Previous Article | Next Article 
Journal of Virology, April 1999, p. 3258-3263, Vol. 73, No. 4
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Interaction of Gli2 with CREB Protein on DNA Elements in the Long
Terminal Repeat of Human T-Cell Leukemia Virus Type 1 Is Responsible
for Transcriptional Activation by Tax Protein
Shingo
Dan,
Akira
Tanimura, and
Mitsuaki
Yoshida*
Department of Cellular and Molecular Biology,
Institute of Medical Science, The University of Tokyo, Minato-ku,
Tokyo 108, Japan
Received 16 September 1998/Accepted 18 January 1999
 |
ABSTRACT |
The long terminal repeat (LTR) of human T-cell leukemia virus type
1 (HTLV-1) has two distinct DNA elements, one copy of TRE2S and three copies of a 21-bp sequence that respond to the viral trans-activator protein, Tax. Either multiple
copies of the 21-bp sequence or a combination of one copy each of TRE2S
and 21-bp sequence is required for efficient
trans activation by Tax. In the trans
activation of multiple copies of 21-bp sequence,
CREB/ATF protein plays an essential role in forming a complex
with Tax. To understand the role of TRE2S in trans
activation of one copy of 21-bp sequence, we examined protein binding
to the DNA elements by DNA affinity precipitation assay including Gli2
protein binding to TRE2S and CREB protein binding to 21-bp
sequence. Binding of CREB to a DNA probe containing both
elements, TRE2S-21bp probe, was dependent on Gli2 protein
under restricted conditions and was enhanced in a dose-dependent
fashion by the binding of Gli2 protein to the same probe.
Mutation in either element abolished the efficient binding of CREB. A
glutathione S-transferase fusion protein of a
fragment of Gli2 was able to bind to CREB. Therefore, Gli2-CREB
interaction on the DNA probe is proposed to stabilize CREB binding to
DNA. Tax can bind to CREB protein on the DNA; therefore, stabilization
of DNA binding of CREB results in more recruitment of Tax onto DNA.
Conversely, Tax increased the DNA binding of CREB, although it had
almost no effect on the binding of Gli2. These results suggest
that Gli2 binds to the DNA element and interacts with CREB, resulting
in more recruitment of Tax, which in turn stabilizes DNA binding of
CREB. Similar cooperation of the protein binding to TRE2S-21bp probe
was also observed in nuclear extract of an HTLV-1-infected T-cell line.
Consistent with the Gli2-CREB interaction on the DNA elements,
Tax-mediated trans activation was dependent on the size of
the spacer between TRE2S and 21-bp sequence. The effective sizes
of the spacer suggest that TRE2S in the LTR would cooperate with the
second and third copies of the 21-bp sequence and contribute to
trans activation of the viral gene transcription.
| |
INTRODUCTION |
Infection with human T-cell leukemia
virus type 1 (HTLV-1) (21, 33) is etiologically associated
with adult T-cell leukemia (34) and tropical spastic
paraparesis (10, 19). Patients with these diseases
have serum antibodies against HTLV-1 proteins, indicating persistent
expression of HTLV-1 in individuals. The mechanisms of the viral gene
expression and replication are thus important issues in understanding
its pathogenesis and possibly controlling the diseases.
Gene expression of retroviruses is regulated by cis elements
in the long terminal repeats (LTRs) at both termini of the proviral genome. HTLV-1, however, has a unique regulatory system to enhance its
own gene expression: HTLV-1 transcription is trans activated by its own product, Tax (4, 6, 25, 26), responding to three
repeats of 21-bp sequence in the LTR (7, 24), and TRE2S (18, 30, 31). Reconstitution experiments have revealed that at least two direct repeats of the 21-bp sequence alone are sufficient for efficient activation by Tax (7, 20, 24); however, one copy of the 21-bp sequence is activated only weakly. In the activation of multiple copies of the 21-bp sequence, Tax protein does not bind to
DNA directly but binds to CREB (cyclic AMP response element binding
protein), which specifically binds to the 21-bp sequence (27,
35). Tax, on the other hand, binds to CBP (CREB binding protein)
and forms a transcriptionally active complex, 21bp-CREB-Tax-CBP, without phosphorylation of CREB at the specific site (16, 17, 27,
35).
On the other hand, another element termed TRE2S was proposed to
contribute to trans activation induced by Tax
(1). However, the TRE2S element requires the 21-bp sequence
to respond to Tax protein (18, 30, 31); furthermore, TRE2S
alone was totally inactive even in its multiple form (30,
31). TRE2S, therefore, seems to have a unique property as an
enhancer, although enhancers are generally active in a multiple form.
As binding proteins for TRE2S sequence, the Gli2 family of
Gli-Krüppel family proteins with zinc finger motifs, including
four isoforms (
, 
, 
, and 
), was isolated (30).
The Gli2 proteins show high homology with Gli1 and Gli3 in their zinc
finger motifs (14, 22). The Gal4 fusion protein of Gli2
isoforms enhanced gene expression from a reporter carrying the
Gal4-binding site and the 21-bp sequence in the presence of Tax, but
not in the absence of Tax. These previous observations suggest that
binding of Gli2 to TRE2S is involved in Tax-mediated trans
activation cooperating with 21-bp sequence (31), implying
that another cellular signal may control HTLV-1 gene expression in
addition to that through 21-bp sequence.
To understand the mechanism of the cooperation between TRE2S and the
21-bp sequence in the LTR during trans activation induced by
Tax, we analyzed the binding of Gli2, CREB, and Tax to DNA elements by DNA affinity precipitation (DNAP) assay. We
demonstrated that Gli2 binding enhances the binding of CREB proteins to
DNA elements, which enables recruitment of more Tax on the DNA.
