Previous Article | Next Article 
Journal of Virology, May 1999, p. 3582-3586, Vol. 73, No. 5
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Identification of a Novel GC-Rich 113-Nucleotide
Region To Complete the Circular, Single-Stranded DNA Genome of TT
Virus, the First Human Circovirus
Hironori
Miyata,1
Hiroaki
Tsunoda,1
Aslamuzzaman
Kazi,1
Akio
Yamada,1
Mohammed Ali
Khan,1
Jun
Murakami,2
Toshio
Kamahora,1
Kazuo
Shiraki,2 and
Shigeo
Hino1,*
Departments of
Virology1 and
Pediatrics,2 Faculty of Medicine,
Tottori University, Yonago 683-8503, Japan
Received 26 October 1998/Accepted 21 January 1999
 |
ABSTRACT |
The sequence data (H. Okamoto et al., Hepatol. Res. 10:1-16, 1998)
of a newly discovered single-stranded DNA virus, TT virus (TTV), showed
that it did not have the terminal structure typical of a parvovirus.
Elucidation of the complete genome structure was necessary to
understand the nature of TTV. We obtained a 1.0-kb amplified product
from serum samples of four TTV carriers by an inverted, nested long PCR
targeted for nucleotides (nt) 3025 to 3739 and 1 to 216 of TTV. The
sequence of a clone obtained from serum sample TA278 was compared with
those registered in GenBank. The complete circular TTV genome contained
a novel sequence of 113 nt (nt 3740 to 3852 [=0]) in between the
known 3'- and 5'-end arms, forming a 117-nt GC-rich stretch (GC
content, 90.6% at nt 3736 to 3852). We found a 36-nt stretch (nt 3816 to 3851) with an 80.6% similarity to chicken anemia virus (CAV) (nt
2237 to 2272 of M55918), a vertebrate circovirus. A putative SP-1 site was located at nt 3834 to 3839, followed by a TATA box at nt 85 to 90, the first initiation codon of a putative VP2 at nt 107 to 109, the
termination codon of a putative VP1 at nt 2899 to 2901, and a poly(A)
signal at nt 3073 to 3078. The arrangement was similar to that of CAV.
Furthermore, several AP-2 and ATF/CREB binding sites and an NF-
B
site were arranged around the GC-rich region in both TTV and CAV. The
data suggested that TTV is circular and similar to CAV in its genomic
organization, implying that TTV is the first human circovirus.
 |
INTRODUCTION |
Recently, the isolation of DNA
clones of a new human virus, TT virus (TTV), from a Japanese patient
with posttransfusion hepatitis has been reported (11, 13).
Epidemiological studies by seminested PCRs showed that TTV is globally
widespread among the general population (2, 10, 13, 14).
However, the pathogenic nature of this virus is still unclear, even
though it seems to be more prevalent in posttransfusion hepatitis
patients (2, 5, 13). Okamoto et al. reported that TTV is
nonenveloped and has a linear single-stranded DNA (ssDNA) genome
(13). They presented a sequence of 3,739 nucleotides (nt)
and suggested that TTV may belong to the parvovirus group. Parvovirus
has a linear ssDNA genome with a palindromic structure on both ends
(1). However, the sequence presented by Okamoto et al.
(13) did not contain the palindrome. Here we clarify the
full genome structure of TTV.
 |
MATERIALS AND METHODS |
Sera.
The serum sample TA278, a key serum for the discovery
of TTV, was supplied by M. Mayumi of Jichi Medical School, Tochigi, Japan. We screened the sera of pediatric non-A-G hepatitis patients by
a seminested PCR (13). The sera used here included three positive ones (TP88, TP97, and TP110) and a negative one (TP100). These
sera were obtained from patients at the Department of Pediatrics, Faculty of Medicine, Tottori University, under informed consent.
DNA extraction.
Each serum sample of 100 µl was treated
with 0.5% sodium dodecyl sulfate and 0.12 mg of proteinase K per ml at
37°C for 16 h. The DNA was extracted by phenol,
phenol-chloroform-isoamyl alcohol (25:24:1), and chloroform-isoamyl
alcohol. The DNA was ethanol precipitated with 20 µg of glycogen
(Boehringer, Mannheim, Germany) as a carrier. The DNA was dissolved in
40 µl of 10 mM Tris-HCl (pH 8.3)-0.1 mM EDTA, and it was stored at
20°C until use.
Primers for PCR.
The primers for the seminested short PCR
(13) were supplied by M. Mayumi. For the inverted long PCR,
we designed nested pairs of inverted primers: TTV2915
(C2915CCCAAACCTTACAACCCTTCC2936) and TTV324
(T347TAGTAGTTTGCAACGTTCTTTG324) for the outer
primer pair and TTV3025
(CGCGGATCCG3025GGCCCCCAAGGAAAACCAGTA3046)
and TTV195
(AAGGAAAAAAGCGGCCGCA216TTGCCCCTTGACTTCGGTGTG195)
for the inner primer pair. For the inner primers, NotI and
BamHI tags (indicated in italics) were added for cloning purposes.
