INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Hepatitis B virus (HBV) is a small DNA virus with a partially double-stranded 3.2-kb genome. The genome organization of HBV is very compact, with four overlapping open reading frames coding for the surface, core, polymerase, and X proteins. The transcription of these open reading frames is under the control of four promoters: two for surface, one for core and polymerase, and one for X. Two enhancers, enhancer I and enhancer II, play important roles in the transcription regulation of these viral genes. The core promoter is composed of the basal core promoter and its upstream regulatory sequence (70). This promoter produces two 3.5-kb RNAs, i.e., the precore and pregenomic RNAs. Pregenomic RNA has dual functions: (i) it can be packaged into nucleocapsids (core particles) along with viral polymerase and serve as the template for reverse transcription, and (ii) it can serve as mRNA that encodes the core and polymerase proteins. Regulated expression of pregenomic RNA plays a pivotal role in the control of the viral replication cycle. A detailed understanding of the transcription control of viral genes may reveal new targets for therapeutic intervention.

The second enhancer of HBV has a unique bipartite structure in that the cooperation of two noncontiguous elements, box  and box , is required for its enhancer function. It stimulates the transcriptional activity of the simian virus 40 (SV40) early promoter and the HBV surface and X promoters (67, 68). The second enhancer is colocalized with the core upstream regulatory sequence (CURS). Box , for example, is not only an essential component of the second enhancer but also a potent stimulatory element of the CURS. In other words, box  can activate the basal core promoter from an upstream position in differentiated human hepatoma cell lines (HepG2 and HuH-7) (69, 70). A negative regulatory element, designated NRE, which represses the activities of enhancer II and the core promoter, was identified upstream of the CURS (44). The core promoter provides a valuable system to study the positive and negative transcription regulation of eukaryotic promoters.

Transcription regulation is governed by a constellation of trans-acting cellular factors that bind to specific cis-acting elements that act in either a positive or negative manner. Transcription initiation by RNA polymerase II involves a stepwise assembly of general transcription factors or a holoenzyme on a promoter template to form a preinitiation complex. Transcription activators may stimulate transcription by increasing the assembly of a preinitiation complex. Several distinct models have been proposed as the mechanism of transcription repression (20, 21, 24, 25, 29, 42, 52). In the competition model, repressors may bind directly at or near a transcription start site and compete with the formation of a preinitiation complex in the promoter. Alternatively, activators and repressors may compete for overlapping or closely linked binding sites. In the activator-sequestering model, repressors stoichiometrically bind to particular activators through protein-protein interactions, leading to the formation of complexes with reduced or no DNA binding activity. In the quenching model, repressors and activators may bind to adjacent, nonoverlapping DNA sequences, but the repressors neutralize the ability of the activators to transmit stimulatory signals to the basal transcription machinery. In the fourth model, direct repression, repressors may bind to any of the basal transcription factors, with RNA polymerase II itself, or with a corepressor that ultimately targets the basal machinery. Such interaction may interfere with the formation or the activity of the basal transcription preinitiation complex.

We have previously shown that C/EBP-like proteins can bind to box . C/EBPs (CCAAT/enhancer binding proteins) are a family of highly conserved, leucine zipper-type (bZIP) DNA binding proteins. Members identified so far are C/EBP, C/EBP (also known as NF-IL6, CRP2, LAP, and AGP/EBP), C/EBP (also known as NF-IL6 and CRP3), C/EBP, CRP1, Ig-C/EBP, and GADD153 (also known as CHOP) (1, 5, 6, 15, 31, 32, 36, 53, 54, 65). Different C/EBP family members are characterized by a high degree of sequence homology in the leucine zipper and basic regions. They have, however, much less conserved N-terminal regulatory and transactivation domains (5, 35). C/EBPs have the potential to form homo- and heterodimers with C/EBP family members or bZIP proteins or to interact with proteins that do not contain leucine zippers. Dimerization of C/EBPs is generally required for their DNA binding and transcription activation function (3, 10, 16, 18, 26, 33, 34, 37-41, 45, 46, 48, 58-65).