Interaction between Gli2 and CREB was also directly demonstrated
without DNA. Consistent with the Gli2-CREB interaction on the DNA
elements, the distance between TRE2S and 21-bp sequence affected the
trans activation induced by Tax protein. From these results,
we proposed that the binding of Gli2 to CREB bound to the respective
DNA element stabilizes the complex and enhances recruitment of Tax onto
the complex forming Gli2-CREB-Tax, and Tax in turn stabilizes the DNA
binding of CREB protein. These protein interactions of Gli2, CREB, and
Tax would be the mechanism of the trans activation of transcription in the presence of Tax.
| |
MATERIALS AND METHODS |
Cells and plasmids.
FL cells, a human amnion cell line, and
293T cells, an adenovirus-transformed human embryonic kidney cell line
carrying simian virus 40 large T antigen, were maintained in
Dulbecco's modified Eagle medium supplemented with 5% fetal calf
serum. Hut102 cells, a T-cell line infected with HTLV-1, were
maintained in RPMI 1640 with 10% fetal calf serum. A reporter plasmid,
pTK-Luc, containing a basic promoter of thymidine kinase which is
linked to the luciferase gene, and pUCdN55-CAT, carrying the promoter
region of HTLV-1 LTR, from which enhancers were deleted, were
previously described (31). Into these basic constructs,
TRE2S, consisting of 25 bp (31) and the 21-bp sequence, was
inserted, constructing pTRE2S-(n)-21bp-TK-Luc. pTRE2S-TK-Luc
and p21bp-TK-Luc were also constructed as controls. Another series with
the HTLV-1 promoter and chloramphenicol acetyltransferase (CAT),
dN55-CAT, was similarly constructed. Between the TRE2S sequence and the
21-bp sequence of these reporters, spacer sequences of specified length
(see Fig. 5) were inserted. Expression vectors, pCG-Tax (8),
pCG-d3 (27), pCG-Gli2 (30), and pHisT-pET (13), for bacterial expression were previously described.
Mutations in TRE2S and 21-bp sequence were as follows: TRE2S,
CCGGGAAGCCACCGGGAACCACCCA; TRE2M,
CCGGGAAGCCACCGGGAACAAATTA; 21-bp sequence,
AGGCGTTGACGACAACCCCTG; 21-M, AGGCGTACACGACAACCCCTG.
Transfection and assays for CAT and luciferase.
The reporter
and effector plasmids were transfected into 5 × 105
FL cells according to the calcium phosphate procedure, adjusting the
total DNA to 10 µg with salmon sperm DNA as described previously (6). For the expression of Tax, 0.05 µg of pCG-Tax was
cotransfected. After 40 h, cells were harvested and subjected to
assay for CAT or luciferase activity as described previously
(6). Under the conditions used, the activity was linearly
proportional to the incubation time and the protein concentration. The
assay was repeated at least twice to confirm reproducibility. CAT
activity was defined as percent acetylation of chloramphenicol per 100 µg of protein in 30 min at 37°C, and luciferase activity was
expressed as arbitrary units as previously described (6).
DNAP assay.
CREB and Tax used in the assays were
histidine-tagged proteins produced in Escherichia coli and
purified as described previously (13). Nuclear extracts
(NEs) of 293T cells and Hut102 cells were prepared according to
Dignam's method (3). The expression plasmid for Gli2 was
transfected into 293T cells by the calcium phosphate procedure
(7). After 48 h, cells were suspended in hypotonic
buffer (20 mM HEPES-NaOH [pH 7.9], 5 mM KCl, 0.5 mM MgCl2, 0.5 mM dithiothreitol [DTT], 1 mM
phenylmethylsulfonyl fluoride, 1 µg of aprotinin per ml, 1 µg of pepstatin per ml, 1 µg of leupeptin per ml) and homogenized
in a Dounce homogenizer. Nuclei were pelleted and extracted with a
high-salt buffer (20 mM HEPES-NaOH [pH 7.9], 25% [vol/vol]
glycerol, 500 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM
DTT, 1 mM phenylmethylsulfonyl fluoride, 1 µg of aprotinin
per ml, 1 µg of pepstatin per ml, 1 µg of leupeptin per ml). The
extract was dialyzed against a buffer (20 mM HEPES-NaOH [pH 7.9], 80 mM KCl, 0.5 mM MgCl2, 10 mM ZnSO4, 0.5 mM DTT).
DNA probes carrying TRE2S and/or the 21-bp sequence were generated by
PCR with biotinylated primers as described previously (27).
Typical DNAP assays were carried out in a total volume of 400 µl
basically as follows unless otherwise specified. DNA probe (10 ng) was
incubated at 25°C for 10 min with Gli2-containing NE (100 µg of
protein unless otherwise specified), His-CREB (20 ng), and/or His-Tax
(10 ng). DNA-protein complex was isolated by addition of Dynabeads
M-280-streptavidin (Dynal), and half or one-third of the isolated
complexes was subjected to each immunoblot analysis with rabbit
anti-Gli2 (31), anti-CREB (27), or anti-Tax antibodies (15). For the analysis with the HTLV-1-infected
T-cell line (Fig. 5), increased doses of the components were used: 200 µg of protein of NE and 20 ng of DNA probe; furthermore, total complexes isolated were applied to a single gel for immunoblot analysis. Therefore, the sensitivity of the experiments with infected cell lines was nearly 10-fold higher than that of those with
transfected cells The bands were visualized with protein A-conjugated
horseradish peroxidase and an enhanced chemiluminescence detection
system (Amersham Co. Ltd.). The density of each band was measured by scanning the film with BASTATION software (Fuji Film, Tokyo, Japan). The binding of proteins to DNA-protein complexes was dependent on the
dose of Gli2-containing NE and also of CREB, and thus the system
reflects the binding capacities of Gli2 and CREB proteins.