PCR.
For TTV genome screening, we utilized the seminested
PCR targeted for nt 1915 to 2185 (GenBank no. AB008394). The
sensitivity of the PCR was three copies per reaction as determined by a
cloned DNA containing nt 946 to 2226 of TTV. To guarantee the
sensitivity of each PCR, we added a pair of tubes, each containing six
copies of the cloned DNA, as positive controls in the routine screening (7).
For the inverted, nested PCR, we applied a hot-start and long PCR
method with minor modifications (7). The first and second PCRs were performed for 35 cycles (each cycle was 94°C for 1 min, 59°C for 1 min, and 72°C for 3 min) with a programmable incubator (API 300; ASTEC, Fukuoka, Japan). The extracted DNA, 10 µl, was used
in the first PCR, and a 5-µl aliquot of the first PCR product was
used in the second PCR. A reaction cocktail, 50 µl, consisted of 10 mM Tris-HCl (pH 9.0), 50 mM KCl, 1.5 mM MgCl2, a 0.25 mM concentration of each deoxynucleoside triphosphate, a 0.5 µM
concentration of each primer, 1.25 U of Taq DNA polymerase
(Pharmacia Biotech, Uppsala, Sweden), 0.005 U of Deep Vent DNA
polymerase (New England Biolabs, Beverly, Mass.), 5% dimethyl
sulfoxide, and 2% glycerol. The PCR product was electrophoresed on a
1% agarose S (Nippon Gene, Toyama, Japan) gel, and the gel was stained
with ethidium bromide.
Cloning and DNA sequencing.
The 1.0-kb product amplified by
the inverted, nested long PCR of DNA derived from TA278 was digested
with BamHI and NotI and cloned into a vector,
pBluescript SK(
). The BamHI/SacI fragment from
one of these clones was recloned into pTZ19U (pTZ27852). From each end
of the insert, series of deletion mutants were generated with a
Kilo-Sequence Deletion kit (Takara Biomedicals, Kyoto, Japan)
(6). In brief, to make a series of deletion mutants from the
5' end of the insert, pTZ27852 was restricted with
BamHI/Sse8387I at the 5' end of the insert
(series BS). Following serial digestions with exonuclease III for up to
10 min, the single-stranded region was digested out with mung bean
nuclease. After both ends were repaired by Klenow fragment, the product
was self-ligated. Constructs with serial deletions from the 3' end of
the insert were generated similarly with
NotI/SacI restriction of pTZ27852 (series NS). At
least three of these mutants overlapping in each area were selected for
sequencing based on the method of Sanger et al. (15). We
used a Thermo Sequenase fluorescent labeled primer cycle sequencing kit
with 7-deaza-dGTP (Amersham Pharmacia Biotech, Little Chalfont, United
Kingdom) in an ALFred DNA sequencer (Pharmacia LKB, Uppsala, Sweden).
Since the novel GC-rich region was refractory to the Sanger method, we
obtained shorter subclones, such as pBS317pma (nt 3706 to 3852 and 1 to
22), from one of the deletion plasmids, pBS317 (nt 3706 to 3852 and 1 to 216). These served in chemical sequencing after the method of Maxam
and Gilbert (8) by using [
-32P]ATP.
Southern blotting.
To confirm the specificity of the newly
identified GC-rich region for TTV, PCR products of the inverted PCR
were probed by a EcoRI/HindIII insert
fragment of pBS317pma; 5' ends on both of the strands were radiolabeled
with [
-32P]ATP by polynucleotide kinase (Takara
Biomedicals). The DNA electrophoresed in a 1% agarose gel was blotted
onto a nylon membrane (Hybond N plus; Amersham Pharmacia Biotech) by an
alkaline transfer method. Following prehybridization at 65°C for
2 h, the DNA was hybridized with the 32P-probe under a
highly stringent condition at 65°C for 16 h. After being washed
three times with 40 mM phosphate buffer containing 0.1% sodium dodecyl
sulfate (Church's buffer [3]) at 68°C for 5 min,
the membrane was dried and autoradiographed.
Computer work.
Database searches and sequence analyses were
performed by FASTA in the DNA Data Bank of Japan (DDBJ) and by Genetyx
(version 9.0). For alignment of the DNA, we used Sequencher (version
3.0).
Nucleotide sequence accession number.
The nucleotide
sequence data reported in this paper will appear in the
DDBJ/EMBL/GenBank nucleotide sequence database with the accession no.
AB017911.
 |
RESULTS |
PCR.
In the seminested short PCR (Fig.