In this paper, we describe the cloning and characterization of a box  binding protein, E4BP4. Overexpression of E4BP4 represses the stimulating activity of box  in the CURS and the second enhancer. E4BP4 can also repress the transcription of HBV genes and the production of HBV virions in a transient-transfection system. Overexpression of an E4BP4 antisense transcript, on the other hand, can elevate the transcription of the core promoter. Though present in low abundance, E4BP4 can bind to the box  sequence with higher affinity than the box  binding activity present in nuclear extracts. Evidence that binding site occlusion is most likely the mechanism whereby E4BP4 suppresses transcription in HBV is presented.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Isolation of cDNA clones. A ZAPII cDNA library (prepared from Stratagene's ZAP cDNA synthesis kit) of human hepatoma HepG2 cells was screened with concatemerized double-stranded synthetic oligonucleotides of box  by the method of Singh (57). The oligonucleotides contained the box  sequence gatCCAAGGTCTTACATAAGAGGACTCTT and its complement, which corresponded to the box  sequence extending from nucleotide (nt) 1644 to 1669 of HBV plus an MboI 5' overhang. The oligonucleotides were concatemerized to ~500 bp in size with T4 polynucleotide kinase and T4 DNA ligase and labeled with [-³²P]dCTP by random prime labeling. All positive plaques were picked, replated, and clonally purified through secondary and tertiary screenings. cDNA inserts from positive clones were excised in the form of pBluescript plasmid (pSKP4) by coinfection with helper phage. DNA sequences were determined by dideoxy chain termination methods.

Plasmids. The HBV sequence used in the study is of the adw subtype. Numbering of the HBV sequence begins at the unique EcoRI site, which is nt 1. All reporter plasmids used in transfection experiments contain a head-to-tail trimeric tandem repeat, referred to as A3, of a 237-bp BclI-BamHI fragment from the SV40 polyadenylation signal. A3 is placed 5' of promoter sequences of interest and has been shown to stop transcription readthrough from spurious upstream initiation.

Bacterial fusion proteins. The E4BP4 expression construct pXa-2-P4 was used to express biotinylated fusion proteins in strain JM109. JM109 cells harboring E4BP4 vectors were grown to log phase and induced with 100 µM isopropyl--D-thiogalactopyranoside (IPTG) (Sigma). Six hours following induction, the bacteria were centrifuged and lysed in 1 mg of lysozyme per ml-0.1% Triton X-100-200 U of DNase. The lysates were then clarified by centrifugation at 10,000 × g for 15 min at 4°C and mixed with avidin resin (Promega). Following a 6-h incubation, the resin was washed three times in cold buffer (50 mM Tris-HCl, 4 mM dithiothreitol [DTT], 2 mM EDTA, 10% glycerol). If the fusion protein was to be eluted, the pelleted resin was washed with buffer containing 5 mM biotin. The eluent was aliquoted, quickly frozen under liquid nitrogen, and kept frozen at 70°C.

Preparation of anti-E4BP4 polyclonal antibody. Rabbits were immunized with a 16-amino-acid peptide corresponding to amino acids 446 to 461 of E4BP4. After three booster injections with conjugated peptide (the carrier protein was keyhole limpet hemocyanin or bovine serum albumin), rabbit sera were tested for reactivity with E4BP4 by immunoprecipitation and Western blotting.

Cell lines, transfection, and CAT assay. The culture and transfection of human hepatoma cell lines HepG2 and HuH-7 were performed as previously described (7). All plasmids used in one set of experiments were simultaneously prepared, checked for supercoiled forms, aliquoted in small amounts, and stored in 70% ethanol. Each set of experiments was performed with two different preparations of plasmids and repeated two to three times for each preparation. The chloramphenicol acetyltransferase (CAT) activity was normalized against the CAT activity exhibited by a control plasmid, pSV2CAT, which was taken as 100%. In pSV2CAT, the expression of the CAT gene is driven by the SV40 early promoter and 72-bp enhancer. When the CAT activity was high, assays were performed on serially diluted cell lysates to ensure that CAT activity fell in a linear range for all assays.

Preparation and heparin-Sepharose fractionation of nuclear extracts. Fractionated nuclear extracts from differentiated human hepatoma cell lines HepG2 and HuH-7 were prepared as previously described (8, 68). The crude and fractionated nuclear extracts were aliquoted, quickly frozen under liquid nitrogen, and kept frozen at 70°C.