In vitro binding of glutathione S-transferase
(GST)
Gli2 to CREB.
An expression plasmid of the fusion protein,
GST-Gli2(1-521), was constructed by inserting an N-terminal
fragment of Gli2 cDNA that codes for amino acids 1 to 521 into a
vector, pGEX. pGEX-Gli2(1-521) was introduced into E. coli, and the production of GST-Gli2(1-521) was induced by
addition of 1 mM isopropyl--D-thiogalactoside (IPTG).
The cells were collected and lysed by sonication in phosphate-buffered saline containing Triton X-100. The lysates were mixed with
glutathione-conjugated Sepharose beads (Pharmacia, Piscataway, N.J.),
and the complexes were isolated. The GST-Gli2(1-521) conjugated
with the beads was then incubated with purified CREB protein as
previously described (12). The GST fusion proteins on the
beads were collected and subjected to immunoblot analysis with
anti-CREB antibody (27).
| |
RESULTS |
Cooperative DNA binding of Gli2 and CREB.
We have previously
reported that a combination of TRE2S and 21-bp sequence was
trans activated by Tax protein but either element alone was
not (30). The proteins that bind to TRE2S are Gli2 proteins
(30), new members of the Gli-Krüppel protein family related to the previously reported THP (31), and the
proteins that bind to 21-bp sequence are CREB/ATF (27). The
requirement for these two DNA elements in trans activation
induced by Tax protein suggests specific interaction of these proteins
bound to each element. To examine this possibility, DNA binding
capacities of Gli2 and CREB proteins were analyzed. As a protein source
of Gli2, a long isoform of Gli2, an NE of 293T cells transfected with Gli2 expression vector was used, since production of Gli2 in
E. coli was unsuccessful. A biotinylated DNA probe was
incubated with increasing doses of Gli2 and CREB, and then the
DNA-protein complexes were isolated by means of streptavidin
beads. The isolated complexes were analyzed by immunoblotting with
antibodies against Gli2 or CREB protein (Fig.
1).
View larger version (45K):
[in this window]
[in a new window]
|
FIG. 1.
Cooperative binding of Gli2 and CREB proteins to a
DNA probe carrying TRE2S and 21-bp sequence. (A) Effect of increasing
doses of Gli2 and CREB on their binding to TRE2S-21bp DNA. (B)
Mutational effect of DNA probes on the binding of Gli2 and CREB to
DNA elements. Biotinylated DNA probe was incubated with purified
His-CREB and an NE of 293T cells transfected with a Gli2 expression
vector (NE-Gli2) or untransfected cells (NE). DNA-protein complexes
were then isolated, the complexes were divided into two portions, and
each was separately subjected to immunoblot analysis with rabbit
anti-Gli2 or anti-CREB antibodies. The numbers 10 to 40 for NE-Gli2 or
60 to 100 for NE indicate total protein (micrograms) of each NE, and +1
and +3 for CREB roughly correspond to 20 and 50 ng of purified
His-CREB, respectively. Open and hatched boxes with arrows represent
TRE2S and 21-bp sequence, respectively, and those with asterisks
represent their mutants. Numbers at right show molecular mass in
kilodaltons.
|
|
When the DNA probes contained both TRE2S and 21-bp sequence,
increasing doses of Gli2
and CREB resulted in greater binding
of
the respective proteins to the DNA elements (Fig.
1A). The
results revealed that the assay system is dependent on the dose
of each
protein and thus reflects total binding capacities of
the proteins in
the system. NE of untransfected cells contained
Gli2 and CREB proteins;
however, no significant bindings of these
endogenous proteins were
observed (lane 1), probably due to their
low levels in the reaction
mixture. The binding of Gli2
was not
significantly affected by
increasing doses of CREB (lanes 4 to
6, 7 to 9, and 10 to 12), but the
binding of CREB was enhanced
by increasing doses of Gli2
(lanes 5, 8, and 11 and 6, 9, and
12). Furthermore, with a low dose of Gli2
(Fig.
1A, lanes 1 to
3), CREB did not bind to DNA at significant levels
under the conditions
used. Total protein in each reaction was adjusted
to 100 µg by
adding an NE of untransfected cells; therefore, these
observations
exclude any possible contribution of other endogenous
proteins
to the observed binding of CREB. We further suspected a
possibility
that Gli2
-induced proteins might be involved in the CREB
binding
through the TRE2S element. However, any other specific binding
protein was detected in addition to Gli2
by gel electrophoresis
of
DNA-protein complexes followed by silver staining (data not
shown).
Therefore, it is highly unlikely that any Gli2
-induced
protein
affected the DNA binding of CREB. We thus concluded that
there was
cooperative binding of Gli2
and CREB to the DNA
probe.
To substantiate the cooperative binding of Gli2
and CREB,
a mutation was introduced into either TRE2S or the 21-bp
sequence
(Fig.
1B). When a mutation was introduced into
TRE2S, both Gli2
and CREB no longer bound to the DNA (lanes 5 to 8).
On the other
hand, when the 21-bp sequence was mutated, the binding of
Gli2
was not affected significantly, but the binding of CREB was
markedly
reduced (lanes 9 to 12). Two DNA elements, therefore, are both
indispensable for the efficient binding of CREB to the DNA probe
in
cooperation with Gli2
.
