Previous Article | Next Article 
Journal of Virology, May 1999, p. 3534-3543, Vol. 73, No. 5
0022-538X/99/$04.00+0
Regulation of Vaccinia Virus Morphogenesis:
Phosphorylation of the A14L and A17L Membrane Proteins and
C-Terminal Truncation of the A17L Protein Are Dependent on the
F10L Kinase
Tatiana
Betakova,
Elizabeth
J.
Wolffe, and
Bernard
Moss*
Laboratory of Viral Diseases, National
Institute of Allergy and Infectious Diseases, National Institutes
of Health, Bethesda, Maryland
Received 30 November 1998/Accepted 25 January 1999
 |
ABSTRACT |
This study focused on three vaccinia virus-encoded proteins that
participate in early steps of virion morphogenesis: the A17L and A14L
membrane proteins and the F10L protein kinase. We found that (i) the
A17L protein was cleaved at or near an AGX consensus motif at amino
acid 185, thereby removing its acidic C terminus; (ii) the nontruncated
form was associated with immature virions, but only the C-terminal
truncated protein was present in mature virions; (iii) the nontruncated
form of the A17L protein was phosphorylated on serine, threonine, and
tyrosine residues, whereas the truncated form was unphosphorylated;
(iv) nontruncated and truncated forms of the A17L protein existed in a
complex with the A14L membrane protein; (v) C-terminal cleavage of the
A17L protein and phosphorylation of the A17L and A14L proteins failed
to occur in cells infected with a F10L kinase mutant at the
nonpermissive temperature; and (vi) the F10L kinase was the only viral
late protein that was necessary for phosphorylation of the A17L
protein, whereas additional proteins were needed for C-terminal
cleavage. We suggest that phosphorylation of the A17L and A14L proteins
is mediated by the F10L kinase and is required to form the membranes
associated with immature virions. Removal of phosphates and the A17L
acidic C-terminal peptide occur during the transition to mature virions.
 |
INTRODUCTION |
The initial steps in vaccinia virus
morphogenesis are poorly understood. The first viral structures are
crescent-shaped membranes that appear to form de novo in specialized
factory regions of the cytoplasm which are largely devoid of cellular
organelles (6, 10, 24). Griffiths and coworkers (36,
42) have proposed that the viral membranes are derived from the
cellular intermediate compartment by a wrapping mechanism. Regardless
of their origin, the crescents develop into spherical, immature virions (IV) containing the double-stranded DNA genome and subsequently into
dense, brick-shaped, infectious intracellular mature virions (IMV).
Some of the IMV escape from the assembly regions and are wrapped by
membrane cisternae, derived from the trans-Golgi or early endosomal
network, to form the intracellular enveloped virions (IEV) (13,
15, 23, 38, 47). A subset of IEV are propelled through the
cytoplasm via actin tails and form the tips of specialized microvilli
that protrude from the cell surface and mediate efficient cell-to-cell
virus spread (5, 12, 14, 35, 37, 44, 55, 57). IEV without
actin tails also reach the periphery (55), where they fuse
with the plasma membrane to form cell-associated enveloped virions and
released extracellular enveloped virions (3, 28).
At least 11 virus-encoded proteins are associated with IMV membranes
(16, 45). Studies with conditional lethal mutants have shown
that three of these (the A17L, D13L, and A14L proteins) and one
additional protein encoded by the F10L gene are required for formation
of viral crescents. Under nonpermissive conditions, F10L mutants make
no membrane structures (48, 51), A17L mutants make small
vesicles (34, 56), D13L mutants make irregular membranes
without spicules (58) that resemble structures formed in the
presence of the drug rifampin (10, 26, 27), and A14L mutants
make aberrant crescents (34). The product of the F10L gene
is a serine/threonine protein kinase whose protein targets are
unidentified (21). The A17L product undergoes proteolytic processing near the N terminus at an AGX cleavage site consensus motif
(34, 45, 54) and is cotranslationally inserted into membranes and exposed on the concave surface of IV (18, 30, 56). Rifampin-resistant mutants have been mapped to the D13L gene
(1, 46), and the protein has been localized to the concave surface of crescents and IV (43). The A14L product is a
phosphorylated component of the IMV membrane that forms a complex with
the A17L and A27L proteins (34, 36). Although associated
with IMV membranes, the A27L protein has a role in the formation of IEV
rather than IMV (32, 33).
In the present study, we investigated the posttranslational
modifications of the A17L protein and the role of these in virion assembly. Proteolytic processing was shown to occur near the C terminus
of the A17L protein, as well as at the previously described N-terminal
site. In addition, the A17L protein with an intact C terminus was found
to be phosphorylated. Both of these modifications, as well as
phosphorylation of the A14L protein, depended on the F10L protein
kinase, providing insights into the role of the enzyme in the early
steps of morphogenesis.
 |
MATERIALS AND METHODS |
Cells and viruses.
BS-C-1 (ATCC CCL26) cells were grown in
Eagle minimum essential medium (EMEM; Quality Biologicals) containing
2.5% fetal bovine serum in a 5% CO2 atmosphere at 37°C.
Recombinant vaccinia virus vA17L
5 in which the original A17L open
reading frame (ORF) was replaced by an
isopropyl-
-D-galactopyranoside (IPTG)-inducible copy
(56), and recombinant vaccinia virus vTF7-3 which expresses the bacteriophage T7 RNA polymerase gene (9) were propagated in HeLa cells as described previously (8).
Temperature-sensitive (ts) F10L mutants of vaccinia virus,
ts15 and ts28 (4) were grown at
32°C.
Antibodies.
Rabbit antiserum to the C-terminal peptide of
the A17L ORF was previously described (56). Rabbit antisera
were produced to the peptide corresponding to the sequence
TEEQQQSFMPKD of the A17L ORF (Fig. 1A) and to the C-terminal
peptide CAPHRVSGVIHTN of the A14L ORF conjugated to keyhole
limpet hemocyanin. Polyclonal antibodies to phosphorylated amino acids
were from Zymed Laboratories (San Francisco, Calif.).
Plasmid construction.
Plasmid pVOTE.1-A17L, containing the
A17L ORF, was previously described under the name pDMA17L.2
(56). A copy of the F10L gene, with an NdeI site
as the initiation codon and BamHI site after the TAA
termination signal, was obtained by PCR using vaccinia virus genomic
DNA as the template and oligonucleotide primers TB90
(GGGGGGCATATGGGTGTTGCCAATGATTCATCC) and TB91
(GGGGGGGGATCCTTAGTTTCCGCCATTTATCC). The T at position
510
was changed to C to eliminate an internal NdeI restriction
site by PCR using primers TB92
(CTCTGTATAAACGGGTTCTTCACATGTTGCTATTATTGATAC) and TB93
(GTATCAATAATAGCAACATGTGAAGAACCCGTTTATACAGAG). The PCR product was cut with NdeI and BamHI and inserted
into plasmid pVOTE.2 (52) to generate pVOTE.2-F10L. Plasmid
DNA was purified using the Wizard Plus SV Minipreps DNA purification
system (Promega).
Metabolic labeling.
Confluent BS-C-1 cells were infected
with 10 PFU of vaccinia virus strain WR per cell in the presence or
absence of rifampin (100 µg/ml) at 37°C or with vaccinia virus
ts15 or ts28 at 32 or 39.5°C. At 6 h after
infection, the medium was removed and the cells were overlaid with
methionine-free EMEM containing [35S]methionine (50 µCi/ml). After a 30-min incubation, the cells were washed once and
overlaid with EMEM containing 2.5% fetal bovine serum. Cells in
individual wells were lysed in extraction buffer (1% Nonidet P-40, 150 mM NaCl, 1 mM EDTA, 20 mM Tris-HCl [pH 7.5], 1 mM
phenylmethylsulfonyl fluoride) immediately after labeling (time zero)
or at later times. After 10 min on ice, the lysates were cleared by
microcentrifugation for 1 min, and the supernatants were used for immunoprecipitations.