Preparation of mini-nuclear extracts from transfected cells. Mini-nuclear extracts were prepared by the method of Schreiber et al. (56). HuH-7 cells were transiently transfected with pFLAG-CMV2, pf:E4BP4, and expression plasmids containing deletion mutants of f:E4BP4 by the calcium phosphate precipitation method. Forty-eight hours later, transfected HuH-7 cells were collected, washed with Tris-buffered saline (TBS) (10 mM Tris-HCl [pH 7.45] and 150 mM NaCl), and pelleted by centrifugation at 1,500 × g for 5 min. The cell pellet was resuspended in TBS, transferred into an Eppendorf tube, and pelleted again by being spun for 20 s in a microcentrifuge. TBS was removed, and the cell pellet was resuspended in cold buffer A (10 mM HEPES [pH 7.9], 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, and 0.5 mM phenylmethylsulfonyl fluoride) by gentle pipetting. The cells were allowed to swell on ice for 15 min, after which a 10% solution of Nonidet P-40 was added and the tube was vigorously vortexed for 10 s. The homogenate was centrifuged for 30 s in a microcentrifuge. The nuclear pellet was resuspended in ice-cold buffer C (20 mM HEPES [pH 7.9], 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, and 1 mM phenylmethylsulfonyl fluoride), and the tube was vigorously rocked at 4°C for 15 min on a shaking plate. The nuclear extract was centrifuged for 5 min in a microcentrifuge at 4°C, and the supernatant was aliquoted, quickly frozen under liquid nitrogen, and kept frozen at 70°C.

Gel shift analysis. The probe was prepared with annealed double-stranded oligonucleotide (100 ng) corresponding to the box  sequence of HBV (Fig. 1A) and end labeled with [-³²P]ATP and T4 polynucleotide kinase. Gel shifting and competition experiments were done as previously described (68) except that 5 instead of 10 µg of nuclear extract was used (68). Supershifts were generated with anti-E4BP4 antiserum, anti-FLAG M2 monoclonal antibody (Kodak), or anti-C/EBP polyclonal antibody for C/EBP, C/EBP, or C/EBP (Santa Cruz Biotechnology, Santa Cruz, Calif.).

View larger version (61K): [in this window] [in a new window]   FIG. 1.   Binding specificity of recombinant E4BP4 protein. (A) Summary of the oligonucleotide sequences of wild-type box  nt 1636 to 1668 [WT(36)] and 1646 to 1668 [WT(46)] and mutants AB, CD, EF, GH, IJ, and YZ and their binding activities toward recombinant E4BP4. In the WT(36) oligonucleotide, the lowercase letters represent the sequence which is different from the HBV sequence. In mutants, the lowercase letters represent the mutated nucleotides. (B) Competition of binding of recombinant E4BP4 protein to wild-type box  sequence [WT(36)] by wild-type box  sequence [either WT(36) or WT(46)] or six box  mutants in gel shift assays. Recombinant E4BP4 protein was first incubated with competing cold oligonucleotides in molar excess and then tested for its binding to labeled WT36 probe. Lane 1, labeled WT(36) probe with no protein; lane 2: labeled WT(36) probe with recombinant E4BP4 protein but no competitor; lanes 3 to 20, labeled WT(36) probe with recombinant E4BP4 protein and different unlabeled competitors at various molar excesses as indicated. HNF1 is a nonspecific competitor.

Northern blotting. Total cellular RNA was prepared from HepG2 cells, HuH-7 cells, or transfected HuH-7 cells with the RNAzol B kit (Cinna/Tiotecx Laboratories, Inc., Houston, Tex.). Twenty or 40 µg of total cellular RNA was electrophoretically separated on a 1% formaldehyde-agarose gel and transferred to a Hybond nylon membrane (Amersham). In addition, nitrocellulose filters containing approximately 2 µg of poly(A)⁺ RNAs from 16 different adult human tissues (Clontech, Palo Alto, Calif.) were used for Northern analysis. These membranes were hybridized with a ³²P-random-prime-labeled 554-bp EcoRI fragment of the E4BP4 cDNA probe or 1,960-bp PstI fragment of the HBV DNA probe and washed at a high stringency under standard conditions. These blots were exposed to Fuji X-ray film at 70°C with an intensifying screen. The signals were normalized by hybridization with a probe for the -actin or glyceraldehyde-3-phosphate dehydrogenase (G3PDH) gene followed by quantitation with a Molecular Dynamics PhosphorImager.