1A), the serum samples TA278, TP88, TP97,
and TP110 gave a positive signal with an expected size of 286 nt after
the first PCR (Fig. 1B). All of them gave a strong signal with a size
of 271 nt after the second PCR. The same set of samples was used in the
inverted, nested long PCR (Fig. 1A). Two high-virus-load samples, TP88
and TP110, gave a positive signal at 1.2 kb in the first PCR, and all
positive samples gave a strong signal at 1.0 kb after the second PCR
(Fig. 1C). The negative control sample, TP100, was consistently
negative. The results suggested that this novel sequence is a part of
the TTV genome and that its structure is circular instead of linear. Since our inverted, nested PCR was expected to read 931 nt on the
reported sequence (nt 3025 to 3739 and 1 to 216), the estimated length
of the novel sequence was ~100 nt.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 1.
Seminested short PCR and inverted, nested long PCR for
TTV. (A) Schematic diagram of the TTV genome and target regions for the
seminested and inverted, nested long PCRs. The dotted region in the
genome indicates the region identified in this study. Arrows indicate
locations and directions of primers. (B) Seminested short PCR. The
products were electrophoresed in a 3% agarose gel and stained with
ethidium bromide. The expected sizes of the products of the first and
second PCRs were 286 and 271 nt, respectively. (C) Inverted, nested
long PCR. The products were electrophoresed in a 1% agarose gel and
stained with ethidium bromide. The product sizes of the first and
second PCRs were 1.2 and 1.0 kb, respectively. (D) Southern blotting of
the gel in panel C probed by the insert of pBS317pma (nt 3706 to 3852 and 1 to 22). Note that the autoradiogram for the first PCR is
overexposed. Lanes: M, X174 HaeIII digest for panel B and
phage HindIII digest for panel C; 1 and 7, template-free control; 2 and 8, TP100 negative serum; 3 to 6 and 9 to
12, TA278, TP88, TP97, and TP110 sera, respectively; 13 and 14, a
cloned TTV DNA at six copies per reaction.
|
|
To confirm that this novel sequence is a part of the TTV genome, the
electrophoresed gel (Fig.
1C) was probed in a Southern
blot by the
pBS317pma insert encompassing the novel region (nt
3706 to 3852 and 1 to 22). The probe hybridized with the PCR product
bands of all positive
samples (Fig.
1D, lanes 3 to 6 and 9 to
12) but not with that of TP100
(lanes 2 and 8). This suggested
that the novel region is common to all
TTV-positive
samples.
DNA sequencing.
To determine the nucleotide sequence of the
novel region, the series of deletion mutants obtained from pTZ27852
from both directions was sequenced (Fig.
2). The enzymatic and chemical sequencing
revealed that the 1.0-kb product of the inverted PCR had a total length
of 1,000 nt between the inner primers (nt 3047 to 3852 and 1 to 194)
(Fig. 3). The similarity of the sequence to that of AB008394 was 98.6% for the 3'-terminal 693 nt (nt 3047 to
3739) and 100% for the 5'-terminal 194 nt (nt 1 to 194). No deletion
or addition of nucleotides was found in these two regions. Within the
former, 5 of 10 nucleotide changes were located in nt 3577 to 3604. We
found a novel region consisting of ~100 nt between nt 3739 and 1, which was resistant to the Sanger method. By the chemical sequencing,
the region was found to be 113 nt long and next to the last
C3736GGC3739 of AB008394 and to form a
117-nt-long stretch (nt 3736 to 3852 [=0]) with a GC content of
106/117 (90.6%).

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 2.
Sequence strategy. The insert of pTZ27852, 1.0 kb in
size, was sequenced from both directions with two series of deletion
mutants: the BS series with 5'-end deletions and the NS series with
3'-end deletions. Shown are the area sequenced (not the size of insert)
and the sequence direction of representative clones. Open box on the
scale, the novel GC-rich region.
|
|

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 3.
Nucleotide sequences of the pTZ27852 insert. The 1,000 nt between the inner primer pairs were compared with those of the
previously reported TTV, both from sample TA278 (GenBank no. AB008394).
A portion of the CAV genome (M55918) which had an 80.6% similarity to
the TTV genome is also included. Dashes, nucleotide matches with
AB008394; asterisks, nucleotide matches with M55918; underline,
ATF/CREB site; thick underline, AP-2 site; solid box, SP-1 site; dashed
box, NF- B site.
|
|
ORF analysis.
Open reading frame (ORF) analysis revealed three
putative ORFs (>100 nt) extending into the novel region. One with 141 nt (nt 3803 to 3852 and 1 to 91) was on the plus strand, capable of
coding for 47 amino acids (aa). The other two were on the minus strand
with 141 nt (nt 2 to 1 and 3852 to 3714) and 264 nt (nt 3804 to 3541),
capable of coding for 47 and 88 aa, respectively (Fig.
4). None of these ORFs were associated
with TATA box or poly(A) sites in close proximity.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 4.
ORF analysis of pTZ27852. The upper panel is for the
positive strand, and the lower panel is for the negative strand. The
arrows indicate the ORFs found (>100 nt) and their directions. Short
separator, initiation codon; long separator, termination codon; box in
the scale, the novel GC-rich region.
|
|
Computer work.