For metabolic labeling with 32Pi, infected
BS-C-1 cells were incubated overnight with 50 µCi/ml and lysed in the
presence of the phosphatase inhibitors sodium fluoride and sodium
metavanadate as described elsewhere (39).
Immunoprecipitation.
Clarified lysates (100 to 200 µl)
were mixed with 2 µl of antiserum and 500 µl of phosphate-buffered
saline (PBS) and rotated overnight at 4°C. Sodium fluoride and
metavanadate were included for analysis of phosphoproteins
(39). Protein A-Sepharose (Pharmacia) beads (150 µl of a
10% suspension in PBS) were added to each sample. After 2 h, the
beads were washed five times with PBS, resuspended in electrophoresis
sample buffer. Sodium dodecyl sulfate (SDS)-12.5% polyacrylamide gel
electrophoresis (PAGE) was performed as described elsewhere
(19), and the gels were immersed in fixative (10 ml of
acetic acid, 35 ml of 2-propanol, 55 ml of water). The gels were dried
and exposed to BioMax MS film (Kodak) at
70°C. The molecular masses
of viral proteins were estimated by comparison with standard protein
markers (Amersham).
Western blotting.
After fractionation by SDS-PAGE, the
protein were electrophoretically transferred to a nitrocellulose
membrane. The blot was incubated in 5% nonfat dry milk in PBS
overnight and then for 1 h with A17L C or N antibody. The membrane
was washed several times with PBS and incubated with secondary antibody
coupled to alkaline phosphatase (Sigma). The blot was washed several
time with PBS and visualized using the
5-bromo-4-chloro-3-indolylphosphate-nitroblue tetrazolium phosphatase
substrate system (Kirkegaard & Perry Laboratories).
Transfection experiments.
BS-C-1 cells in six-well plates
were infected with vTF7-3 (10 PFU/cell) in OPTIMEM (GIBCO) medium
containing 40 µg of cytosine arabinoside (AraC) per ml at 37°C.
After 1 h, the infected cells were transfected with 2 µg of
pVOTE.1-A17L or pVOTE.2-F10L or both in DOTAP (Boehringer Mannheim).
After 4 h, the cells were washed and overlaid with either 2 ml of
phosphate-free EMEM with 50 µCi of 32Pi or 2 ml of methionine-free MEM with 50 µCi of
[35S]methionine. After an additional 20 h, the cells
were washed with PBS, lysed, and analyzed as described above.
Phosphoamino acid analysis.
BS-C-1 cells were infected with
vA17L
5 virus in the presence or absence of IPTG and metabolically
labeled with 32Pi as described above. After
immunoprecipitation with antibodies and SDS-PAGE, the phosphoproteins
were transferred to a polyvinylidene difluoride (PVDF) membrane
(Millipore). The band of interest was excised, and the protein was
hydrolyzed in 6 M HCl for 60 min at 110°C. After drying, the material
was resuspended and analyzed by two-dimensional thin-layer
electrophoresis (40).
Electron microscopy.
Infected BS-C-1 cells were fixed with
paraformaldehyde and cryosectioned as previously described
(55). Thawed cryosections were incubated with rabbit serum
containing A17L N or A17L C antibodies, washed, incubated with
10-nm-diameter gold particles conjugated to protein A (Department of
Cell Biology, Utrecht University School of Medicine, Utrecht, The
Netherlands), and viewed with a Philips CM100 electron microscope.
 |
RESULTS |
C-terminal truncation of the A17L protein.
The A17L ORF
encodes a 203-amino-acid protein of 23 kDa (Fig.
1A). Pulse-chase experiments and
N-terminal sequencing studies, however, indicated the formation of a
21-kDa species that started at amino acid 17, consistent with
proteolytic processing at an AGX consensus motif (31, 34, 45,
54). Based on the electrophoretic mobility of the processed
protein, Takahashi et al. (45) suggested that cleavage also
occurred at another AGX motif near the C terminus. To investigate this,
Western blots were prepared from cytoplasmic extracts of cells infected
with vaccinia virus and then probed with an antibody to the peptide
corresponding to amino acids 26 to 37, which would be conserved in
processed forms of the A17L protein, or with an antibody to the peptide
comprising amino acids 192 to 203, which would be removed by C-terminal
processing (Fig. 1A). The A17L N antibody reacted with a band that was
usually resolved as a doublet of 23- and 25-kDa species and a
faster-migrating band of 21 kDa (Fig. 1B). In contrast, the A17L C
antibody failed to react with the 21-kDa protein (Fig. 1B). These data
indicated that the 21-kDa species lacked epitopes formed by amino acids 192 to 203 and supported the C-terminal proteolytic processing of the
A17L protein. Presumably, the 25- and 23-kDa proteins represent full-length and N-terminally cleaved species, respectively. Evidence for the latter was obtained by experiments in which a mutated gene
encoding an N-terminally truncated form of the A17L protein was
transfected into cells and detected by reactivity with C antibody (unpublished data). Whether an intermediate C-terminally truncated species with an intact N terminus exists could not be determined.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 1.
C-terminal cleavage of the A17L protein. (A) The A17L
ORF is shown with the sequences used to generate synthetic peptides for
immunization underlined and a slash at the known AGA and predicted AGN
cleavage motifs. The antibodies induced by peptides TEEQQQSFMPKD
and IPTFNSLNTDDY are referred to as A17L N antibody
and A17L C antibody, respectively. (B) Western blot of extract from
uninfected cells (U) and cells infected with vaccinia virus (I) and
probed with A17L N antibody (anti-N) and A17L C-antibody (anti-C). The
masses and positions of marker proteins are indicated on the left.
Close inspection reveals that the 23- to 25-kDa bands from infected
cells detected with N and C antibodies are doublets. The C antibody
cross-reacted with more slowly migrating bands from uninfected and
infected cells. (C) Western blot of proteins from 11 µg of sucrose
gradient-purified vaccinia virions probed with A17L N and C
antibodies.
|
|
The C-terminal truncated form of the A17L protein is in mature
virions.
Western blots were prepared from sucrose
gradient-purified vaccinia virions. In this case, only the 21-kDa
protein was detected with the N antibody and the C antibody was
nonreactive (Fig. 1C).
Previous immunoelectron microscopic studies had shown that the C
antibody labeled the concave surface of crescents and IV
as well as
immature membrane precursors that accumulated in the
presence of the
drug rifampin but did not label IMV (
56). We
repeated these
studies using the newly available N antibody in
addition to the C
antibody. Whereas the C antibody labeled only
membranes of immature
virus forms, the N antibody also labeled
mature forms (Fig.
2). These results were consistent with
the
biochemical analysis and indicated that C-terminal truncation
occurred during the transition from IV to IMV.

View larger version (93K):
[in this window]
[in a new window]
|
FIG. 2.
Immunogold labeling of viral membranes with antibodies
to the A17L protein. BS-C-1 cells that had been infected with vaccinia
virus for 24 h were fixed in paraformaldehyde, cryosectioned, and
incubated with A17L N antibody (N) or A17L C antibody (C) and then with
10-nm-diameter gold particles conjugated to protein A. Electron
microscopic images are shown with a 1-µm marker. m, mature particles;
i, immature particles.
|
|
Relationship of C-terminal cleavage and morphogenesis.
The
antibiotic rifampin blocks the formation of viral crescents, leading to
the accumulation of immature membrane precursors lacking a spicule coat
(10, 26, 27), and prevents the proteolytic processing of
some core proteins (17, 25). To determine the relationship
between C-terminal cleavage of the A17L protein and morphogenesis, [35S]methionine pulse-chase
experiments were carried out in the absence or presence of
rifampin. In the absence of rifampin, a pulse-labeled band of 23 to 25 kDa was detected with C or N antibody (Fig.