Assay for endogenous DNA polymerase activity. To assay for endogenous DNA polymerase activity, the culture supernatant was collected 3 days after transient transfection, treated with 1% Nonidet P-40 for 4 h at room temperature, and centrifuged at 17,000 × g for 30 min at 4°C. The supernatant was then centrifuged at 227,000 × g for 1 h at 4°C. The pellet from the second centrifugation, which contains HBV viral core particles, was resuspended in TNE buffer (10 mM Tris-HCl [pH 7.5], 50 mM NaCl, and 0.1 mM EDTA) and assayed for endogenous polymerase activity as previously described (70).

Western blotting. HuH-7 cells were transfected with pFLAG-CMV2, pf:E4BP4, and plasmids containing deletion mutants of f:E4BP4. After 48 h, cells were collected and lysed in Laemmli sample buffer at 95°C for 10 min. Proteins were separated by electrophoresis through a 10 or 12.5% polyacrylamide gel, transferred onto a Hybond (Amersham) enhanced chemiluminescence (ECL) nitrocellulose membrane, and probed with 6 µg of monoclonal anti-FLAG antibody (Kodak) per ml or with a 1,000× dilution of polyclonal anti-E4BP4 antibody. Blots were incubated with anti-rabbit or anti-mouse immunoglobulin G (IgG)-horseradish peroxidase conjugate (Promega), and immunoreactive proteins were visualized with 4-chloro-1-naphthol (Sigma) or by using the ECL system (Amersham).

Immunofluorescence. HuH-7 cells cultured on Chamber Slides (Nunc) were transfected with pFLAG-CMV2, pf:E4BP4, and plasmids containing deletion mutants of f:E4BP4. Following washing in phosphate-buffered saline (PBS), the cells were fixed with 2% formaldehyde in PBS for 20 min at room temperature, permeabilized by expoure to cold acetone for 3 min, and washed once with PBS. The permeabilized cells were detected with 6 µg of monoclonal anti-FLAG antibody (Kodak) per ml for 1 h and then with fluorescein isothiocyanate-conjugated goat anti-mouse IgG (Cappel) and 0.1 µg of Hoechst 33258 per ml in 1% bovine serum albumin-PBS for 1 h at room temperature. Finally, the cells were washed three times with PBS and examined by fluorescence microscopy.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

E4BP4 as a box  binding protein. To search for the box  binding protein(s), we screened a cDNA library made from a differentiated human hepatoma cell line, HepG2, with labeled concatemers of the box  sequence. A cDNA which was identical to that of a previously described transcription factor, E4BP4 (also named NF-IL3A), was obtained. A member of the bZIP family, E4BP4 has been identified as a binding protein for a variety of promoters, including the ATF site in the E4 promoter of adenovirus, the CRE/ATF-like site of the interleukin-1 (IL-1) promoter, the gamma interferon promoter, and the A site of the IL-3 promoter (11, 12, 27, 71). E4BP4 contains 462 amino acids. The bZIP domain of E4BP4 is located in the N-terminal region of the protein (see Fig. 6A). E4BP4 has been shown to function as a dimer (12).

