2V staining was precisely
localized with that of actin stress fibers, while coimmunoprecipitation
experiments demonstrated a physical association of PIT-2 with
actin. These results support the assumption that the cell surface
distribution of PIT-2 is determined to some extent by the
organization of the actin network. Consistently, the cell
surface distribution of PIT-2 was severely affected by the
actin-disorganizing drug cytochalasin D, while its association with
actin was maintained. Extracellular [Pi] not only
affected the organization of the actin network but also modulated
the proportion of PIT-2 molecules associated with actin microfilaments. Thus, in the presence of phosphate deprivation, PIT-2 molecules were more frequently associated with highly
polymerized actin microfilaments. Whether PIT-2 binds actin
directly or through connections established by actin binding proteins
is currently being investigated.
Indications that the cytoskeleton plays a role at early stages of the
viral life cycle have been previously obtained for other retroviruses,
including ecotropic MLV (9), lentiviruses (7), and spumaviruses (31). However, the mechanisms remain mostly undocumented. We showed that the receptor for A-MLV is physically associated with actin and that the entry of virus particles is more efficiently processed by PIT-2 when the actin network is highly polymerized. Cell infection was inhibited by high extracellular [Pi] and cytochalasin D, whereas it was stimulated by low
extracellular [Pi] and LPA. These effects were specific
for PIT-2, since infection efficiency was affected neither by the
extracellular concentration of other anions nor when virus entry was
mediated by another receptor. Alteration of cell infection was not the
consequence of altered binding of virus particles but rather was due to
the altered efficiency of the entry process. Impaired virus entry was
consistently associated with impaired internalization of PIT-2 in
response to virus particle binding, suggesting that these phenomena may
be related. However, the involvement of PIT-2 internalization in
virus entry raises questions. Indeed, in contrast to ecotropic or VSV-G
pseudotypes, amphotropic particles do not require internalization into
acidic vesicles for fusion, leading to the assumption that fusion takes place at the cell surface (19, 30). According to this view, receptor internalization should be secondary to fusion, playing roles in infection other than mediating virus entry, for example, activating signal transduction pathways or degrading receptor-bound virus particles in lysosomes. Alternatively, pH-independent fusion could take place in vesicles, where multiple envelope-receptor interactions may be facilitated by physical constraints. Receptor internalization would then directly participate in the entry process.
The analysis of cell surface PIT-2V by flow cytometry indicated
that raising extracellular [Pi] did not down-regulate the expression of the cotransporter, at least during the first 6 h. Although constant recycling cannot be ruled out, this result suggests that the rapid adaptive changes of the NaPi cotransport
activity of PIT-2 are achieved without modification of the number
of cell surface molecules. Therefore, PIT-2 molecules present at
the cell surface can be either activated or inactivated. Molecular
organizations which support the activated and inactivated states of
PIT-2 are unknown. However, treatment with PCMB or PCMBS, which
impairs the conformational changes of type II NaPi
cotransporters induced by Pi, inhibit Pi
transport and virus entry mediated by PIT-2. It is therefore likely
that conformational changes participate in activation. One plausible
hypothesis is that inactive molecules are monomers which may interact
with each other or with other partners to form active complexes, as was
previously proposed for type II NaPi cotransporters
(8, 34). PCMB and PCMBS could interfere with the formation
of such complexes. Interestingly, these drugs affected Pi
transport, receptor internalization in response to virus particle
binding, and virus entry, suggesting that similar molecular constraints
influence the occurrence of these various events. In contrast, virus
particle binding was not affected by PCMB and PCMBS, indicating that
binding and entry have different requirements. This result is
consistent with our previous observations showing a dissociation of the
binding and entry processes (1).
In conclusion, this study shows that the transmembrane transport of
Pi and the entry of amphotropic retroviruses mediated by
PIT-2 require the presence of active forms of the molecule at the
cell surface. Moreover, efficient processing of retrovirus entry
involves the association of the receptor with a highly polymerized actin network.
 |
ACKNOWLEDGMENTS |
We are grateful to E. Perec for assistance with confocal
microscopy, to J. V. Garcia for providing the rabbit
anti-PIT-2 serum, to D. Kabat for the gift of the CEAR 13 cell
line, and to O. Schwartz for critical reading of the manuscript.
This work was supported by grants from the Agence National de Recherche
contre le SIDA (ANRS) and Sidaction. P.R. is a fellow of
Fundação para a Ciência e Tecnologia (Portugal).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratoire
Rétrovirus et Transfert Génétique, Institut Pasteur,
28 Rue du Dr. Roux, 75724 Paris, France. Phone: 33 (0) 1 45 68 82 46. Fax: 33 (0) 1 45 68 89 40. E-mail: jmheard{at}pasteur.fr.
 |
REFERENCES |
| 1.
|
Battini, J. L.,
P. Rodrigues,
R. Müller,
O. Danos, and J. M. Heard.
1996.