3A). The intensity of this band was
relatively constant for an additional hour but then diminished. A
21-kDa species was detected after a 1-h chase and only with N antibody
(Fig. 3A). The 21-kDa C-terminal truncated species also formed in the
presence of rifampin, indicating that processing of the A17L protein
does not require viral crescent formation (Fig. 3B). Rifampin was shown
to block the cleavage of the precursor to the 4B core protein,
indicating that the drug was working effectively (Fig. 3).

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 3.
C-terminal truncation of the A17L protein in the
presence of rifampin. Replicate wells containing BS-C-1 cells were
infected with vaccinia virus and incubated at 37°C in the absence (A)
or continued presence (B) of rifampin. At 6 h after infection, the
cells were incubated for 30 min with [35S]methionine. The
cells were then washed and incubated with medium containing unlabeled
amino acids. Cells were harvested after the 30-min pulse (time zero)
and after 0.5, 1, 2, and 3 h of chase as indicated, lysed, and
incubated with A17L C antibody, A17L N antibody, or antibody to the 4b
core protein. The bound proteins were analyzed by SDS-PAGE and
autoradiography. The positions and masses of marker proteins are
indicated.
|
|
To block morphogenesis prior to the rifampin-sensitive stage, we
acquired the conditional lethal F10L mutants
ts15 and
ts28
(
4). Under nonpermissive conditions, viral
protein synthesis
occurs normally but formation of crescents or other
viral membranes
and processing of core proteins is largely blocked
(
48,
51).
Pulse-chase experiments and immunoprecipitation
with N and C antibodies
indicated that C-terminal cleavage of the A17L
protein occurred
in cells infected with
ts15 at the
permissive temperature of 32°C
but not at the nonpermissive
temperature of 39.5°C (Fig.
4),
suggesting
a direct or indirect role of the F10L kinase in proteolytic
processing.
Similar results were obtained for
ts28 (data not
shown). However,
processing of the A17L protein occurred in cells
infected with
wild-type vaccinia virus at 39.5°C (data not shown).

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 4.
C-terminal truncation of the A17L protein failed to
occur in cells infected at the nonpermissive temperature with an F10L
mutant. Replicate BS-C-1 cells were infected with ts15 at
32°C (A) or 39.5°C (B). At 6 h after infection, the cells were
incubated for 30 min with [35S]methionine. The cells were
then washed and incubated with medium containing unlabeled amino acids.
Care was taken to maintain the temperature at 32 or 39.5°C during the
labeling and chase periods. Cells were harvested after the 30-min pulse
(time zero) and after 0.5, 1, 2, and 3 h of chase as indicated,
lysed, and incubated with A17L C antibody or A17L N antibody. The bound
proteins were analyzed by SDS-PAGE and autoradiography. The positions
and masses of marker proteins are indicated.
|
|
Association of the A17L and A14L proteins.
Rodriguez et al.
(31, 34) found that antibody to the A27L IMV membrane
protein precipitated a complex containing the 21-kDa form of the A17L
protein, the 15-kDa A14L protein, and the A27L protein. In contrast,
neither the A14L nor the A27L protein coprecipitated with the A17L
protein when the A17L N or C antibody was used (Fig. 3A). Proteins
corresponding in size to those derived from A17L did coprecipitate with
the A14L protein, however, when antibody to the C-terminal peptide of
the latter was used (see below). To be certain that the coprecipitating
proteins were derived from A17L, we repeated the experiment using the
A17L-inducible conditional lethal mutant vA17L
5 (56).
Previous studies had shown that the absence of IPTG, synthesis of the
A17L protein was undetectable but synthesis of other proteins appeared
unaffected (56). Under these conditions, small vesicles
assembled around areas of dense viroplasm without formation of the
characteristic viral membranes and processing of core proteins
(56). Pulse-chase experiments were carried out in the
presence and absence of IPTG, and the labeled proteins were
immunoprecipitated with A17L N antibody (Fig.
5A) or A14L C antibody (Fig. 5B). As
shown in Fig. 5A, the A17L protein was not pulse-labeled in the absence
of IPTG. In the presence of IPTG, synthesis and processing of the A17L
protein was similar to that observed with wild-type vaccinia virus
(compare Fig. 3A and 5A). No evidence of coprecipitation of the 15-kDa A14L protein was obtained with A17L N antibody. Nevertheless, the
pulse-labeled 25- and 23-kDa A17L proteins coprecipitated with the
15-kDa A14L protein using antibody to the latter (Fig. 5B). After a 1-h
chase, the 21-kDa A17L protein also coprecipitated with the 15-kDa A14L
protein (Fig. 5B). As expected, no proteins of 21, 23, or 25 kDa were
coprecipitated when A17L expression was not induced. The amount of
labeled A14L protein was diminished in the absence of IPTG (Fig. 5B),
suggesting that the A17L protein exerted a positive effect on the
synthesis or stability of the A14L protein.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 5.
Coimmunoprecipitation of A17L and A14L proteins.
Pulse-chase [35S]methionine-labeling experiments were
carried out as described in the legend to Fig. 4 except that cells were
infected with vA17L 5 virus in the absence ( ) or presence (+) of
IPTG at 37°C and the chase was continued for 4 h. Lysates were
immunoprecipitated with A17L N antibody (A) or A14L C antibody (B) and
analyzed by SDS-PAGE and autoradiography. In panel A, no pulse-labeled
protein was detected in the absence of IPTG, and so only the chase
samples in the presence of IPTG are shown. The positions and masses of
marker proteins are indicated.
|
|
Phosphorylation of the A17L protein.
Since the A14L protein is
phosphorylated (34), we carried out experiments to determine
whether the A17L protein is also a phosphoprotein. Initial
32Pi labeling experiments were carried out with
wild-type vaccinia virus. These studies indicated that a phosphorylated
protein was immunoprecipitated with A17L N antibody (data not shown).
To confirm the specificity of the immunoprecipitation, we again used
the inducible mutant vA17L
5 (56).
Cells were infected with vA17L

5 in the presence or absence of IPTG
and labeled with [
35S]methionine to analyze polypeptide
synthesis or
32P
i to detect phosphorylation. In
the absence of IPTG, no labeled
products of 21 to 25 kDa were
immunoprecipitated with A17L N antibody
(Fig.
6), consistent with repression of A17L
expression. In the
presence of IPTG, however, a
32P-labeled
polypeptide of 25 kDa was immunoprecipitated with A17L
N antibody (Fig.
6B), whereas [
35S]methionine-labeled polypeptides of 25 and 23 kDa as well as
a faint one of 21 kDa were immunoprecipitated
(Fig.
6A). The comigration
of the
32P-labeled band with the
upper band of the [
35S]methionine-labeled doublet was
confirmed by their electrophoresis
in the same gel (data not shown).
The inability to detect a phosphorylated
21-kDa A17L species in
numerous experiments could indicate that
the phosphate was removed by a
phosphatase or by proteolytic processing
during morphogenesis. An
additional
32P-labeled band was present near the bottom of
most lanes regardless
of which antibody was used (Fig.
6B). Neither the
identity nor
the significance of this material was determined.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 6.
Phosphorylation of the A17L and the A14L proteins.
BS-C-1 cells were infected with vaccinia virus vA17L 5 at 37°C in
the presence (+) or absence ( ) of IPTG or with vaccinia virus
ts15 virus at the permissive (32°C) or nonpermissive
(39.5°C) temperature (T) and then labeled overnight with
[35S]methionine (A) or with 32Pi
(B). Immunoprecipitation was performed with A17L N antibody (A17L) or
with A14L C antibody (A14L) as indicated. The bound proteins were
analyzed by SDS-PAGE and autoradiography. U, uninfected cells.
Positions and masses of marker proteins are shown on the right.
|
|
The A14L antibody was also used to immunoprecipitate the labeled
proteins in extracts of cells infected with vA17L

5. Phosphorylation
of the 15-kDa A14L protein was independent of A17L induction (Fig.