View larger version (35K): [in this window] [in a new window]   FIG. 2.   DNA binding specificity of overexpressed E4BP4. HuH-7 cells at a density of 1.1 × 107 cells per 15-cm-diameter plate were untransfected (un) or transfected with 62.5 µg of pFLAG-CMV2 (flag) or pf:E4BP4 as indicated. Mini-nuclear extracts were prepared as described in Materials and Methods. (A) E4BP4 expression in transfectants determined by Western blot analysis. Mini-nuclear extracts (20 µg per lane) were used for Western blot analysis, with 1,000× dilutions of anti-E4BP4 (lanes 1 to 3) and preimmune serum (lanes 4 to 6), 6 µg of anti-FLAG ( flag) antibody per ml (lanes 7-9), and 10 µg of anti-HA antibody per ml (lanes 10 to 12). Immunoreactive proteins were visualized with 4-chloro-1-naphthol. (B) Binding of E4BP4 to the box  sequence. Five micrograms of mini-nuclear extracts was incubated with 105 cpm of labeled box  probe [WT(36)] in gel shift experiments. The sources of nuclear extracts are indicated. For supershift experiments, 1 µl of preimmune serum (lane 5) or anti-E4BP4 (lane 6) or 3 µg of anti-FLAG antibody (lane 11) was added. (C) DNA binding specificity of E4BP4. Five micrograms of mini-nuclear extracts was incubated with the labeled wild-type box  probe [WT(36)] in the presence of unlabeled WT(36) or different mutant competitors at various molar excesses as indicated.

Repression of the transcription stimulation effect of box  by E4BP4. We have previously shown that a single copy of the box  sequence in an upstream position stimulates the transcription of the HBV basal core promoter in both HepG2 and HuH-7 cells (68). To examine the effect of E4BP4 on box , the reporter plasmid p/BCP-CAT was cotransfected with pf:E4BP4 or pFLAG-CMV2 vector in HepG2 and HuH-7 cells. p/BCP-CAT contains a CAT reporter gene, driven by the HBV basal core promoter, which is preceded by an upstream box  sequence. Increasing amounts of E4BP4 expression plasmids were cotransfected with the reporter plasmid. The expression level of f:E4BP4 and the transcriptional activity of the basal core promoter as measured by CAT assays were determined (Fig. 3). Coexpression of E4BP4 reduced the CAT activity by 35- and 14-fold in HepG2 and HuH-7 cells, respectively (Fig. 3). Cotransfection with pFLAG-CMV2, which had no insert, had no significant effect. It is worth noting that the suppression by E4BP4 was observed with the expression of E4BP4 at a very low level (data not shown). Since the promoter activity of the basal core promoter (pBCP-CAT) is already very low, it is difficult to examine the effect of E4BP4 on the basal core promoter directly. To circumvent this problem, we placed another positive element from the CURS upstream of the basal core promoter instead of box . This reporter plasmid, p(1687-1851)CAT, contained an extra sequence from nt 1687 to 1743 in addition to the basal core promoter. E4BP4 decreased the activity of p(1687-1851)CAT by threefold (Fig. 4). Weak suppression of the basal promoter by E4BP4 has been previously noted (12). Taken together, these data indicated that E4BP4 suppressed the transcription-stimulatory activity of the basal core promoter mediated by box .

View larger version (34K): [in this window] [in a new window]   FIG. 3.   Repression of the box  activity by E4BP4. HuH-7 (lanes 1 to 14) and HepG2 (lanes 15 to 28) cells were transfected with 8 µg of pBCP-CAT only (lanes 1 and 15), 8 µg of p/BCP-CAT only (lanes 2 and 16), 8 µg of p/BCP-CAT plus 31.2, 62.5, 125, 250, 500, or 1,000 ng of pf:E4BP4 (lanes 3 to 8 and 17 to 22, respectively), or 8 µg of p/BCP-CAT plus 31.2, 62.5, 125, 250, 500 or 1,000 ng of pFLAG-CMV2 (lanes 9 to 14 and 23 to 28, respectively). The cell densities for HuH-7 and HepG2 cells were 1.5 × 106 and 2.8 × 106 per 5-cm-diameter plate, respectively. The ability of a cotransfected expression vector to modulate the box  activity was determined by CAT assay. (A) Autoradiogram of CAT activities in a representative assay. (B) Diagram showing the suppression of CAT activity produced by p/BCP-CAT in the presence of an increasing amount of cotransfected pf:E4BP4. The diagram shows the CAT activity exhibited by p/BCP-CAT relative to that of pBCP-CAT. Results were quantitated by PhosphorImager counting as described in Materials and Methods.