The possible interaction of Gli2
with CREB without DNA was examined
with GST fusion protein of Gli2. A fragment of Gli2
(amino acids 1 to 521) fused to the GST domain was produced in
E. coli, purified, and used for the binding to CREB protein. As
shown in Fig.
2, CREB protein bound to
GST-Gli2
but not to the
GST domain alone. These observations
clearly indicate that Gli2
can bind to CREB without DNA motifs.
View larger version (36K):
[in this window]
[in a new window]
|
FIG. 2.
Binding of Gli2 fragment to CREB protein without DNA. A
GST fusion protein of a fragment of Gli2 containing amino acids 1 to
521 (asterisk) was incubated with CREB, and the complexes formed were
isolated with glutathione-Sepharose beads. The isolated proteins were
analyzed by immunoblotting with anti-CREB antibody.
|
|
Effects of Gli2 and CREB on association of Tax with DNA.
As
described above, Gli2 binding to TRE2S-21bp enhanced the
binding of CREB. Previously, CREB protein has been shown to recruit Tax
protein onto the repeated 21-bp elements, and Tax in turn stabilizes the CREB-DNA complex (27, 35). Therefore, we
examined the effect of Gli2 on recruitment of Tax onto TRE2S-21bp
probe. As shown in Fig. 3, the presence
of both Gli2 and CREB induced greater binding of Tax (Fig. 3A, subpanel
c, lane 8) than did the presence of either protein alone (Fig. 3, lanes
6 and 7). Since CREB binding was enhanced by Gli2 (Fig. 3A, subpanel b, lanes 2 and 4 and 6 and 8), it is conceivable that Gli2 bound to TRE2S
interacts with CREB, enhances CREB binding to DNA, and results in
greater recruitment of Tax. Furthermore, addition of Tax to the
binding system enhanced the binding of CREB to DNA (Fig. 3, lanes 2 and
4 and 6 and 8). The result was similar to the previous findings on
increased binding of CREB to multiple copies of 21-bp sequence in the
presence of Tax (2, 32, 35), therefore suggesting
stabilization of the DNA binding of CREB by Tax protein. The proposed
mechanism is further supported by examining a mutant of Tax. A mutant
of Tax that cannot bind to CREB (27), d3, was not
bound significantly to the DNA-protein complex even in the presence of
CREB (Fig. 3A, subpanel d, lanes 11 and 12). Consistent with these
observations, mutant d3 was completely inactive in
trans activation of gene expression directed by TRE2S-21bp
(Fig. 3B). These results suggest that recruitment of CREB and Tax onto
DNA elements by Gli2 binding and stabilization of the complex by Tax is
the mechanism of Tax-mediated trans activation of one copy
of the 21-bp element.
View larger version (24K):
[in this window]
[in a new window]
|
FIG. 3.
Binding of Gli2, CREB, and Tax to DNA probe and
trans activation of gene expression. (A) Cooperative binding
of Gli2 and CREB in the absence and presence of wild-type Tax (a to
c) or mutant d3 of Tax (d). Assays for DNA binding of
proteins were carried out as described for Fig. 1. Plus signs for Gli2,
CREB, and Tax or d3 represent roughly 100 µg of total NE
and 20 and 10 ng of purified protein, respectively. One-third each of
the isolated complexes was separately subjected to immunoblot analysis
with anti-Gli2, anti-CREB, or anti-Tax antibody. Numbers at right show
molecular mass in kilodaltons. (B) Tax-mediated trans
activation of gene expression directed by TRE2S and 21-bp
sequence. CAT activity is expressed as the ratio to that with reporter
alone without Tax or mutant d3 of Tax. Wt, wild type.
|
|
A noteworthy result is that Tax was detected in the DNA-protein complex
even without detectable binding of CREB (Fig.
3C,
lane 7). This result
suggests that Gli2 may be able to bind to
Tax. However, the
significance of the putative interaction is
not convincing because the
binding was variable from one assay
to another, suggesting a rather
weak
interaction.
Cooperative binding of Gli2, CREB, and Tax in vivo.
To
confirm the cooperative binding of Gli2, CREB, and Tax to DNA in
HTLV-1-infected cells, DNAP assay was carried out with an extract from
an HTLV-1-infected cell line, Hut102. The DNA probe with the 21-bp
sequence alone precipitated only low levels of CREB and Tax (Fig.
4, lane 1), as expected from the previous findings. The TRE2S probe alone precipitated Gli2 and a low level of
Tax but not CREB (lane 2). One might expect binding of CREB to the
TRE2S probe since CREB can bind to Gli2 without 21-bp sequence, as
shown in Fig. 2; however, CREB binding was not detectable in this assay
(lane 2), probably due to the low level of CREB protein in the NE used.
Mixed probes of the 21-bp sequence and TRE2S gave a pattern similar to
the sum of lanes 1 and 2 as expected (lane 3), indicating no
cooperation in the protein binding. However, when the DNA probe carried
both the 21-bp sequence and TRE2S, CREB and Tax proteins were
precipitated at much higher levels than with the mixed probes (4.1- and
6.0-fold, respectively) (lane 4). These increased levels of binding of
CREB and Tax on the DNA probe can be explained by the cooperation of
Gli2, CREB, and Tax on the DNA elements in HTLV-1-infected cells.
Although possible involvement of proteins other than Gli2 cannot be
ruled out rigorously in this type of experiment, the cooperative
binding of Gli2, CREB, and Tax that is observed in the
reconstituted system was strongly suggested also for naturally
infected T cells.
View larger version (32K):
[in this window]
[in a new window]
|
FIG. 4.