Receptor-binding properties of a purified fragment of the 4070A amphotropic murine leukemia virus envelope glycoprotein.
J. Virol.
70:4387-4393[Abstract].
|
| 2.
|
Boyer, C. J. C.,
A. Baines,
E. Beaulieu, and R. Béliveau.
1998.
Immunodetection of a type III sodium-dependent phosphate cotransporter in tissues and OK cells.
Biochim. Biophys. Acta
1368:73-83[Medline].
|
| 3.
|
Chien, M. L.,
J. L. Foster,
J. L. Douglas, and J. V. Garcia.
1997.
The amphotropic murine leukemia virus receptor gene encodes a 71-kilodalton protein that is induced by phosphate depletion.
J. Virol.
71:4564-4570[Abstract].
|
| 4.
|
Chien, M. L.,
E. O'Neill, and J. V. Garcia.
1998.
Phosphate depletion enhances the stability of the amphotropic murine leukemia virus receptor mRNA.
Virology
240:109-117[Medline].
|
| 5.
|
Cosset, F. L.,
Y. Takeuchi,
J. L. Battini,
R. A. Weiss, and M. K. Collins.
1995.
High-titer packaging cells producing recombinant retroviruses resistant to human serum.
J. Virol.
69:7430-7436[Abstract].
|
| 6.
|
Evans, L. H.,
R. P. Morrison,
F. G. Malik,
J. Portis, and W. Britt.
1990.
A neutralizable epitope common to the envelope glycoproteins of ecotropic, polytropic, xenotropic, and amphotropic murine leukemia viruses.
J. Virol.
64:6176-6183[Abstract/Free Full Text].
|
| 7.
|
Iyengar, S.,
J. E. K. Hildreth, and D. Schwartz.
1998.
Actin-dependent receptor colocalization required for human immunodeficiency virus entry into host cells.
J. Virol.
72:5251-5255[Abstract/Free Full Text].
|
| 8.
|
Jette, M.,
V. Vachon,
M. Potier, and R. Béliveau.
1996.
The renal sodium/phosphate symporters: evidence for different functional oligomeric states.
Biochemistry
35:15209-15214[Medline].
|
| 9.
|
Kizhatil, K., and L. M. Albritton.
1997.
Requirements for different components of the host cell cytoskeleton distinguish ecotropic murine leukemia virus entry via endocytosis from entry via surface fusion.
J. Virol.
71:7145-7156[Abstract].
|
| 10.
|
Kozak, S. L.,
D. C. Siess,
P. Kavanaugh,
A. D. Miller, and D. Kabat.
1995.
The envelope glycoprotein of an amphotropic murine retrovirus binds specifically to the cellular receptor/phosphate transporter of susceptible species.
J. Virol.
69:3433-3440[Abstract].
|
| 11.
|
Kranenburg, O.,
M. Poland,
M. Gebbink,
L. Oomen, and W. H. Moolenaar.
1997.
Dissociation of LPA-induced cytoskeletal contraction from stress fiber formation by differential localization of RhoA.
J. Cell Sci.
110:2417-2427[Abstract].
|
| 12.
|
Kreis, T. E.
1986.
Microinjected antibodies against the cytoplasmic domain of vesicular stomatitis virus glycoprotein block its transport to the cell surface.
EMBO J.
5:931-941[Medline].
|
| 13.
|
Kreis, T. E., and H. F. Lodish.
1986.
Oligomerization is essential for transport of vesicular stomatitis virus glycoprotein to the cell surface.
Cell
46:1929-1937.
|
| 14.
|
Levi, M.,
M. Lotscher,
V. Sorribas,
M. Custer,
M. Arar,
B. Kaissling,
H. Murer, and J. Bider.
1994.
Cellular mechanisms of acute and chronic adaptation of rat renal Pi transporter to alterations in dietary Pi.
Am. J. Physiol.
267:900-908.
|
| 15.
|
Li, H., and Z. Xie.
1995.
Molecular cloning of two rat Na+/Pi cotransporters: evidence for differential tissue expression of transcripts.
Cell. Mol. Biol. Res.
41:451-460[Medline].
|
| 16.
|
Loghman-Adham, M.
1991.
Characterization of essential sulfhydryl groups of rat Na-Pi cotransporter.
Am. J. Physiol.
260:874-882.
|
| 17.
|
Loghman-Adham, M.,
G. T. Motock,
P. Wilson, and M. Levi.
1995.
Characterization of Na(+)-phosphate contransporters in renal cortical endosomes.
Am. J. Physiol.
269:93-102.
|
| 18.
|
Lotscher, M.,
B. Kaissling,
J. Bider,
H. Murer, and M. Levi.
1997.
Role of microtubules in the rapid regulation of renal phosphate transport in response to acute alterations in dietary phosphate content.