View larger version (25K): [in this window] [in a new window]   FIG. 4.   Repression of the activities of the CURS and second enhancer by E4BP4. HepG2 cells at a density of 1.4 × 106 per well in a six-well plate were either transfected with 4 µg of pBCP-CAT or cotransfected with p/BCP-CAT, pCURS/BCP-CAT, pNRE-CURS/BCP-CAT, pSVpCAT/ENII, pSVpCAT/, or a p(1687-1851)CAT control plasmid in the presence of 500 ng of either pCMVP4 (CMV-E4BP4) or pCMVIE (CMV). The diagram shows the CAT activity exhibited by p/BCP-CAT relative to that of pBCP-CAT. Results were quantitated with a PhosphorImager as described in Materials and Methods. The data represent the mean results obtained from at least four experiments. Error bars represent the standard errors of the mean values obtained.

E4BP4 suppresses HBV replication. So far, we have shown that E4BP4 can suppress the activity of box , which is a major component of the CURS and enhancer II. Enhancer II activates the transcription of both the large and middle/major surface promoters, while the CURS activates that of the core promoter (67, 70). The negative regulatory effects seen with E4BP4, therefore, may have a significant impact on viral gene expression and replication. To test this, we resorted to transient transfection with a more-than-unit-length HBV genome, pHBV3.6, into differentiated human hepatoma HuH-7 cells. Viral gene expression and production of mature virions that closely mimic viral infection in vivo have been seen after transfection (70). The effect of E4BP4 on the transcription and replication of HBV was tested by cotransfecting an E4BP4 expression plasmid, pf:E4BP4, or an empty vector, pFLAG-CMV2, with pHBV3.6. Three days after transfection, the amounts of the 2.4-kb large surface, 2.1-kb middle and major surface, and 3.5-kb precore and pregenomic transcripts were measured by Northern hybridization. The expression of G3PDH was used as an internal control. As shown in Fig. 5B, expression of E4BP4 reduced the expression of viral RNAs by five- to sixfold. The production of mature virions was quantified by an endogenous DNA polymerase activity assay. As shown in Fig. 5A, E4BP4 reduced the production of virions 20-fold. This was seen with pf:E4BP4 but not pFLAG-CMV2. These results clearly demonstrated that E4BP4 suppressed the gene expression and replication of HBV.

View larger version (28K): [in this window] [in a new window]   FIG. 5.   Repression of the production of HBV virions and gene expression by E4BP4. Forty-five micrograms of plasmid HBV3.6, which contains a more-than-unit-length HBV viral genome, was transfected into HuH-7 cells at a density of 1.1 × 107 cells per 15-cm-diameter plate alone (lanes 1) or with 30 µg of pFLAG-CMV2 (flag) (lanes 3) or pf:E4BP4 (lanes 2). A pSV2CAT vector, which contains a CAT reporter gene driven by the SV40 early promoter and 72-bp enhancer, was included in all transfections as an internal control for transfection efficiency. (A) Production of virions. Media from the transfectants were collected 3 days after transfection to assay for the production of HBV virions and core particles. The amounts of virions and core particles produced were quantified by the endogenous DNA polymerase activity assay. L and NC, linear and nicked circular forms, respectively, of HBV DNA. Numbers on the left are kilobases. (B) Northern blot analysis of HBV transcripts. The intracellular RNAs were collected at day 3 posttransfection. Twenty micrograms of total RNA of each sample was analyzed by Northern hybridization with the entire HBV DNA as the probe. The same blot was reprobed with G3PDH to ensure equal loading of RNA samples.

Identification of E4BP4 regions essential for the suppression of HBV gene expression. Earlier studies have identified a repression domain at the C-terminal portion of E4BP4 (12, 13). To test the involvement of this repression domain in the suppression of HBV gene expression, we tested several E4BP4 mutants, which included a series of C-terminal deletion mutants (pf:E4BP4Apa, pf:E4BP4Pvu, and pf:E4BP4Sal) and an internal deletion mutant lacking the repression domain (pf:E4BP4Hae/BstB) (Fig. 6A). All of these mutants were tagged with the FLAG epitope. These mutants were individually cotransfected into HuH-7 cells with a reporter plasmid, p/BCP-CAT, or a control plasmid, p(1687-1851)CAT, which lacked the box  sequence. The levels of expression and the intracellular localizations of E4BP4 proteins were determined by Western blotting and immunofluorescence. The box  binding activities and the effects of transcription suppression of these mutants were examined with gel shifting experiments and CAT assays. All of these mutants were expressed at roughly comparable levels (Fig. 6B). All of these mutant proteins except f:E4BP4Sal were localized only in the nucleus. In Fig. 6C, the localization of a representative f:E4BP4Pvu mutant is shown (left panel). The f:E4BP4Sal was present mainly in the nucleus, but a faint signal could be detected in the cytoplasm (right panel).