Binding of Gli2, CREB, and Tax proteins to TRE2S-21bp
DNA probe in NE of HTLV-1-infected cell line. The NE (200 µg of
protein) of Hut102 cells, an HTLV-1-infected T-cell line, was used for
a DNAP assay as described above for Fig. 1, but the total of the
DNA-protein complexes isolated was subjected to an immunoblot analysis
with a mixture of antibodies against Gli2, CREB, and Tax proteins. The
intensity of each band was estimated with BASTATION software (Fuji
Film), and the ratios to those with mixed probes of 21-bp sequence and
TRE2S are also indicated. ( ), too low for significant estimation.
Numbers at right show molecular mass in kilodaltons.
|
|
Spacing effect of TRE2S and 21-bp sequence on trans
activation.
TRE2S and three copies of the 21-bp sequence are
aligned in the LTR of HTLV-1 in the order 21bp-21bp-TRE2S-21bp
with spacers of 27, 25, and 29 bases (20, 23) (Fig.
5A). The distances between these elements
in the LTR are rather different from the 11-bp spacer in the constructs
used in these assays. Therefore, we examined the effect of the distance
between these two elements on the expression of the luciferase gene
from the reporter, pTRE2S-(n)-21bp-TK-Luc. Series of
reporters with various lengths of spacer were constructed (Fig. 5B) and
transfected into FL cells with or without Tax expression vector. The
luciferase activity expressed in the absence of Tax was relatively
constant among the reporters, but the activity in the presence of
Tax varied depending on the length of the spacer (Fig. 5C).
Similar results were also obtained with another promoter with CAT,
pTRE2S-(n)-21bp-dN55-CAT, which contained the HTLV-1 promoter region instead of thymidine kinase promoter and luciferase (data not shown). Therefore, the periodical effect of the spacer length
was not unique to the TK-Luc reporter. These results suggest that both
TRE2S and the 21-bp sequence are required in a stereospecific arrangement on the double-stranded DNA to allow the interaction of two
binding proteins, Gli2 and CREB.
View larger version (29K):
[in this window]
[in a new window]
|
FIG. 5.
(A) Alignment of Tax-responsive elements, 21-bp sequence
and TRE2S, in the LTR of HTLV-1. Hatched and open boxes with arrows are
21-bp sequence and TRE2S, respectively. (B) Size and sequence of the
spacer used for the assay described for panel C. (C) Effect of size of
spacer on trans activation induced by Tax.  and  ,
luciferase activity (104 units per microgram of protein) in
the absence or presence of Tax, respectively;  , the ratio of to
.  and  , fold activation by Tax with a reporter carrying
either 21-bp sequence or TRE2S alone, respectively. (D) Effect of
relative positions of, and spacers between, TRE2S and 21-bp sequence.
|
|
The results in Fig.
5C, on the other hand, show that the 29-bp
spacer between TRE2S and 21-bp sequence is active in responding
to Tax.
This clearly suggests that TRE2S and the third copy of
21-bp sequence
in the LTR are an active form in the
trans activation,
since
they are in the same order with 29-bp spacer as in the reporter
in Fig.
5B. However, the 25-bp sequence between the second copy
of 21-bp
sequence and TRE2S in the LTR does not fit the active
form in
Fig.
5C. The alignment of the elements in the reporter
was different
from that in the LTR; therefore, we next altered
the order of TRE2S and
21-bp sequence in the reporter construct.
The alteration with a 20-bp
spacer reduced the
trans activation
markedly. However,
extension of the spacer from 20 to 24 bp, which
is close to the size of
the 25-bp sequence in the LTR, almost
restored the activity (Fig.
5D).
These results support the idea
that the second copy of the 21-bp
sequence in the LTR also cooperates
with TRE2S in
trans activation.
| |
DISCUSSION |
The LTR of HTLV-1 has two types of cis-acting
transcriptional elements, TRE2S and the 21-bp sequence, that respond to
Tax. These elements are activated by Tax protein in either a
combination of multiple copies of the 21-bp sequence (7, 20,
24) or one copy each of TRE2S and 21-bp sequence (18, 30,
31). Analyzing the second system with TRE2S-21bp, we found
that Gli2 protein binds to TRE2S, enhances the binding of
CREB to DNA probe, and finally results in enhanced recruitment of Tax
on the DNA elements. The recruited Tax in turn stabilizes the DNA
binding of CREB. We propose that this would be a possible mechanism for the Tax-mediated trans activation of one copy of the 21-bp element.
One copy itself of 21-bp sequence is not an efficient target for the
binding of CREB protein, which is responsible for the trans
activation (27, 35), and is not efficiently trans
activated by Tax (7, 20, 24). However, when the probe has
21-bp sequence together with TRE2S, efficient binding of CREB to one
copy of the 21-bp sequence is achieved by the binding of Gli2 protein to TRE2S adjacent to the 21-bp sequence. Although Gli2 is able to bind
to CREB without DNA elements, Gli2 was unable to affect the CREB
binding to 21-bp sequence unless TRE2S was present in cis.
Therefore, interaction of Gli2 protein with CREB on the DNA elements
seems to play a role in increasing the binding of CREB. Because CREB
did not enhance Gli2 binding to DNA effectively, it is conceivable that
Gli2 binds stably to TRE2S and then interacts with CREB that is bound
unstably to the 21-bp sequence in cis.
The proposed interaction on the DNA between two proteins should be
specific, since TRE2S was unable to trans activate an
NF-
B binding site in a TRE2S-NF-B construct (31a).
The importance of the proposed interaction of Gli2 with CREB is
supported by the finding that Tax-mediated trans
activation depends on the distance between TRE2S and 21-bp
sequence. Probably, a certain distance and configuration of these
two elements are required for the efficient physical
interaction of the respective binding proteins.