J. Clin. Investig.
99:1302-1312[Medline].
|
| 19.
|
McClure, M. A.,
M. S. Johnson,
D. F. Feng, and R. F. Doolittle.
1988.
Sequence comparisons of retroviral proteins: relative rate of change and general phylogeny.
Proc. Natl. Acad. Sci. USA
85:2469-2473[Abstract/Free Full Text].
|
| 20.
|
Miller, A. D.
1996.
Cell-surface receptors for retrovirus and implications for gene transfer.
Proc. Natl. Acad. Sci. USA
93:11407-11413[Abstract/Free Full Text].
|
| 21.
|
Murer, H., and J. Biber.
1996.
Molecular mechanisms of renal apical Na/phosphate cotransport.
Annu. Rev. Physiol.
58:607-618[Medline].
|
| 22.
|
Murer, H.,
I. Forster,
M. Pfister,
B. Kaissling,
M. Lotscher, and J. Biber.
1998.
Cellular/molecular control of renal Na/Pi-cotransport.
Kidney Int.
65:S2-S10.
|
| 23.
|
Palmer, G.,
J. P. Boujour, and J. Caverzasio.
1997.
Expression of a newly identified phosphate transport/retrovirus receptor in human SaOS-2 osteoblast-like cells and its regulation by insulin-like growth factor I.
Endocrinology
138:5202-5209[Abstract/Free Full Text].
|
| 24.
|
Peerce, B. E.
1995.
Effect of substrates and pH on the intestinal Na+/phosphate cotransporter: evidence for an intervesicular divalent phosphate allosteric regulatory site.
Biochim. Biophys. Acta
1239:1-10[Medline].
|
| 25.
|
Peerce, B. E.
1997.
Interaction of substrates with the intestinal brush border membrane Na/phosphate cotransporter.
Biochim. Biophys. Acta
1323:45-56[Medline].
|
| 26.
|
Peerce, B. E.,
M. Cedilote, and R. D. Clarke.
1995.
Examination of the molecular mechanism of SH reagent-induced inhibition of the intestinal brush-border membrane Na/phosphate cotransporter.
Biochim. Biophys. Acta
1239:11-21[Medline].
|
| 27.
|
Pfister, M. F.,
H. Hilfiker,
J. Forgo,
E. Lederer,
J. Biber, and H. Murer.
1998.
Cellular mechanisms involved in the acute adaptation of OK cell Na/Pi cotransport to high- or low-Pi medium.
Pfluegers Arch. Eur. J. Physiol.
435:713-719[Medline].
|
| 28.
|
Pfister, M. F.,
G. Stange,
U. Ziegler,
E. Lederer,
J. Biber, and H. Murer.
1998.
Parathyroid hormone leads to the lysosomal degradation of the renal type II Na/Pi cotransporter.
Proc. Natl. Acad. Sci. USA
95:1909-1914[Abstract/Free Full Text].
|
| 29.
|
Pollock, A. S., and H. L. Santiesteban.
1995.
Calbindin expression in renal tubular epithelial cells. Altered sodium phosphate co-transport in association with cytoskeletal rearrangement.
J. Biol. Chem.
270:16291-16301[Abstract/Free Full Text].
|
| 30.
|
Ragheb, J. A.,
H. Yu,
T. Hofmann, and W. F. Anderson.
1995.
The amphotropic and ecotropic murine leukemia virus envelope TM subunits are equivalent mediators of direct membrane fusion: implications for the role of the ecotropic envelope and receptor in syncytium formation and viral entry.
J. Virol.
69:7205-7215[Abstract].
|
| 31.
|
Saïb, A.,
F. Puvion-Dutilleul,
M. Schmid,
J. Périès, and H. de Thé.
1997.
Nuclear targeting of incoming human foamy virus Gag proteins involves a centriolar step.
J. Virol.
71:1155-1161[Abstract].
|
| 32.
|
Thomsen, S.,
B. Vogt,
D. von Laer,
C. Heberlein,
A. Rein,
W. Ostertag, and C. Stocking.
1998.
Lack of functional PiT-1 and PiT-2 expression on hematopoietic stem cell lines.
Acta Haematol.
99:148-155[Medline].
|
| 33.
|
Van Zeijl, M.,
S. V. Johann,
E. Closs,
J. Cunningham,
R. Eddy,
T. B. Shows, and B. O'Hara.
1994.
A human amphotropic retrovirus receptor is a second member of the gibbon ape leukemia virus receptor family.
Proc. Natl. Acad. Sci. USA
91:1168-1172[Abstract/Free Full Text].
|
| 34.
|
Xiao, Y.,
C. J. Boyer,
E. Vincent,
A. Dugre,
V. Vachon,
M. Potier, and R. Béliveau.
1997.