6B),
even though the amount of the [
35S]methionine-labeled
A14L protein was decreased in the absence
of IPTG. In the presence of
inducer, C-terminal processed and
unprocessed
[
35S]methionine-labeled A17L protein species (Fig.
6A)
and a single
32P-labeled 25-kDa species (Fig.
6B)
coprecipitated with the A14L
protein.
Role of the F10L kinase in phosphorylation of A17L and A14L
proteins.
Because the F10L kinase mutants exhibited a defect in
processing of the A17L protein at 39.5°C (Fig. 4B), we investigated the phosphorylation of the A17L and A14L proteins at the nonpermissive temperature. Control experiments with wild-type vaccinia virus demonstrated that 32P-labeling of the A17L and A14L
proteins was unaffected by elevation of the temperature to 39.5°C
(data not shown). However, in cells infected with ts15 or
ts28, 32P-labeling of the A17L and the A14L
proteins was undetectable or greatly reduced at the elevated
temperature (Fig. 6B). This correlated with a block in formation of the
21-kDa [35S]methionine-labeled A17L species (Fig. 6A). In
addition, the 23-kDa [35S]methionine-labeled A17L protein
did not coprecipitate with the A14L protein at 39.5°C (Fig. 6A).
These data suggested that the F10L kinase was required for
phosphorylation of the A17L and A14L proteins as well as for their
physical association.
To further study the role of the F10L kinase, we devised conditions in
which the A17L and F10L proteins could be selectively
expressed. This
was accomplished with plasmids pVOTE.1-A17L and
pVOTE.2-F10L, in which
the A17L and F10L ORFs are regulated by
a bacteriophage T7 promoter,
and recombinant vaccinia virus vTF7-3,
which expresses the T7 RNA
polymerase. BS-C-1 cells were infected
with vTF7-3 in the presence of
AraC to prevent replication of
the viral genome and expression of
intermediate and late genes.
The cells were transfected with
pVOTE.1-A17L alone or together
with pVOTE.2-F10L and then metabolically
labeled with
32P
i or
[
35S]methionine. Although synthesis of the A17L protein
occurred
independently of F10L kinase (Fig.
7A), it was phosphorylated
only when F10L
kinase was coexpressed (Fig.
7B). These results
suggested that the F10L
kinase was the only viral late protein
required for phosphorylation of
the A17L protein. However, the
21-kDa species of the A17L protein was
not detected suggesting
that synthesis of other viral late proteins was
required for C-terminal
truncation. Attempts to carry out similar
experiments by cotransfection
of a plasmid containing the A14L gene,
either with or without
plasmids expressing A17L and F10L, were not
interpretable because
expression of the A14L protein could not be
demonstrated (
2).

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 7.
Phosphorylation of the A17L protein in cells transfected
with plasmids expressing the A17L and F10L genes. BS-C-1 cells were
infected with vTF7-3 in the absence or presence of AraC and transfected
with pVOTE.1-A17L (A17L) alone or together with.pVOTE.2-F10L (F10L).
The cells were metabolically labeled with [35S]methionine
(A) or 32Pi (B), and the lysates were
immunoprecipitated with A17L N antibody and analyzed by SDS-PAGE and
autoradiography.
|
|
Analysis of phosphorylated amino acids.
We used two methods to
identify the amino acids in the A17L and A14L proteins that were
phosphorylated. The first depended on the specificity of antibodies for
phosphoserine, phosphothreonine, and phosphotyrosine and the ability to
selectively induce expression of the A17L protein. Lysates were
prepared from cells infected with vA17L
5 in the presence or absence
of IPTG and labeled with 32Pi. An IPTG-induced
protein of 25 kDa was immunoprecipitated with the antibody to
phosphotyrosine (Fig. 8). Although in the
absence of IPTG a protein that gave a faint 25-kDa band was
immunoprecipitated with antibody to phosphothreonine, a stronger band
appeared with IPTG (Fig. 8). No band of the correct size was detected
using antibody to phosphoserine. Thus, these results suggested that the
A17L protein was phosphorylated on tyrosine and threonine residues.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 8.
SDS-PAGE analysis of proteins immunoprecipitated with
antibodies to phosphorylated amino acids. BS-C-1 cells were infected
with vA17L 5 virus in the absence ( ) or presence (+) of IPTG and
labeled with 32Pi. Lysates were
immunoprecipitated with antibody to phosphoserine (PS), phosphotyrosine
(PY), or phosphothreonine (PT) or with A17L N-antibody (A17L) and
analyzed by SDS-PAGE. The positions and masses in kilodaltons of marker
proteins are shown on the left.
|
|
In the second approach, cells were infected with vA17L

5 in the
presence or absence of IPTG and then labeled with
32P
i. The lysates were immunoprecipitated with
A17L N or C antibody,
A14L antibody, or antiphosphotyrosine antibody.
The proteins were
then resolved by SDS-PAGE and transferred to a PVDF
membrane.
The polypeptides were located by autoradiography, and the
segments
corresponding to the induced 25-kDa protein were excised and
hydrolyzed
with HCl. The absence of radioactive 25-kDa bands from
noninduced
cells supported the specificity of the immunoprecipitation
(data
not shown). After acid hydrolysis, the samples were analyzed by
two-dimensional thin-layer electrophoresis with
phosphoamino acid
standards. The latter were visualized with
ninhydrin, and the
plate was then autoradiographed. Phosphoserine was
identified
in the hydrolysate of the A14L protein (Fig.
9, anti-A14L), and
both phosphothreonine
and phosphoserine were identified in the
hydrolysate of the A17L
protein isolated either with A17L N antibody
(Fig.
9, anti-A17L) or
A17L C antibody (not shown). No phosphotyrosine
was detected in these
hydrolysates. Nevertheless, phosphotyrosine,
phosphothreonine, and
phosphoserine were detected in the hydrolysate
of the IPTG-induced
25-kDa protein that was immunoprecipitated
with phosphotyrosine
antibody (Fig.
9, Anti-PY). Presumably, the
latter procedure provided
an enrichment for phosphotyrosine-containing
A17L protein species of
low abundance.

View larger version (77K):
[in this window]
[in a new window]
|
FIG. 9.
Phosphoamino acid analysis. BS-C-1 cells were infected
with vaccinia virus vA17L 5 in the presence of IPTG and labeled
overnight with 32Pi. After lysis and
immunoprecipitation with A14L antibody, A17L N antibody, or antibody to
phosphotyrosine (anti-PY), the proteins were resolved by SDS-PAGE and
transferred to a PVDF membrane. The radioactively labeled bands were
excised, hydrolyzed with HCl, and analyzed by two-dimensional
thin-layer electrophoresis at pH 1.9 and 3.5. The standards amino acids
were visualized with ninhydrin, and the plates were autoradiographed.
The spots corresponding to phosphoserine (PS), phosphothreonine (PT),
phosphotyrosine (PY), Pi, phosphoribose (Pr), and
phosphouridine (Up) are identified. P.peptides, phosphorylated
peptides.
|
|
 |
DISCUSSION |
Viral membrane formation is the initial step in poxvirus
morphogenesis. We examined the A17L protein primarily because it is an
integral membrane component (18, 31) and repression of A17L
gene expression results in a very early block in morphogenesis, prior
to the formation of viral membrane crescents (29, 30, 56).