One of the principles of the Tax-mediated trans activation
of 21-bp sequence, NF-B site, and SRE (serum responsive element) is
the indirect association of Tax with the DNA element through binding to
CREB/ATF (27, 35), NF-B family proteins (28, 29), and serum response factor (5, 27). In our system
with TRE2S-21bp, augmentation of CREB binding to DNA by Gli2 resulted in greater recruitment of Tax on the specific DNA. It was reported previously that Tax increased the binding of CREB to multiple copies of
21-bp sequence (2, 32); therefore, it is expected that CREB
binding to DNA is enhanced by Tax also in the system with
TRE2S-21bp. In fact, CREB binding was enhanced by Tax as well as Gli2
in the TRE2S-21bp system. The importance of CREB-Tax interaction
in the trans activation of TRE2S-21bp was also supported by
examination of a mutant of Tax; a mutant of Tax, d3, which cannot bind to CREB, was unable to bind to TRE2S-21bp DNA and also
unable to trans activate the transcription. Therefore, the principle of the trans activation of TRE2S-21bp would be the
same as that for the 21bp-21bp system. That is, Tax protein on CREB has
been proposed to recruit another transcription coactivator, CBP/p300,
independently from phosphorylation of CREB protein (16). The
cooperative binding of Gli2, CREB, and Tax proteins was also detected
in a nuclear extract of HTLV-1-infected T cells, suggesting the
cooperation of these proteins in vivo also.
It is reported that a protein in the same family as Gli2 interacts
with CREB/ATF on a specific DNA and regulates transcription: YY1, a
protein in the Gli-Krüppel protein family, interacts with CREB/ATF on the DNA elements and inhibits the expression of the c-fos gene (9, 11). This interaction was mediated
through the zinc finger motifs (amino acids 347 to 392) of YY1
(37). The interaction domain has 68% homology with the
corresponding region in the zinc finger motif (amino acids 152 to 197)
of Gli2. Therefore, the corresponding domain of Gli2 might interact
with CREB protein on the DNA. The inhibitory complex of
YY1-CREB/ATF on the DNA is disrupted by an adenovirus-transforming
protein, E1A (36), which is an activator of transcription of
specific genes. In our system, we found the stabilization of the
CREB-Tax complex to occur by adjacent binding of Gli2 to the DNA
elements and activation of the transcription. Apparently, the basic
strategies of the viral trans activation in these
systems are unrelated even though similar proteins are involved in the mechanisms.
It is established that multiple copies of the 21-bp sequence are
sufficient for the maximum trans activation by Tax protein. Therefore, three repeats of 21-bp sequence in the LTR could be responsible for trans activation. TRE2S in the LTR is
separated by 25 bp upstream from the second 21-bp sequence and by 29 bp downstream from the third 21-bp sequence. Our data indicate that both
spacers in the respective orientation are suitable for efficient trans activation and, therefore, suggest an active
contribution of the TRE2S element in Tax-induced activation of viral
gene expression. Therefore, Tax-mediated trans
activation described here is an alternative mechanism for the
activation of viral gene expression involving the binding of Gli2 and CREB.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Cellular and Molecular Biology, Institute of Medical Science,
University of Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo 108, Japan.
Phone: 81-3-5449-5275. Fax: 81-3-5449-5421. E-mail:
myoshi{at}ims.u-tokyo.ac.jp.
| |
REFERENCES |
| 1.
|
Brady, J.,
K. T. Jeang,
J. Duvall, and G. Khoury.
1987.
Identification of p40x-responsive regulatory sequences within the human T-cell leukemia virus type I long terminal repeat.
J. Virol.
61:2175-2181[Abstract/Free Full Text].
|
| 2.
|
Brauweiler, A.,
P. Garl,
A. A. Franklin,
H. A. Giebler, and J. K. Nyborg.
1995.
A molecular mechanism for human T-cell leukemia virus latency and Tax transactivation.
J. Biol. Chem.
270:12814-12822[Abstract/Free Full Text].
|
| 3.
|
Dignam, J. D.,
R. M. Lebovitz, and R. G. Roeder.
1983.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
11:1475-1489[Abstract/Free Full Text].
|
| 4.
|
Felber, B. K.,
H. Paskalis,
C. Kleinman-Ewing,
F. Wong-Staal, and G. N. Pavlakis.
1985.
The pX protein of HTLV-I is a transcriptional activator of its long terminal repeats.
Science
229:675-679[Abstract/Free Full Text].
|
| 5.
|
Fujii, M.,
H. Tsuchiya,
T. Chuhjo,
T. Akizawa, and M. Seiki.
1992.
Interaction of HTLV-I Tax1 with p67SRF causes the aberrant induction of cellular immediate early genes through CArG boxes.
Genes Dev.
6:2066-2076[Abstract/Free Full Text].
|
| 6.
|
Fujisawa, J.,
M. Seiki,
T. Kiyokawa, and M. Yoshida.
1985.
Functional activation of the long terminal repeat of human T-cell leukemia virus type I by a trans-acting factor.
Proc. Natl. Acad. Sci. USA
82:2277-2281[Abstract/Free Full Text].
|
| 7.
|
Fujisawa, J.,
M. Seiki,
M. Sato, and M. Yoshida.
1986.
A transcriptional enhancer sequence of HTLV-I is responsible for trans-activation mediated by p40 chi HTLV-I.
EMBO J.
5:713-718[Medline].
|
| 8.
|
Fujisawa, J.,
M. Toita,
T. Yoshimura, and M. Yoshida.
1991.