We searched for some similarities between the
sequence of the novel region of the TTV genome (nt 3740 to 3852) and
those of the viral genomes registered in GenBank. The 36-nt stretch (nt 3816 to 3851) within the novel region had an 80.6% similarity with a
part of the GC-rich region (nt 2237 to 2272) of the chicken anemia
virus (CAV) (M55918; 2,319 nt in total) (Fig. 3). We compared the whole
genome of TTV with that of CAV (M55918), using the TTV sequence
(AB008394; nt 1 to 3739) connected with the novel region of pTZ27852
(nt 3740 to 3852).
The nucleotide sequence similarities in other regions were
insignificant. However, the genomic constructions of these viruses
were
similar in spite of the differences in their genomic sizes
(Fig.
5). CAV has an ORF in each of the three
different frames
(
4,
12). TTV also had a putative ORF in
each frame, and the
frames' relative sizes and locations also
resembled each other.
Following the GC-rich sequence of CAV, there were
a SP-1 site,
a TATA box, and the first initiation codon of the VP2 ORF
(Table
1). TTV had a putative SP-1 site
at nt 3834 to 3839, near the
end of the GC-rich region, which was
followed by a TATA box at
nt 85 to 90 and then by the first initiation
codon of the putative
VP2 ORF at nt 107 to 109. CAV has a poly(A) site
after the VP1
ORF. Similarly, the poly(A) site at nt 3073 to 3078 of
TTV was
located approximately 100 nt downstream from the termination
codon
of the putative VP1.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 5.
Comparative scheme of three major ORFs of TTV and CAV.
The ORFs of the TTV genome, VP1* through VP3*, are putative. Closed
box, the novel GC-rich region; arrow, SP-1 site; open triangle, poly(A)
site; closed triangle, TATA box.
|
|
As for the arrangement of putative regulatory sequences around the
GC-rich region, the 36-nt stretch of both CAV and TTV contained
two
areas of putative AP-2 binding sites. In addition, two areas
for
putative AP-2 sites were found within 100 nt upstream of the
36-nt
stretch in both viral genomes. While CAV has five putative
ATF/CREB
binding sites within 340 nt downstream of the GC-rich
region, TTV had
five putative ATF/CREB binding sites in the region
of nt 3465 to 3852 and 1 to 14. CAV has a putative NF-

B binding
site within its 36-nt
stretch, which was missing in the 36-nt
stretch of TTV. However, we did
find one at nt 3089 to
3097.
 |
DISCUSSION |
The genomic sequence reported by Okamoto et al. (13)
did not conform to a full viral genome of a parvovirus as they
suggested, because it lacked terminal repeats. They reported that using
an inverted PCR to reveal a circular structure was unsuccessful. We
first used a commercial long-PCR kit, which failed. However, by using
our nested long-PCR system as reported previously (7), we
successfully amplified the novel region by an inverted PCR. The 1.0-kb
amplified product contained 693 nt with a 98.6% similarity to the
3'-end region of TTV (AB008394; nt 3047 to 3739) and 194 nt with a
100% similarity to the 5'-end region of TTV (nt 1 to 194). In between,
there was a 113-nt GC-rich region (nt 3740 to 3852) following
C3736GGC3739, making a 117-nt GC-rich stretch.
The results indicated that TTV has a circular genome with 3,852 nt.
Taxonomically, no human virus has been categorized as a circular ssDNA
virus. Geminivirus is a plant virus that has one to two
circular DNAs as a genome, and Inoviridae and
Microviridae are bacterial viruses with a circular genome.
Among vertebrate viruses, Circoviridae are known to have a
circular ssDNA genome; CAV (4, 12) and the porcine
circovirus (9) have been studied most extensively. The
former has a 2.3-kb circular ssDNA genome, and the latter has a 1.8-kb
one. However, no significant similarity in nucleotide sequences between
these two viruses is known. The latter is reported to be more similar
to plant circoviruses (9).
The novel region of TTV included a 36-nt stretch (nt 3816 to 3851)
which had a 80.6% similarity with one region (nt 2237 to 2270 of
M55918) of CAV. However, we could not find any significant nucleotide
or amino acid sequence similarity between these two viruses in other
regions. Although the TTV genome is ca. 1.5 times larger than that of
CAV, both viruses had three major ORFs, one each in three frames. The
relative lengths and locations and also the frame usage of the three
major ORFs were quite similar (Fig. 5). Furthermore, the relative
locations of the GC-rich region, SP-1 site, TATA box, the first
initiation codon for VP2, and poly(A) signal following the termination
codon of VP1 were also quite similar to each other. The TTV genome
(AB008394) also had a second poly(A) signal, at nt 1722 to 1727 in the
middle of the putative VP1 ORF. This one may not be significant, since
it was not found in a clone we obtained from the same patient (data not shown).
Although there were three putative ORFs extending into the novel region
in TTV, we could not find corresponding ORFs in the vicinity of the
GC-rich sequence of CAV. These putative ORFs were not associated with
nearby TATA box or poly(A) binding sites. These data may suggest that
these three ORFs are nonfunctional.