In addition, the A17L protein is posttranslationally modified by
cleavage at a consensus motif, AGX, near the N terminus (34, 45,
54), and it forms a complex with the A14L and A27L membrane proteins (31, 34). New information provided by the present study is that (i) the A17L protein was cleaved at or near an AGX motif
at amino acid 185, thereby removing its acidic C terminus; (ii) only
the C-terminal truncated form was present in mature virus particles;
(iii) the A17L precursor protein was phosphorylated whereas the
C-terminal truncated form was not; (iv) nontruncated and C-terminal
truncated forms of the A17L protein associated in a complex with the
A14L protein; (v) C-terminal cleavage of the A17L protein and
phosphorylation of the A17L and A14L proteins failed to occur in cells
infected with F10L kinase mutants at the nonpermissive temperature; and
(vi) the F10L kinase was the only viral late stage protein that was
necessary for phosphorylation of the A17L protein, whereas other
intermediate- or late-stage proteins may be required for C-terminal
cleavage. Taken together, the data provided a model in which
phosphorylation and proteolytic processing are key events in vaccinia
virus morphogenesis that are regulated by the F10L kinase.
Proteolytic processing of vaccinia virus structural proteins occurs in
conjunction with viral morphogenesis (17, 25). Hruby and
coworkers (49, 50, 54) defined the cleavage site as the AGX
motif. An AGX motif in which X is A was previously identified as an
N-terminal cleavage site in the A17L protein (34, 45, 54).
We confirmed the presence of a second cleavage at or near the AGN
sequence at amino acid 186. Although a natural cleavage site in which X
is N had not previously been demonstrated, N as well as many other
amino acids can function in a trans-processing assay
(20). Proof that cleavage occurs precisely at the A17L AGN
site, however, will require C-terminal sequencing of the 21-kDa fragment or isolation and N-terminal sequencing of the putative 19-amino-acid fragment.
Cleavage of vaccinia virus structural proteins is generally blocked by
the antibiotic rifampin, indicating that proteolysis occurs after the
attachment of the D13L protein and formation of viral crescents
(17, 58). Removal of the C terminus of the A17L protein was
detected by 60 to 90 min after labeling but was unaffected by rifampin.
This result agreed with data of Rodriguez et al. (31) and
suggested that proteolysis of the A17L protein occurred at a very early
stage of virus assembly or was independent of morphogenesis. Evidence
supporting the former was obtained using F10L ts mutants
that interrupt morphogenesis prior to the detection of viral membranes
(48, 51). Importantly, the C-terminal cleavage of the A17L
protein did not occur at the nonpermissive temperature. Therefore,
viral membrane association appeared to be necessary for processing.
Although membrane association has not yet been shown to be required for
N-terminal processing of the A17L protein, it may be significant that
both the N and C termini of the A17L protein are oriented on the
concave surface of the IMV membrane (18, 56) where they
could be accessed by a viral protease. Whitehead and Hruby
(53) proposed that the vaccinia virus G1L ORF encodes a
protease that is responsible for processing of vaccinia virus
structural proteins. However, the absence of a conditional lethal G1L
mutant has precluded the testing of whether this protein has a role in
processing of the A17L protein.
Our studies also revealed that the A17L protein was phosphorylated.
Interestingly, only the A17L protein with an intact C terminus was
32P labeled. The absence of label in the 21-kDa processed
form could have several explanations. One is that the kinase sites are
in the C or the N termini and are removed by cleavage. Another is that
the processed form becomes accessible to a phosphatase. In this
respect, vaccinia virus encodes a dual-specificity tyrosine/serine phosphatase that is packaged in virus particles (11, 22). Chemical analysis of the 25-kDa species immunoprecipitated with antibody to the A17L protein revealed phosphorylated serine and threonine residues. Although we could not detect other phosphoamino acids in the protein immunoprecipitated with A17L N or C antibody, phosphotyrosine, phosphoserine, and phosphothreonine were detected in
the 25-kDa protein induced by IPTG and immunoprecipitated with antibody
to phosphotyrosine. Both the size of the protein and its specific
induction support the idea that the phosphotyrosine was present in the
A17L protein and not a contaminant. Although there are several possible
explanations for the apparent discrepancy, the most likely one is that
the phosphotyrosine antibody provided an enrichment for a small
population of A17L protein molecules with phosphotyrosine. We also
determined the phosphoamino acid composition of the A14L membrane
protein because this had not previously been reported. Only
phosphoserine was detected.
The presence of phosphothreonine and phosphoserine in A17L and A14L
proteins provided an explanation for the morphogenesis defect of
conditional lethal F10L kinase mutants. We found that neither the A17L
nor the A14L protein was phosphorylated in cells infected with F10L
ts mutants at a nonpermissive temperature. Similar results
regarding phosphorylation of the A17L protein were independently
observed by Derrien et al. (7). Since F10L is a
serine/threonine kinase and is packaged in virus particles (21), the A17L and A14L proteins are probably substrates.
Support for this hypothesis came from cotransfection experiments which demonstrated that the F10L kinase is the only vaccinia virus late gene
product required for phosphorylation of the A17L protein. Another
explanation, however, is that the F10L kinase activates a cellular
kinase that is responsible for phosphorylation of the A14L and A17L
proteins. A cellular kinase could explain the occurrence of tyrosine
phosphorylation, as this specificity has not yet been described for the
F10L kinase.
Previous studies demonstrated that antibody to the A27L IMV membrane
protein bound a complex that contained the A14L and 21-kDa processed
form of the A17L protein (34). We extended this observation by demonstrating coprecipitation of the C-terminal truncated and the
nontruncated forms of the A17L protein with antibody to the C terminus
of the A14L protein. This result indicated that the A14L and A17L
proteins associate with each other before C-terminal cleavage of the
latter or their interaction with the A27L protein. This sequence of
events is consistent with immunoelectron microscopic studies which
showed that the A27L protein does not associate with crescents but
attaches to IV at a later stage of morphogenesis (41). Under
conditions in which phosphorylation of the A14L and A17L proteins was
blocked, coprecipitation of the two could not be demonstrated,
suggesting that this modification is required for their interaction.
However, under these conditions, as well as when expression of the A17L
protein was repressed, the amount of A14L protein recovered after a
30-min pulse with [35S]methionine was reduced. Shorter
pulses might help to discriminate between the effect of the A17L
protein on the synthesis and stability of the A14L protein.
In summary, we suggest that phosphorylation of the A17L and A14L
proteins is mediated by the F10L kinase and is required to form the
viral membranes associated with immature virions. Removal of phosphates
and the acidic C-terminal peptide of the A17L protein occur during the
transition to mature virions.
 |
ACKNOWLEDGMENTS |
We thank Norman Cooper for preparing cells, George Katsafanas for
purified vaccinia virus, and Andrea Weisberg for assistance with
electron microscopy.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: National
Institutes of Health, Building 4, Room 229, 4 Center Dr., MSC 0445, Bethesda, MD 20892-0445. Phone: (301) 496-9869. Fax: (301) 480-1147. E-mail: bmoss{at}nih.gov.
 |
REFERENCES |
| 1.
|
Baldick, C. J., and B. Moss.
1987.
Resistance of vaccinia virus to rifampicin conferred by a single nucleotide substitution near the predicted NH2 terminus of a gene encoding an Mr 62,000 polypeptide.
Virology
156:138-145[Medline].
|
| 2.
| Betakova, T. 1998. Unpublished data.
|
| 3.
|
Blasco, R., and B. Moss.
1992.
Role of cell-associated enveloped vaccinia virus in cell-to-cell spread.
J. Virol.
66:4170-4179[Abstract/Free Full Text].
|
| 4.
|
Condit, R. C.,
A. Motyczka, and G. Spizz.
1983.
Isolation, characterization, and physical mapping of temperature-sensitive mutants of vaccinia virus.
Virology
128:429-443[Medline].
|
| 5.
|
Cudmore, S.,
P. Cossart,
G. Griffiths, and M. Way.
1995.
Actin-based motility of vaccinia virus.
Nature
378:636-638[Medline].
|
| 6.
|
Dales, S., and L. Siminovitch.
1961.
The development of vaccinia virus in Earle's L strain cells as examined by electron microscopy.
J. Biophys. Biochem. Cytol.
10:475-503.
[Abstract/Free Full Text] |
| 7.
| Derrien, M., K. Liu, M. Khanna, and P. Traktman.