Involvement of disulphide bonds in the renal sodium/phosphate co-transporter NaPi-2.
Biochem. J.
323:401-408.
|
| 35.
|
Yee, J. K.,
A. Miyanohara,
P. LaPorte,
K. Bouic,
J. C. Burns, and T. Friedmann.
1994.
A general method for the generation of high-titer, pantropic retroviral vectors: highly efficient infection of primary hepatocytes.
Proc. Natl. Acad. Sci. USA
91:9564-9568[Abstract/Free Full Text].
|
Journal of Virology, May 1999, p. 3789-3799, Vol. 73, No. 5
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Verhoeyen, E., Cosset, F.-L.
(2009). Engineering the Surface Glycoproteins of Lentiviral Vectors for Targeted Gene Transfer. CSH Protocols
2009: pdb.top59-pdb.top59
[Abstract]
[Full Text]
-
Virkki, L. V., Biber, J., Murer, H., Forster, I. C.
(2007). Phosphate transporters: a tale of two solute carrier families. Am. J. Physiol. Renal Physiol.
293: F643-F654
[Abstract]
[Full Text]
-
Beer, C., Andersen, D. S., Rojek, A., Pedersen, L.
(2005). Caveola-Dependent Endocytic Entry of Amphotropic Murine Leukemia Virus. J. Virol.
79: 10776-10787
[Abstract]
[Full Text]
-
Wang, W., Jobbagy, Z., Bird, T. H., Eiden, M. V., Anderson, W. B.
(2005). Cell Signaling through the Protein Kinases cAMP-dependent Protein Kinase, Protein Kinase C{epsilon}, and RAF-1 Regulates Amphotropic Murine Leukemia Virus Envelope Protein-induced Syncytium Formation. J. Biol. Chem.
280: 16772-16783
[Abstract]
[Full Text]
-
Khadeer, M. A., Tang, Z., Tenenhouse, H. S., Eiden, M. V., Murer, H., Hernando, N., Weinman, E. J., Chellaiah, M. A., Gupta, A.
(2003). Na+-dependent phosphate transporters in the murine osteoclast: cellular distribution and protein interactions. Am. J. Physiol. Cell Physiol.
284: C1633-C1644
[Abstract]
[Full Text]
-
Bottger, P., Pedersen, L.
(2002). Two Highly Conserved Glutamate Residues Critical for Type III Sodium-dependent Phosphate Transport Revealed by Uncoupling Transport Function from Retroviral Receptor Function. J. Biol. Chem.
277: 42741-42747
[Abstract]
[Full Text]
-
Lauring, A. S., Cheng, H. H., Eiden, M. V., Overbaugh, J.
(2002). Genetic and Biochemical Analyses of Receptor and Cofactor Determinants for T-Cell-Tropic Feline Leukemia Virus Infection. J. Virol.
76: 8069-8078
[Abstract]
[Full Text]
-
Salaun, C., Gyan, E., Rodrigues, P., Heard, J. M.
(2002). Pit2 Assemblies at the Cell Surface Are Modulated by Extracellular Inorganic Phosphate Concentration. J. Virol.
76: 4304-4311
[Abstract]
[Full Text]
-
Salaün, C., Rodrigues, P., Heard, J. M.
(2001). Transmembrane Topology of PiT-2, a Phosphate Transporter-Retrovirus Receptor. J. Virol.
75: 5584-5592
[Abstract]
[Full Text]
-
Lavillette, D., Boson, B., Russell, S. J., Cosset, F.-L.
(2001). Activation of Membrane Fusion by Murine Leukemia Viruses Is Controlled in cis or in trans by Interactions between the Receptor-Binding Domain and a Conserved Disulfide Loop of the Carboxy Terminus of the Surface Glycoprotein. J. Virol.
75: 3685-3695
[Abstract]
[Full Text]
-
Jobbagy, Z., Garfield, S., Baptiste, L., Eiden, M. V., Anderson, W. B.
(2000). Subcellular Redistribution of Pit-2 Pi Transporter/Amphotropic Leukemia Virus (A-MuLV) Receptor in A-MuLV-Infected NIH 3T3 Fibroblasts: Involvement in Superinfection Interference. J. Virol.
74: 2847-2854
[Abstract]
[Full Text]
-
Tailor, C. S., Nouri, A., Kabat, D.
(2000). A Comprehensive Approach to Mapping the Interacting Surfaces of Murine Amphotropic and Feline Subgroup B Leukemia Viruses with Their Cell Surface Receptors. J. Virol.
74: 237-244
[Abstract]
[Full Text]
-
Lavillette, D., Ruggieri, A., Russell, S. J., Cosset, F.-L.
(2000). Activation of a Cell Entry Pathway Common to Type C Mammalian Retroviruses by Soluble Envelope Fragments. J. Virol.
74: 295-304
[Abstract]
[Full Text]