In terms of regulatory sequences for gene expression, CAV has four
(D10068) or five (M55918) direct repeats approximately 200 nt
downstream from the 36-nt stretch (4, 12). The units are 19 and 21 nt long, respectively, and each contains a region capable of
binding ATF/CREB. TTV did not have such long repeats, but it had five
putative ATF/CREB binding sites starting from ca. 350 nt upstream to
the 36-nt stretch. CAV had two putative AP-2 binding sites within the
36-nt stretch and two additional sites within an area 100 nt upstream.
In contrast, TTV had several sites within the 36-nt stretch and two
additional sites within an area 100 nt upstream. The CAV 36-nt stretch
contained a putative NF-
B binding site, which was not maintained in
the TTV 36-nt stretch. However, a putative NF-
B binding site was
found at nt 3089 to 3097 of TTV. The putative regulatory element
profile provided more evidence that TTV and CAV are related to each
other. The results suggested that TTV is the first human virus that
belongs to Circoviridae instead of Parvoviridae
as previously suggested (13). The exploration of the complete TTV
genome will facilitate a better understanding of this virus and its replication.
 |
ACKNOWLEDGMENT |
We thank Kenzo Sato for technical advice on chemical sequencing.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Tottori
University Faculty of Medicine, Department of Virology, 86 Nishi,
Yonago 683-8503, Japan. Phone: 81-859-34-8021. Fax: 81-859-34-8133. E-mail: hino{at}grape.med.tottori-u.ac.jp.
 |
REFERENCES |
| 1.
|
Berns, K. I.
1996.
Parvoviridae: the viruses and their replication, p. 2173-2197.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed., vol. 2. Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 2.
|
Charlton, M.,
P. Adjei,
J. Poterucha,
N. Zein,
B. Moore,
T. Therneau,
R. Krom, and R. Wiesner.
1998.
TT-virus infection in North American blood donors, patients with fulminant hepatic failure, and cryptogenic cirrhosis.
Hepatology
28:839-842[Medline].
|
| 3.
|
Church, G. M., and W. Gilbert.
1984.
Genomic sequencing.
Proc. Natl. Acad. Sci. USA
81:1991-1995[Abstract/Free Full Text].
|
| 4.
|
Claessens, J. A.,
C. C. Schrier,
A. P. Mockett,
E. H. Jagt, and P. J. Sondermeijer.
1991.
Molecular cloning and sequence analysis of the genome of chicken anaemia agent.
J. Gen. Virol.
72:2003-2006[Abstract/Free Full Text].
|
| 5.
|
Cossart, Y.
1998.
TTV a common virus, but pathogenic?
Lancet
352:164.
|
| 6.
|
Henikoff, S.
1984.
Unidirectional digestion with exonuclease III creates targeted breakpoints for DNA sequencing.
Gene
28:351-359[Medline].
|
| 7.
|
Kazi, A.,
H. Miyata,
T. Kamahora,
K. Kurokawa,
S. Katamine, and S. Hino.
1998.
Deleted HTLV-1 provirus in cord-blood samples of babies born to HTLV-1-carrier mothers.
Int. J. Cancer
77:701-704[Medline].
|
| 8.
|
Maxam, A. M., and W. Gilbert.
1977.
A new method for sequencing DNA.
Proc. Natl. Acad. Sci. USA
74:560-564[Abstract/Free Full Text].
|
| 9.
|
Meehan, B. M.,
J. L. Creelan,
M. S. McNulty, and D. Todd.
1997.
Sequence of porcine circovirus DNA: affinities with plant circoviruses.
J. Gen. Virol.
78:221-227[Abstract].
|
| 10.
|
Naoumov, N. V.,
E. P. Petrova,
M. G. Thomas, and R. Williams.
1998.
Presence of a newly described human DNA virus (TTV) in patients with liver disease.
Lancet
352:195-197[Medline].
|
| 11.
|
Nishizawa, T.,
H. Okamoto,
K. Konishi,
H. Yoshizawa,
Y. Miyakawa, and M. Mayumi.
1997.
A novel DNA virus (TTV) associated with elevated transaminase levels in posttransfusion hepatitis of unknown etiology.
Biochem. Biophys. Res. Commun.
241:92-97[Medline].
|
| 12.
|
Noteborn, M. H. M.,
G. F. de Boer,
D. J. van Roozelaar,
C. Karreman,
O. Kranenburg,
J. G. Vos,
S. H. M. Jeurissen,
R. C. Hoeben,
A. Zantema,
G. Koch,
H. van Ormondt, and A. J. van der Eb.
1991.
Characterization of cloned chicken anemia virus DNA that contains all elements for the infectious replication cycle.
J. Virol.
65:3131-3139[Abstract/Free Full Text].
|
| 13.
|
Okamoto, H.,
T. Nishizawa,
N. Kato,
M. Ukita,
H. Ikeda,
H. Iizuka,
Y. Miyakawa, and M. Mayumi.
1998.