The indirect association of human T-cell leukemia virus tax protein with DNA results in transcriptional activation.
J. Virol.
65:4525-4528[Abstract/Free Full Text].
|
| 9.
|
Gedrich, R. W., and D. A. Engel.
1995.
Identification of a novel E1A response element in the mouse c-fos promoter.
J. Virol.
69:2333-2340[Abstract].
|
| 10.
|
Gessain, A.,
F. Barin,
J. C. Vernant,
O. Gout,
L. Maurs,
A. Calender, and G. de The.
1985.
Antibodies to human T-lymphotropic virus type-I in patients with tropical spastic paraparesis.
Lancet
ii:407-410.
|
| 11.
|
Gualberto, A.,
D. LePage,
G. Pons,
S. L. Mader,
K. Park,
M. L. Atchison, and K. Walsh.
1992.
Functional antagonism between YY1 and the serum response factor.
Mol. Cell. Biol.
12:4209-4214[Abstract/Free Full Text].
|
| 12.
|
Hirai, H.,
J. Fujisawa,
T. Suzuki,
K. Ueda,
M. Muramatsu,
A. Tsuboi,
N. Arai, and M. Yoshida.
1992.
Transcriptional activator Tax of HTLV-1 binds to the NF-kappa B precursor p105.
Oncogene
7:1737-1742[Medline].
|
| 13.
|
Hoffmann, A., and R. G. Roeder.
1991.
Purification of his-tagged proteins in non-denaturing conditions suggests a convenient method for protein interaction studies.
Nucleic Acids Res.
19:6337-6338[Free Full Text].
|
| 14.
|
Kinzler, K. W., and B. Vogelstein.
1990.
The GLI gene encodes a nuclear protein which binds specific sequences in the human genome.
Mol. Cell. Biol.
10:634-642[Abstract/Free Full Text].
|
| 15.
|
Kiyokawa, T.,
T. Kawaguchi,
M. Seiki, and M. Yoshida.
1985.
Association of the pX gene product of human T-cell leukemia virus type-I with nucleus.
Virology
147:462-465[Medline].
|
| 16.
|
Kwok, R. P.,
M. E. Laurance,
J. R. Lundblad,
P. S. Goldman,
H. Shih,
L. M. Connor,
S. J. Marriott, and R. H. Goodman.
1996.
Control of cAMP-regulated enhancers by the viral transactivator Tax through CREB and the co-activator CBP.
Nature
380:642-646[Medline].
|
| 17.
|
Laurance, M. E.,
R. P. Kwok,
M. S. Huang,
J. P. Richards,
J. R. Lundblad, and R. H. Goodman.
1997.
Differential activation of viral and cellular promoters by human T-cell lymphotropic virus-1 tax and cAMP-responsive element modulator isoforms.
J. Biol. Chem.
272:2646-2651[Abstract/Free Full Text].
|
| 18.
|
Marriott, S. J.,
I. Boros,
J. F. Duvall, and J. N. Brady.
1989.
Indirect binding of human T-cell leukemia virus type I tax1 to a responsive element in the viral long terminal repeat.
Mol. Cell. Biol.
9:4152-4160[Abstract/Free Full Text].
|
| 19.
|
Osame, M.,
K. Usuku,
S. Izumo,
N. Ijichi,
H. Amitani,
A. Igata,
M. Matsumoto, and M. Tara.
1986.
HTLV-1 associated myelopathy, a new clinical entity.
Lancet
i:1031-1032. (Letter.)
|
| 20.
|
Paskalis, H.,
B. K. Felber, and G. N. Pavlakis.
1986.
Cis-acting sequences responsible for the transcriptional activation of human T-cell leukemia virus type I constitute a conditional enhancer.
Proc. Natl. Acad. Sci. USA
83:6558-6562[Abstract/Free Full Text].
|
| 21.
|
Poiesz, B. J.,
F. W. Ruscetti,
A. F. Gazdar,
P. A. Bunn,
J. D. Minna, and R. C. Gallo.
1980.
Detection and isolation of type C retrovirus particles from fresh and cultured lymphocytes of a patient with cutaneous T-cell lymphoma.
Proc. Natl. Acad. Sci. USA
77:7415-7419[Abstract/Free Full Text].
|
| 22.
|
Ruppert, J. M.,
B. Vogelstein,
K. Arheden, and K. W. Kinzler.
1990.
GLI3 encodes a 190-kilodalton protein with multiple regions of GLI similarity.
Mol. Cell. Biol.
10:5408-5415[Abstract/Free Full Text].
|
| 23.
|
Seiki, M.,
S. Hattori,
Y. Hirayama, and M. Yoshida.
1983.
Human adult T-cell leukemia virus: complete nucleotide sequence of the provirus genome integrated in leukemia cell DNA.
Proc. Natl. Acad. Sci. USA
80:3618-3622[Abstract/Free Full Text].
|
| 24.
|
Shimotohno, K.,
M. Takano,
T. Teruuchi, and M. Miwa.
1986.
Requirement of multiple copies of a 21-nucleotide sequence in the U3 regions of human T-cell leukemia virus type I and type II long terminal repeats for trans-acting activation of transcription.
Proc. Natl. Acad. Sci. USA
83:8112-8116[Abstract/Free Full Text].
|
| 25.
|
Sodroski, J.,
C. Rosen,
W. C. Goh, and W. Haseltine.
1985.
A transcriptional activator protein encoded by the x-lor region of the human T-cell leukemia virus.
Science
228:1430-1434[Abstract/Free Full Text].
|
| 26.
|
Sodroski, J. G.,
C. A. Rosen, and W. A. Haseltine.
1984.