View larger version (180K): [in this window] [in a new window]   FIG. 6.   Minimal essential region of E4BP4 required for transcription repression. HuH-7 cells were cotransfected with either p/BCP-CAT or p(1687-1851)CAT plus either pf:E4BP4 or one of the four E4BP4 deletion constructs pf:E4BP4Hae/BstB (H/B), pf:E4BP4Apa (Apa), pf:E4BP4Pvu (Pvu), and pf:E4BP4Sal (Sal). Cotransfection with an insertless pFLAG-CMV2 was also included as a negative control. (A) Repression functions of different E4BP4 deletion mutants. The diagram displays the repression of the CAT activity exhibited by p/BCP-CAT or p(1687-1851)CAT by a cotransfected wild-type E4BP4 or deletion mutants of E4BP4. The resulting CAT activities were normalized against those obtained with a p/BCP-CAT reporter alone. (B) Expression of E4BP4 protein by transfectants. Protein expression by untransfected cells (un) (lanes 1 and 8) and cells transfected with either wild-type E4BP4 (f.l) (lanes 2 and 9) or its deletion mutants (with a whole cell lysate of 105 cells/lane) was analyzed by Western blotting with anti-FLAG monoclonal antibody and the ECL system as described in Materials and Methods. Numbers on the left are kilodaltons. (C) Localization of f:E4BP4Pvu and f:E4BP4Sal mutant proteins. The localization of f:E4BP4Pvu (left panels) and f:E4BP4Sal (right panels) mutant proteins was detected with anti-FLAG monoclonal antibody and a fluorescein isothiocyanate-conjugated goat anti-mouse IgG (bottom panels). The nuclear DNA was stained with Hoechst 33258 (top panels). (D) DNA binding activity of wild-type E4BP4 and its various deletion mutants. Gel shift experiments were performed with end-labeled box  oligonucleotide in the presence of 5 µg of mini-nuclear extracts obtained from untransfected cells (lanes 14 and 15) and cells transfected with either wild-type E4BP4 (lanes 2 and 3) or different deletion mutants of E4BP4 (lanes 4 to 11). For lanes 3, 5, 7, 9, 11, 13, and 15, 3 µg of anti-FLAG monoclonal antibody ( flag) was added for supershifting. No antibody was added in lanes 2, 4, 6, 8, 10, 12, and 14.

Negative regulatory effects of E4BP4 in human hepatoma cells. Northern hybridization was performed to analyze the expression pattern of E4BP4. A 1.9-kb E4BP4 transcript was detected in total RNAs extracted from HepG2 and HuH-7 cells, which are differentiated human hepatoma cell lines (Fig. 7A). As a control, the blot was reprobed with a radiolabeled G3PDH cDNA for equal loading of RNA samples. In addition, poly(A)⁺ RNAs from a variety of human tissues were subjected to Northern blot analysis. The 1.9-kb E4BP4 message could be detected in all tissues. Modest expression was seen in brain, liver, and thymus, while very strong expression was seen in peripheral blood leukocytes, skeletal muscle, and testis (Fig. 7B). These blots were subsequently reprobed with a radiolabeled human -actin cDNA to ensure equal loading. The modest level of E4BP4 expression in liver was in line with the observation that there was very little supershifting by anti-E4BP4 antibody of box  binding activity in nuclear extracts derived from untransfected HepG2 and HuH-7 cells (Fig. 2B). To test the involvement of E4BP4 in the negative regulation of HBV promoters, we overexpressed an E4BP4 antisense transcript and measured the transcriptional activity of a cotransfected basal core promoter. The E4BP4 antisense transcript was driven by the CMV promoter, while an insertless vector containing only the CMV promoter was used as a negative control. As shown in Fig. 8, the activity of the basal core promoter in the presence of an upstream box  or the CURS was increased by threefold. The activation of the basal core promoter by another upstream element containing nt 1687 to 1743, was not significantly affected.