1998. Personal communication.
|
| 8.
|
Earl, P. L., and B. Moss.
1991.
Generation of recombinant vaccinia viruses, p. 16.17.1-16.17.16.
In
F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology, vol. 2. Greene Publishing Associates & Wiley Interscience, New York, N.Y.
|
| 9.
|
Fuerst, T. R.,
E. G. Niles,
F. W. Studier, and B. Moss.
1986.
Eukaryotic transient-expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase.
Proc. Natl. Acad. Sci. USA
83:8122-8126[Abstract/Free Full Text].
|
| 10.
|
Grimley, P. M.,
E. N. Rosenblum,
S. J. Mims, and B. Moss.
1970.
Interruption by rifampin of an early stage in vaccinia virus morphogenesis: accumulation of membranes which are precursors of virus envelopes.
J. Virol.
6:519-533[Abstract/Free Full Text].
|
| 11.
|
Guan, K.,
S. S. Broyles, and J. E. Dixon.
1991.
A Tyr/Ser protein phosphatase encoded by vaccinia virus.
Nature
350:359-362[Medline].
|
| 12.
|
Hiller, G.,
C. Jungwirth, and K. Weber.
1981.
Fluorescence microscopical analysis of the life cycle of vaccinia virus in chick embryo fibroblasts. Virus-cytoskeleton interactions.
Exp. Cell Res.
132:81-87[Medline].
|
| 13.
|
Hiller, G., and K. Weber.
1985.
Golgi-derived membranes that contain an acylated viral polypeptide are used for vaccinia virus envelopment.
J. Virol.
55:651-659[Abstract/Free Full Text].
|
| 14.
|
Hiller, G.,
K. Weber,
L. Schneider,
C. Parajsz, and C. Jungwirth.
1979.
Interaction of assembled progeny pox viruses with the cellular cytoskeleton.
Virology
98:142-153[Medline].
|
| 15.
|
Ichihashi, Y.,
S. Matsumoto, and S. Dales.
1971.
Biogenesis of poxviruses: role of A-type inclusions and host cell membranes in virus dissemination.
Virology
46:507-532[Medline].
|
| 16.
|
Jensen, O. N.,
T. Houthaeve,
A. Shevchenko,
S. Cudmore,
T. Ashford,
M. Mann,
G. Griffiths, and J. K. Locker.
1996.
Identification of the major membrane and core proteins of vaccinia virus by two-dimensional electrophoresis.
J. Virol.
70:7485-7497[Abstract].
|
| 17.
|
Katz, E., and B. Moss.
1970.
Formation of a vaccinia virus structural polypeptide from a higher molecular weight precursor: inhibition by rifampicin.
Proc. Natl. Acad. Sci. USA
6:677-684.
|
| 18.
|
Krijnse-Locker, J.,
S. Schleich,
D. Rodriguez,
B. Goud,
E. J. Snijder, and G. Griffiths.
1996.
The role of a 21-kDa viral membrane protein in the assembly of vaccinia virus from the intermediate compartment.
J. Biol. Chem.
271:14950-14958[Abstract/Free Full Text].
|
| 19.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[Medline].
|
| 20.
|
Lee, P., and D. E. Hruby.
1994.
Proteolytic cleavage of vaccinia virus virion proteins. Mutational analysis of the specificity determinants.
J. Biol. Chem.
269:8616-8622[Abstract/Free Full Text].
|
| 21.
|
Lin, S., and S. S. Broyles.
1994.
Vaccinia protein kinase 2: a second essential serine/threonine protein kinase encoded by vaccinia virus.
Proc. Natl. Acad. Sci. USA
91:7653-7657[Abstract/Free Full Text].
|
| 22.
|
Liu, K.,
B. Lemon, and P. Traktman.
1995.
The dual-specificity phosphatase encoded by vaccinia virus, VH1, is essential for viral transcription in vivo and in vitro.
J. Virol.
69:7823-7834[Abstract].
|
| 23.
|
Morgan, C.
1976.
Vaccinia virus reexamined: development and release.
Virology
73:43-58[Medline].
|
| 24.
|
Morgan, C.,
S. Ellison,
H. Rose, and D. Moore.
1954.
Structure and development of viruses observed in the electron microscope. II. Vaccinia and fowl pox viruses.
J. Exp. Med.
100:301-310[Abstract].
|
| 25.
|
Moss, B., and E. N. Rosenblum.
1973.
Protein cleavage and poxvirus morphogenesis: tryptic peptide analysis of core precursors accumulated by blocking assembly with rifampicin.
J. Mol. Biol.
81:267-269[Medline].
|
| 26.
|
Moss, B.,
E. N. Rosenblum,
E. Katz, and P. M. Grimley.
1969.
Rifampicin: a specific inhibitor of vaccinia virus assembly.
Nature
224:1280-1284[Medline].
|
| 27.
|
Nagayama, A.,
B. G. T. Pogo, and S. Dales.
1970.
Biogenesis of vaccinia: separation of early stages from maturation by means of rifampicin.
Virology
40:1039-1051[Medline].
|
| 28.
|
Payne, L. G.
1980.
Significance of extracellular virus in the in vitro and in vivo dissemination of vaccinia virus.
J. Gen. Virol.
50:89-100[Abstract/Free Full Text].
|
| 29.
|
Rodríguez, D.,
M. Esteban, and J. R. Rodríguez.
1995.
Vaccinia virus A17L gene product is essential for an early step in virion morphogenesis.
J. Virol.
69:4640-4648[Abstract].
|
| 30.
|
Rodríguez, D.,
C. Risco,
J. R. Rodríguez,
J. L. Carrascosa, and M. Esteban.
1996.
Inducible expression of the vaccinia virus A17L gene provides a synchronized system to monitor sorting of viral proteins during morphogenesis.
J. Virol.
70:7641-7653[Abstract].
|
| 31.
|
Rodriguez, D.,
J. R. Rodriguez, and M. Esteban.
1993.
The vaccinia virus 14-kilodalton fusion protein forms a stable complex with the processed protein encoded by the vaccinia virus A17L gene.
J. Virol.
67:3435-3440[Abstract/Free Full Text].
|
| 32.
|
Rodriguez, J. F.,
E. Paez, and M. Esteban.
1987.
A 14,000-Mr envelope protein of vaccinia virus is involved in cell fusion and forms covalently linked trimers.
J. Virol.
61:395-404[Abstract/Free Full Text].
|
| 33.
|
Rodriguez, J. F., and G. L. Smith.
1990.
IPTG-dependent vaccinia virus: identification of a virus protein enabling virion envelopment by Golgi membrane and egress.
Nucleic Acids Res.
18:5347-5351[Abstract/Free Full Text].
|
| 34.
|
Rodriguez, J. R.,
C. Risco,
J. L. Carrascosa,
M. Esteban, and D. Rodriguez.
1997.
Characterization of early stages in vaccinia virus membrane biogenesis: implications of the 21-kilodalton protein and a newly identified 15-kilodalton envelope protein.
J. Virol.
71:1821-1833[Abstract].
|
| 35.
|
Roper, R.,
E. J. Wolffe,
A. Weisberg, and B. Moss.
1998.
The envelope protein encoded by the A33R gene is required for formation of actin-containing microvilli and efficient cell-to-cell spread of vaccinia virus.
J. Virol.
72:4192-4204[Abstract/Free Full Text].
|
| 36.
|
Salmons, T.,
A. Kuhn,
F. Wylie,
S. Schleich,
J. R. Rodriguez,
D. Rodriguez,
M. Esteban,
G. Griffiths, and J. K. Locker.
1997.
Vaccinia virus membrane proteins p8 and p16 are cotranslationally inserted into the rough endoplasmic reticulum and retained in the intermediate compartment.
J. Virol.
71:7404-7420[Abstract].
|
| 37.
|
Sanderson, C. M.,
F. Frischknecht,
M. Way,
M. Hollinshead, and G. L. Smith.
1998.