Molecular cloning and characterization of a novel DNA virus (TTV) associated with posttransfusion hepatitis of unknown etiology.
Hepatol. Res.
10:1-16.
|
| 14.
|
Prescott, L. E., and P. Simmonds.
1998.
Global distribution of transfusion-transmitted virus.
N. Engl. J. Med.
339:776-777[Free Full Text].
|
| 15.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 16.
|
Simmonds, P.,
F. Davidson,
C. Lycett,
L. Prescott,
D. MacDonald,
J. Ellender,
P. Yap,
C. Ludlam,
G. Haydon,
J. Gillon, and L. Jarvis.
1998.
Detection of a novel DNA virus (TTV) in blood donors and blood products.
Lancet
352:191-195[Medline].
|
Journal of Virology, May 1999, p. 3582-3586, Vol. 73, No. 5
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ninomiya, M., Takahashi, M., Hoshino, Y., Ichiyama, K., Simmonds, P., Okamoto, H.
(2009). Analysis of the entire genomes of torque teno midi virus variants in chimpanzees: infrequent cross-species infection between humans and chimpanzees. J. Gen. Virol.
90: 347-358
[Abstract]
[Full Text]
-
Ninomiya, M., Takahashi, M., Nishizawa, T., Shimosegawa, T., Okamoto, H.
(2008). Development of PCR Assays with Nested Primers Specific for Differential Detection of Three Human Anelloviruses and Early Acquisition of Dual or Triple Infection during Infancy. J. Clin. Microbiol.
46: 507-514
[Abstract]
[Full Text]
-
Zheng, H., Ye, L., Fang, X., Li, B., Wang, Y., Xiang, X., Kong, L., Wang, W., Zeng, Y., Ye, L., Wu, Z., She, Y., Zhou, X.
(2007). Torque Teno Virus (SANBAN Isolate) ORF2 Protein Suppresses NF-{kappa}B Pathways via Interaction with I{kappa}B Kinases. J. Virol.
81: 11917-11924
[Abstract]
[Full Text]
-
Biagini, P., Uch, R., Belhouchet, M., Attoui, H., Cantaloube, J.-F., Brisbarre, N., de Micco, P.
(2007). Circular genomes related to anelloviruses identified in human and animal samples by using a combined rolling-circle amplification/sequence-independent single primer amplification approach. J. Gen. Virol.
88: 2696-2701
[Abstract]
[Full Text]
-
Leppik, L., Gunst, K., Lehtinen, M., Dillner, J., Streker, K., de Villiers, E.-M.
(2007). In Vivo and In Vitro Intragenomic Rearrangement of TT Viruses. J. Virol.
81: 9346-9356
[Abstract]
[Full Text]
-
Ninomiya, M., Nishizawa, T., Takahashi, M., Lorenzo, F. R., Shimosegawa, T., Okamoto, H.
(2007). Identification and genomic characterization of a novel human torque teno virus of 3.2 kb. J. Gen. Virol.
88: 1939-1944
[Abstract]
[Full Text]
-
Kamada, K., Kuroishi, A., Kamahora, T., Kabat, P., Yamaguchi, S., Hino, S.
(2006). Spliced mRNAs detected during the life cycle of Chicken anemia virus.. J. Gen. Virol.
87: 2227-2233
[Abstract]
[Full Text]
-
Liu, J., Chen, I., Kwang, J.
(2005). Characterization of a Previously Unidentified Viral Protein in Porcine Circovirus Type 2-Infected Cells and Its Role in Virus-Induced Apoptosis. J. Virol.
79: 8262-8274
[Abstract]
[Full Text]
-
Qiu, J., Kakkola, L., Cheng, F., Ye, C., Soderlund-Venermo, M., Hedman, K., Pintel, D. J.
(2005). Human Circovirus TT Virus Genotype 6 Expresses Six Proteins following Transfection of a Full-Length Clone. J. Virol.
79: 6505-6510
[Abstract]
[Full Text]
-
Niel, C., Diniz-Mendes, L., Devalle, S.
(2005). Rolling-circle amplification of Torque teno virus (TTV) complete genomes from human and swine sera and identification of a novel swine TTV genogroup. J. Gen. Virol.
86: 1343-1347
[Abstract]
[Full Text]
-
Suzuki, T., Suzuki, R., Li, J., Hijikata, M., Matsuda, M., Li, T.-C., Matsuura, Y., Mishiro, S., Miyamura, T.
(2004). Identification of Basal Promoter and Enhancer Elements in an Untranslated Region of the TT Virus Genome. J. Virol.
78: 10820-10824
[Abstract]
[Full Text]
-
Kooistra, K., Zhang, Y.-H., Henriquez, N. V., Weiss, B., Mumberg, D., Noteborn, M. H. M.
(2004). TT virus-derived apoptosis-inducing protein induces apoptosis preferentially in hepatocellular carcinoma-derived cells. J. Gen. Virol.