Trans-acting transcriptional activation of the long terminal repeat of human T lymphotropic viruses in infected cells.
Science
225:381-385[Abstract/Free Full Text].
|
| 27.
|
Suzuki, T.,
J. I. Fujisawa,
M. Toita, and M. Yoshida.
1993.
The trans-activator tax of human T-cell leukemia virus type 1 (HTLV-1) interacts with cAMP-responsive element (CRE) binding and CRE modulator proteins that bind to the 21-base-pair enhancer of HTLV-1.
Proc. Natl. Acad. Sci. USA
90:610-614[Abstract/Free Full Text].
|
| 28.
|
Suzuki, T.,
H. Hirai,
J. Fujisawa,
T. Fujita, and M. Yoshida.
1993.
A trans-activator Tax of human T-cell leukemia virus type 1 binds to NF-kappa B p50 and serum response factor (SRF) and associates with enhancer DNAs of the NF-kappa B site and CArG box.
Oncogene
8:2391-2397[Medline].
|
| 29.
|
Suzuki, T.,
H. Hirai, and M. Yoshida.
1994.
Tax protein of HTLV-1 interacts with the Rel homology domain of NF-kappa B p65 and c-Rel proteins bound to the NF-kappa B binding site and activates transcription.
Oncogene
9:3099-3105[Medline].
|
| 30.
|
Tanimura, A.,
S. Dan, and M. Yoshida.
1998.
Cloning of novel isoforms of the human Gli2 oncogene and their activities to enhance tax-dependent transcription of the human T-cell leukemia virus type 1 genome.
J. Virol.
72:3958-3964[Abstract/Free Full Text].
|
| 31.
|
Tanimura, A.,
H. Teshima,
J. Fujisawa, and M. Yoshida.
1993.
A new regulatory element that augments the Tax-dependent enhancer of human T-cell leukemia virus type 1 and cloning of cDNAs encoding its binding proteins.
J. Virol.
67:5375-5382[Abstract/Free Full Text].
|
| 31a.
| Tanimura, A., and M. Yoshida. Unpublished
observations.
|
| 32.
|
Yin, M. J., and R. B. Gaynor.
1996.
Complex formation between CREB and Tax enhances the binding affinity of CREB for the human T-cell leukemia virus type 1 21-base-pair repeats.
Mol. Cell. Biol.
16:3156-3168[Abstract].
|
| 33.
|
Yoshida, M.,
I. Miyoshi, and Y. Hinuma.
1982.
Isolation and characterization of retrovirus from cell lines of human adult T-cell leukemia and its implication in the disease.
Proc. Natl. Acad. Sci. USA
79:2031-2035[Abstract/Free Full Text].
|
| 34.
|
Yoshida, M.,
M. Seiki,
K. Yamaguchi, and K. Takatsuki.
1984.
Monoclonal integration of human T-cell leukemia provirus in all primary tumors of adult T-cell leukemia suggests causative role of human T-cell leukemia virus in the disease.
Proc. Natl. Acad. Sci. USA
81:2534-2537[Abstract/Free Full Text].
|
| 35.
|
Zhao, L. J., and C. Z. Giam.
1992.
Human T-cell lymphotropic virus type I (HTLV-I) transcriptional activator, Tax, enhances CREB binding to HTLV-I 21-base-pair repeats by protein-protein interaction.
Proc. Natl. Acad. Sci. USA
89:7070-7074[Abstract/Free Full Text].
|
| 36.
|
Zhou, Q., and D. A. Engel.
1995.
Adenovirus E1A243 disrupts the ATF/CREB-YY1 complex at the mouse c-fos promoter.
J. Virol.
69:7402-7409[Abstract].
|
| 37.
|
Zhou, Q.,
R. W. Gedrich, and D. A. Engel.
1995.
Transcriptional repression of the c-fos gene by YY1 is mediated by a direct interaction with ATF/CREB.
J. Virol.
69:4323-4330[Abstract].
|
Journal of Virology, April 1999, p. 3258-3263, Vol. 73, No. 4
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Grant, C., Jain, P., Nonnemacher, M., Flaig, K. E., Irish, B., Ahuja, J., Alexaki, A., Alefantis, T., Wigdahl, B.
(2006). AP-1-directed human T cell leukemia virus type 1 viral gene expression during monocytic differentiation. J. Leukoc. Biol.
80: 640-650
[Abstract]
[Full Text]
-
Cote-Velez, A, Perez-Martinez, L, Diaz-Gallardo, M Y, Perez-Monter, C, Carreon-Rodriguez, A, Charli, J-L, Joseph-Bravo, P
(2005). Dexamethasone represses cAMP rapid upregulation of TRH gene transcription: identification of a composite glucocorticoid response element and a cAMP response element in TRH promoter. J Mol Endocrinol
34: 177-197
[Abstract]
[Full Text]
-
Hiraiwa, N., Yabuta, T., Yoritomi, K., Hiraiwa, M., Tanaka, Y., Suzuki, T., Yoshida, M., Kannagi, R.
(2003). Transactivation of the fucosyltransferase VII gene by human T-cell leukemia virus type 1 Tax through a variant cAMP-responsive element. Blood
101: 3615-3621
[Abstract]
[Full Text]
-
Smith, M. J., Gitlin, S. D., Browning, C. M., Lane, B. R., Clark, N. M., Shah, N., Rainier, S., Markovitz, D. M.
(2001). GLI-2 Modulates Retroviral Gene Expression. J. Virol.
75: 2301-2313
[Abstract]
[Full Text]
Top
Abstract
Introduction