Roles of vaccinia virus EEV-specific proteins in intracellular actin tail formation and low pH-induced cell-cell fusion.
J. Gen. Virol.
79:1415-1425[Abstract].
|
| 38.
|
Schmelz, M.,
B. Sodeik,
M. Ericsson,
E. J. Wolffe,
H. Shida,
G. Hiller, and G. Griffiths.
1994.
Assembly of vaccinia virus: the second wrapping cisterna is derived from the trans Golgi network.
J. Virol.
68:130-147[Abstract/Free Full Text].
|
| 39.
|
Sefton, B. M.
1997.
Labeling cultured cells with 32Pi and preparing cell lysates for immunoprecipitation, unit 13.2.
In
J. E. Coligan, B. M. Dunn, H. L. Ploegh, D. W. Speicher, and P. T. Wingfield (ed.), Current protocols protein science. John Wiley & Sons, New York, N.Y.
|
| 40.
|
Sefton, B. M.
1997.
Phosphoamino acid analysis, unit 13.3.
In
J. E. Coligan, B. M. Dunn, H. L. Ploegh, D. W. Speicher, and P. T. Wingfield (ed.), Current protocols protein science. John Wiley & Sons, New York, N.Y.
|
| 41.
|
Sodeik, B.,
S. Cudmore,
M. Ericsson,
M. Esteban,
E. G. Niles, and G. Griffiths.
1995.
Assembly of vaccinia virus: incorporation of p14 and p32 into the membrane of the intracellular mature virus.
J. Virol.
69:3560-3574[Abstract].
|
| 42.
|
Sodeik, B.,
R. W. Doms,
M. Ericsson,
G. Hiller,
C. E. Machamer,
W. van't Hof,
G. van Meer,
B. Moss, and G. Griffiths.
1993.
Assembly of vaccinia virus: role of the intermediate compartment between the endoplasmic reticulum and the Golgi stacks.
J. Cell Biol.
121:521-541[Abstract/Free Full Text].
|
| 43.
|
Sodeik, B.,
G. Griffiths,
M. Ericsson,
B. Moss, and R. W. Doms.
1994.
Assembly of vaccinia virus: effects of rifampin on the intracellular distribution of viral protein p65.
J. Virol.
68:1103-1114[Abstract/Free Full Text].
|
| 44.
|
Stokes, G. V.
1976.
High-voltage electron microscope study of the release of vaccinia virus from whole cells.
J. Virol.
18:636-643[Abstract/Free Full Text].
|
| 45.
|
Takahashi, T.,
M. Oie, and Y. Ichihashi.
1994.
N-terminal amino acid sequences of vaccinia virus structural proteins.
Virology
202:844-852[Medline].
|
| 46.
|
Tartaglia, J.,
A. Piccini, and E. Paoletti.
1986.
Vaccinia virus rifampicin-resistance locus specifies a late 63,000 Da gene product.
Virology
150:45-54[Medline].
|
| 47.
|
Tooze, J.,
M. Hollinshead,
B. Reis,
K. Radsak, and H. Kern.
1993.
Progeny vaccinia and human cytomegalovirus particles utilize early endosomal cisternae for their envelopes.
Eur. J. Cell Biol.
60:163-178[Medline].
|
| 48.
|
Traktman, P.,
A. Caligiuri,
S. A. Jesty, and U. Sankar.
1995.
Temperature-sensitive mutants with lesions in the vaccinia virus F10 kinase undergo arrest at the earliest stage of morphogenesis.
J. Virol.
69:6581-6587[Abstract].
|
| 49.
|
Vanslyke, J. K.,
C. A. Franke, and D. E. Hruby.
1991.
Proteolytic maturation of vaccinia virus core proteins identification of a conserved motif at the N termini of the 4b and 25K virion proteins.
J. Gen. Virol.
72:411-416[Abstract/Free Full Text].
|
| 50.
|
Vanslyke, J. K.,
S. S. Whitehead,
E. M. Wilson, and D. E. Hruby.
1991.
The multistep proteolytic maturation pathway utilized by vaccinia virus P4a protein: a degenerate conserved cleavage motif within core proteins.
Virology
183:467-478[Medline].
|
| 51.
|
Wang, S., and S. Shuman.
1995.
Vaccinia virus morphogenesis is blocked by temperature-sensitive mutations in the F10 gene, which encodes protein kinase 2.
J. Virol.
69:6376-6388[Abstract].
|
| 52.
|
Ward, G. A.,
C. K. Stover,
B. Moss, and T. R. Fuerst.
1995.
Stringent chemical and thermal regulation of recombinant gene expression by vaccinia virus vectors in mammalian cells.
Proc. Natl. Acad. Sci. USA
92:6773-6777[Abstract/Free Full Text].
|
| 53.
|
Whitehead, S., and D. Hruby.
1994.
A transcriptionally controlled trans-processing assay: putative identification of a vaccinia virus-encoded proteinase which cleaves precursor protein P25K.
J. Virol.
68:7603-7608[Abstract/Free Full Text].
|
| 54.
|
Whitehead, W. S., and D. E. Hruby.
1994.
Differential utilization of a conserved motif for the proteolytic maturation of vaccinia virus proteins.
Virology
200:154-161[Medline].
|
| 55.
|
Wolffe, E. J.,
E. Katz,
A. Weisberg, and B. Moss.
1997.
The A34R glycoprotein gene is required for induction of specialized actin-containing microvilli and efficient cell-to-cell transmission of vaccinia virus.
J. Virol.
71:3904-3915[Abstract].
|
| 56.
|
Wolffe, E. J.,
D. M. Moore,
P. J. Peters, and B. Moss.
1996.
Vaccinia virus A17L open reading frame encodes an essential component of nascent viral membranes that is required to initiate morphogenesis.
J. Virol.
70:2797-2808[Abstract].
|
| 57.
|
Wolffe, E. J.,
A. S. Weisberg, and B. Moss.
1998.
Role for the vaccinia virus A36R outer envelope protein in the formation of virus-tipped actin-containing microvilli and cell-to-cell virus spread.
Virology
244:20-26[Medline].
|
| 58.
|
Zhang, Y., and B. Moss.
1992.
Immature viral envelope formation is interrupted at the same stage by lac operator-mediated repression of the vaccinia virus D13L gene and by the drug rifampicin.
Virology
187:643-653[Medline].
|
Journal of Virology, May 1999, p. 3534-3543, Vol. 73, No. 5
0022-538X/99/$04.00+0
This article has been cited by other articles:
-
Domi, A., Weisberg, A. S., Moss, B.
(2008). Vaccinia Virus E2L Null Mutants Exhibit a Major Reduction in Extracellular Virion Formation and Virus Spread. J. Virol.
82: 4215-4226
[Abstract]
[Full Text]
-
Hyun, J.-K., Coulibaly, F., Turner, A. P., Baker, E. N., Mercer, A. A., Mitra, A. K.
(2007). The Structure of a Putative Scaffolding Protein of Immature Poxvirus Particles as Determined by Electron Microscopy Suggests Similarity with Capsid Proteins of Large Icosahedral DNA Viruses. J. Virol.
81: 11075-11083
[Abstract]
[Full Text]
-
Xie, X., Xu, L., Yang, F.
(2006). Proteomic Analysis of the Major Envelope and Nucleocapsid Proteins of White Spot Syndrome Virus. J. Virol.
80: 10615-10623
[Abstract]
[Full Text]
-
Ojeda, S., Domi, A., Moss, B.
(2006). Vaccinia Virus G9 Protein Is an Essential Component of the Poxvirus Entry-Fusion Complex. J. Virol.
80: 9822-9830
[Abstract]
[Full Text]
-
Chung, C.-S., Chen, C.-H., Ho, M.-Y., Huang, C.-Y., Liao, C.-L., Chang, W.