85: 1445-1450
[Abstract]
[Full Text]
-
Crowther, R. A., Berriman, J. A., Curran, W. L., Allan, G. M., Todd, D.
(2003). Comparison of the Structures of Three Circoviruses: Chicken Anemia Virus, Porcine Circovirus Type 2, and Beak and Feather Disease Virus. J. Virol.
77: 13036-13041
[Abstract]
[Full Text]
-
Fenaux, M., Opriessnig, T., Halbur, P. G., Meng, X. J.
(2003). Immunogenicity and Pathogenicity of Chimeric Infectious DNA Clones of Pathogenic Porcine Circovirus Type 2 (PCV2) and Nonpathogenic PCV1 in Weanling Pigs. J. Virol.
77: 11232-11243
[Abstract]
[Full Text]
-
Okamoto, H., Takahashi, M., Nishizawa, T., Tawara, A., Fukai, K., Muramatsu, U., Naito, Y., Yoshikawa, A.
(2002). Genomic characterization of TT viruses (TTVs) in pigs, cats and dogs and their relatedness with species-specific TTVs in primates and tupaias. J. Gen. Virol.
83: 1291-1297
[Abstract]
[Full Text]
-
Kakkola, L., Hedman, K., Vanrobaeys, H., Hedman, L., Soderlund-Venermo, M.
(2002). Cloning and sequencing of TT virus genotype 6 and expression of antigenic open reading frame 2 proteins. J. Gen. Virol.
83: 979-990
[Abstract]
[Full Text]
-
Fenaux, M., Halbur, P. G., Haqshenas, G., Royer, R., Thomas, P., Nawagitgul, P., Gill, M., Toth, T. E., Meng, X. J.
(2002). Cloned Genomic DNA of Type 2 Porcine Circovirus Is Infectious When Injected Directly into the Liver and Lymph Nodes of Pigs: Characterization of Clinical Disease, Virus Distribution, and Pathologic Lesions. J. Virol.
76: 541-551
[Abstract]
[Full Text]
-
Yokoyama, H., Yasuda, J., Okamoto, H., Iwakura, Y.
(2002). Pathological changes of renal epithelial cells in mice transgenic for the TT virus ORF1 gene. J. Gen. Virol.
83: 141-150
[Abstract]
[Full Text]
-
Okamoto, H., Nishizawa, T., Takahashi, M., Tawara, A., Peng, Y., Kishimoto, J., Wang, Y.
(2001). Genomic and evolutionary characterization of TT virus (TTV) in tupaias and comparison with species-specific TTVs in humans and non-human primates. J. Gen. Virol.
82: 2041-2050
[Abstract]
[Full Text]
-
Biagini, P., Gallian, P., Attoui, H., Touinssi, M., Cantaloube, J.-F., de Micco, P., de Lamballerie, X.
(2001). Genetic analysis of full-length genomes and subgenomic sequences of TT virus-like mini virus human isolates. J. Gen. Virol.
82: 379-383
[Abstract]
[Full Text]
-
Bendinelli, M., Pistello, M., Maggi, F., Fornai, C., Freer, G., Vatteroni, M. L.
(2001). Molecular Properties, Biology, and Clinical Implications of TT Virus, a Recently Identified Widespread Infectious Agent of Humans. Clin. Microbiol. Rev.
14: 98-113
[Abstract]
[Full Text]
-
Ott, C., Duret, L., Chemin, I., Trépo, C., Mandrand, B., Komurian-Pradel, F.
(2000). Use of a TT virus ORF1 recombinant protein to detect anti-TT virus antibodies in human sera. J. Gen. Virol.
81: 2949-2958
[Abstract]
[Full Text]
-
Lin, C.-L., Kyono, W., Tongson, J., Chua, P. K., Easa, D., Yanagihara, R., Nerurkar, V. R.
(2000). Fecal Excretion of a Novel Human Circovirus, TT Virus, in Healthy Children. CVI
7: 960-963
[Abstract]
[Full Text]
-
Kamahora, T., Hino, S., Miyata, H.
(2000). Three Spliced mRNAs of TT Virus Transcribed from a Plasmid Containing the Entire Genome in COS1 Cells. J. Virol.
74: 9980-9986
[Abstract]
[Full Text]
-
Okamoto, H., Takahashi, M., Kato, N., Fukuda, M., Tawara, A., Fukuda, S., Tanaka, T., Miyakawa, Y., Mayumi, M.
(2000). Sequestration of TT Virus of Restricted Genotypes in Peripheral Blood Mononuclear Cells. J. Virol.
74: 10236-10239
[Abstract]
[Full Text]
-
Hallett, R. L., Clewley, J. P., Bobet, F., McKiernan, P. J., Teo, C. G.
(2000). Characterization of a highly divergent TT virus genome. J. Gen. Virol.
81: 2273-2279
[Abstract]
[Full Text]
-
Worobey, M.
(2000). Extensive Homologous Recombination among Widely Divergent TT Viruses. J. Virol.
74: 7666-7670
[Abstract]
[Full Text]
-
Cardona, C. J., Oswald, W. B., Schat, K. A.
(2000). Distribution of chicken anaemia virus in the reproductive tissues of specific-pathogen-free chickens. J. Gen. Virol.
81: 2067-2075
[Abstract]
[Full Text]
-
Fenaux, M., Halbur, P. G., Gill, M., Toth, T. E., Meng, X.-J.
(2000). Genetic Characterization of Type 2 Porcine Circovirus (PCV-2) from Pigs with Postweaning Multisystemic Wasting Syndrome in Different Geographic Regions of North America and Development of a Differential PCR-Restriction Fragment Length Polymorphism Assay To Detect and Differentiate between Infections with PCV-1 and PCV-2. J. Clin. Microbiol.
38: 2494-2503
[Abstract]
[Full Text]
-
Inami, T., Konomi, N., Arakawa, Y., Abe, K.
(2000). High Prevalence of TT Virus DNA in Human Saliva and Semen. J. Clin. Microbiol.
38: 2407-2408
[Abstract]
[Full Text]
-
Okamoto, H., Ukita, M., Nishizawa, T., Kishimoto, J., Hoshi, Y., Mizuo, H., Tanaka, T., Miyakawa, Y., Mayumi, M.
(2000). Circular Double-Stranded Forms of TT Virus DNA in the Liver. J. Virol.
74: 5161-5167
[Abstract]
[Full Text]
-
Niel, C., Saback, F. L., Lampe, E.
(2000). Coinfection with Multiple TT Virus Strains Belonging to Different Genotypes Is a Common Event in Healthy Brazilian Adults. J. Clin. Microbiol.
38: 1926-1930
[Abstract]
[Full Text]
-
Khudyakov, Y. E., Cong, M.-e., Nichols, B., Reed, D., Dou, X.-G., Viazov, S. O., Chang, J., Fried, M. W., Williams, I., Bower, W., Lambert, S., Purdy, M., Roggendorf, M., Fields, H. A.
(2000). Sequence Heterogeneity of TT Virus and Closely Related Viruses. J. Virol.
74: 2990-3000
[Abstract]
[Full Text]
-
Romeo, R., Hegerich, P., Emerson, S. U., Colombo, M., Purcell, R. H., Bukh, J.
(2000). High prevalence of TT virus (TTV) in naive chimpanzees and in hepatitis C virus-infected humans: frequent mixed infections and identification of new TTV genotypes in chimpanzees. J. Gen. Virol.
81: 1001-1007
[Abstract]
[Full Text]
-
Rodriguez-Inigo, E., Casqueiro, M., Bartolome, J., Ortiz-Movilla, N., Lopez-Alcorocho, J. M., Herrero, M., Manzarbeitia, F., Oliva, H., Carreno, V.
(2000). Detection of TT Virus DNA in Liver Biopsies by in Situ Hybridization. Am. J. Pathol.
156: 1227-1234
[Abstract]
[Full Text]
-
Okamoto, H., Fukuda, M., Tawara, A., Nishizawa, T., Itoh, Y., Hayasaka, I., Tsuda, F., Tanaka, T., Miyakawa, Y., Mayumi, M.
(2000). Species-Specific TT Viruses and Cross-Species Infection in Nonhuman Primates. J. Virol.
74: 1132-1139
[Abstract]
[Full Text]
-
Abe, K., Inami, T., Ishikawa, K., Nakamura, S., Goto, S.
(2000). TT Virus Infection in Nonhuman Primates and Characterization of the Viral Genome: Identification of Simian TT Virus Isolates. J. Virol.
74: 1549-1553
[Abstract]
[Full Text]
-
Kato, T., Mizokami, M., Mukaide, M., Orito, E., Ohno, T., Nakano, T., Tanaka, Y., Kato, H., Sugauchi, F., Ueda, R., Hirashima, N., Shimamatsu, K., Kage, M., Kojiro, M.
(2000). Development of a TT Virus DNA Quantification System Using Real-Time Detection PCR. J. Clin. Microbiol.
38: 94-98
[Abstract]
[Full Text]
-
Nishizawa, T., Okamoto, H., Tsuda, F., Aikawa, T., Sugai, Y., Konishi, K., Akahane, Y., Ukita, M., Tanaka, T., Miyakawa, Y., Mayumi, M.
(1999). Quasispecies of TT Virus (TTV) with Sequence Divergence in Hypervariable Regions of the Capsid Protein in Chronic TTV Infection. J. Virol.
73: 9604-9608
[Abstract]
[Full Text]
-
Abe, K., Inami, T., Asano, K., Miyoshi, C., Masaki, N., Hayashi, S., Ishikawa, K.-i., Takebe, Y., Win, K. M., El-Zayadi, A. R., Han, K.-H., Zhang, D. Y.
(1999). TT Virus Infection Is Widespread in the General Populations from Different Geographic Regions. J. Clin. Microbiol.
37: 2703-2705
[Abstract]
[Full Text]