(2006). Vaccinia Virus Proteome: Identification of Proteins in Vaccinia Virus Intracellular Mature Virion Particles. J. Virol.
80: 2127-2140
[Abstract]
[Full Text]
-
Ojeda, S., Senkevich, T. G., Moss, B.
(2006). Entry of Vaccinia Virus and Cell-Cell Fusion Require a Highly Conserved Cysteine-Rich Membrane Protein Encoded by the A16L Gene. J. Virol.
80: 51-61
[Abstract]
[Full Text]
-
Resch, W., Moss, B.
(2005). The Conserved Poxvirus L3 Virion Protein Is Required for Transcription of Vaccinia Virus Early Genes. J. Virol.
79: 14719-14729
[Abstract]
[Full Text]
-
Chiu, W.-L., Szajner, P., Moss, B., Chang, W.
(2005). Effects of a Temperature Sensitivity Mutation in the J1R Protein Component of a Complex Required for Vaccinia Virus Assembly. J. Virol.
79: 8046-8056
[Abstract]
[Full Text]
-
Resch, W., Weisberg, A. S., Moss, B.
(2005). Vaccinia Virus Nonstructural Protein Encoded by the A11R Gene Is Required for Formation of the Virion Membrane. J. Virol.
79: 6598-6609
[Abstract]
[Full Text]
-
Punjabi, A., Traktman, P.
(2005). Cell Biological and Functional Characterization of the Vaccinia Virus F10 Kinase: Implications for the Mechanism of Virion Morphogenesis. J. Virol.
79: 2171-2190
[Abstract]
[Full Text]
-
Chung, C.-S., Huang, C.-Y., Chang, W.
(2005). Vaccinia Virus Penetration Requires Cholesterol and Results in Specific Viral Envelope Proteins Associated with Lipid Rafts. J. Virol.
79: 1623-1634
[Abstract]
[Full Text]
-
da Fonseca, F. G., Weisberg, A. S., Caeiro, M. F., Moss, B.
(2004). Vaccinia Virus Mutants with Alanine Substitutions in the Conserved G5R Gene Fail To Initiate Morphogenesis at the Nonpermissive Temperature. J. Virol.
78: 10238-10248
[Abstract]
[Full Text]
-
Unger, B., Traktman, P.
(2004). Vaccinia Virus Morphogenesis: A13 Phosphoprotein Is Required for Assembly of Mature Virions. J. Virol.
78: 8885-8901
[Abstract]
[Full Text]
-
Ansarah-Sobrinho, C., Moss, B.
(2004). Vaccinia Virus G1 Protein, a Predicted Metalloprotease, Is Essential for Morphogenesis of Infectious Virions but Not for Cleavage of Major Core Proteins. J. Virol.
78: 6855-6863
[Abstract]
[Full Text]
-
Ansarah-Sobrinho, C., Moss, B.
(2004). Role of the I7 Protein in Proteolytic Processing of Vaccinia Virus Membrane and Core Components. J. Virol.
78: 6335-6343
[Abstract]
[Full Text]
-
Senkevich, T. G., Ward, B. M., Moss, B.
(2004). Vaccinia Virus Entry into Cells Is Dependent on a Virion Surface Protein Encoded by the A28L Gene. J. Virol.
78: 2357-2366
[Abstract]
[Full Text]
-
Szajner, P., Weisberg, A. S., Moss, B.
(2004). Evidence for an Essential Catalytic Role of the F10 Protein Kinase in Vaccinia Virus Morphogenesis. J. Virol.
78: 257-265
[Abstract]
[Full Text]
-
Szajner, P., Weisberg, A. S., Moss, B.
(2004). Physical and Functional Interactions between Vaccinia Virus F10 Protein Kinase and Virion Assembly Proteins A30 and G7. J. Virol.
78: 266-274
[Abstract]
[Full Text]
-
Husain, M., Moss, B.
(2003). Evidence against an Essential Role of COPII-Mediated Cargo Transport to the Endoplasmic Reticulum-Golgi Intermediate Compartment in the Formation of the Primary Membrane of Vaccinia Virus. J. Virol.
77: 11754-11766
[Abstract]
[Full Text]
-
Mercer, J., Traktman, P.
(2003). Investigation of Structural and Functional Motifs within the Vaccinia Virus A14 Phosphoprotein, an Essential Component of the Virion Membrane. J. Virol.
77: 8857-8871
[Abstract]
[Full Text]
-
Rziha, H.-J., Bauer, B., Adam, K.-H., Rottgen, M., Cottone, R., Henkel, M., Dehio, C., Buttner, M.
(2003). Relatedness and heterogeneity at the near-terminal end of the genome of a parapoxvirus bovis 1 strain (B177) compared with parapoxvirus ovis (Orf virus). J. Gen. Virol.
84: 1111-1116
[Abstract]
[Full Text]
-
Szajner, P., Jaffe, H., Weisberg, A. S., Moss, B.
(2003). Vaccinia Virus G7L Protein Interacts with the A30L Protein and Is Required for Association of Viral Membranes with Dense Viroplasm To Form Immature Virions. J. Virol.
77: 3418-3429
[Abstract]
[Full Text]
-
Doglio, L., De Marco, A., Schleich, S., Roos, N., Krijnse Locker, J.
(2002). The Vaccinia Virus E8R Gene Product: a Viral Membrane Protein That Is Made Early in Infection and Packaged into the Virions' Core. J. Virol.
76: 9773-9786
[Abstract]
[Full Text]
-
Risco, C., Rodriguez, J. R., Lopez-Iglesias, C., Carrascosa, J. L., Esteban, M., Rodriguez, D.
(2002). Endoplasmic Reticulum-Golgi Intermediate Compartment Membranes and Vimentin Filaments Participate in Vaccinia Virus Assembly. J. Virol.
76: 1839-1855
[Abstract]
[Full Text]
-
Heljasvaara, R., Rodriguez, D., Risco, C., Carrascosa, J. L., Esteban, M., Rodriguez, J. R.
(2001). The Major Core Protein P4a (A10L Gene) of Vaccinia Virus Is Essential for Correct Assembly of Viral DNA into the Nucleoprotein Complex To Form Immature Viral Particles. J. Virol.
75: 5778-5795
[Abstract]
[Full Text]
-
Wolffe, E. J., Weisberg, A. S., Moss, B.
(2001). The Vaccinia Virus A33R Protein Provides a Chaperone Function for Viral Membrane Localization and Tyrosine Phosphorylation of the A36R Protein. J. Virol.
75: 303-310
[Abstract]
[Full Text]
-
Yeh, W. W., Moss, B., Wolffe, E. J.
(2000). The Vaccinia Virus A9L Gene Encodes a Membrane Protein Required for an Early Step in Virion Morphogenesis. J. Virol.
74: 9701-9711
[Abstract]
[Full Text]
-
Betakova, T., Wolffe, E. J., Moss, B.
(2000). The Vaccinia Virus A14.5L Gene Encodes a Hydrophobic 53-Amino-Acid Virion Membrane Protein That Enhances Virulence in Mice and Is Conserved among Vertebrate Poxviruses. J. Virol.
74: 4085-4092
[Abstract]
[Full Text]
-
Afonso, C. L., Tulman, E. R., Lu, Z., Zsak, L., Kutish, G. F., Rock, D. L.
(2000). The Genome of Fowlpox Virus. J. Virol.
74: 3815-3831
[Abstract]
[Full Text]
-
Betakova, T., Moss, B.
(2000). Disulfide Bonds and Membrane Topology of the Vaccinia Virus A17L Envelope Protein. J. Virol.
74: 2438-2442
[Abstract]
[Full Text]
-
Derrien, M., Punjabi, A., Khanna, M., Grubisha, O., Traktman, P.
(1999). Tyrosine Phosphorylation of A17 during Vaccinia Virus Infection: Involvement of the H1 Phosphatase and the F10 Kinase. J. Virol.
73: 7287-7296
[Abstract]
[Full Text]