View larger version (37K): [in this window] [in a new window]   FIG. 7.   Expression of E4BP4 RNA. (A) Expression of E4BP4 mRNA in the human hepatoma cell lines HuH-7 and HepG2. Thirty-five micrograms each of total RNAs from HuH-7 (lane 1) and HepG2 (lane 2) cells was loaded for Northern blotting. The filter was probed with a 554-bp EcoRI fragment of E4BP4 cDNA (upper panel) or G3PDH cDNA (lower panel). Numbers on the left are kilobases. (B) Expression of E4BP4 mRNA in various human tissues. Approximately 2 µg of poly(A)+ RNAs from various human tissues (Clontech) was used for Northern blot analysis. The tissue origins of the RNA samples are indicated. The filters were probed with a 554-bp EcoRI fragment of E4BP4 cDNA (upper panel) or -actin cDNA (lower panel). Probing with either G3PDH or -actin is to ensure approximately equal loading of RNA samples. PB, peripheral blood.

View larger version (27K): [in this window] [in a new window]   FIG. 8.   Elevation of the activities of box  and the CURS by E4BP4 antisense RNA. Three micrograms of plasmid p/BCP-CAT, pCURS/BCP-CAT, or p(1687-1851)CAT was cotransfected with either 3 µg of pCMV4Ns/s, which is an antisense E4BP4 expression construct, or 2.35 µg of a control vector, pCMVIE (CMV), into HuH-7 (top panel) and HepG2 (bottom panel) cells. The promoter activity of p/BCP-CAT, pCURS/BCP-CAT, or p(1687-1851)CAT was measured by CAT assay. The CAT activity exhibited by each promoter in cells cotransfected with the antisense construct is normalized against that in cells cotransfected with the control vector pCMVIE. Error bars indicate standard errors of the means.

E4BP4-mediated suppression of transcription. Box  stimulated the basal core promoter activity in HuH-7 and HepG2 cells. Box  is also an essential component of enhancer II. E4BP4, however, suppressed the stimulatory function of box  in the context of the CURS and enhancer II. E4BP4 does not appear to be a major component of box  binding proteins in HepG2 and HuH-7 cells. For example, the box  sequence (CAAGGTCTTACATAAGAGGACTCTT [nt 1645 to 1669]) is similar to the consensus C/EBP binding site (A/G/C)T(T/G)NNG(T/C)AA(T/G). We previously reported that box  binding proteins were C/EBP-like proteins (68). To test whether members of the C/EBP family are present among box  binding proteins in HepG2 and HuH-7 cells, gel shift experiments were performed with the labeled box  sequence in the presence of, as unlabeled competing sequences, the C/EBP consensus sequence or the mutant box  sequence AB, CD, or EF. As shown in Fig. 9A, mutant EF, carrying mutations in box  and the C/EBP consensus sequence, but not mutants AB and CD, carrying mutations in box , could compete as effectively for box  binding as the wild-type box  sequence. This shows that these endogenous C/EBP-like proteins have the same binding site specificity as E4BP4. We have noticed that EF could compete for box  binding, which was different from our previous observation (68). These gel shift and competition experiments were done as previously described except that 5 instead of 10 µg of nuclear extract was used. Whether this minor modification or other conditions that we could not control for led to this change in result is not clear. This result, however, does not change our conclusion that C/EBP-like proteins are major box  binding proteins in liver cells (see Fig. 9B and C and Discussion).

View larger version (94K): [in this window] [in a new window]   FIG. 9.   C/EBP and C/EBP are box  binding proteins. (A) Binding site specificity of endogenous box  binding protein determined by gel shift experiments in the presence of competing oligonucleotides in excess. The relative efficiencies of wild-type box  (WT) (Lanes 3 to 5), three mutated forms of box  sequences (AB [lanes 6 and 7], CD [lanes 8 and 9], and EF [lanes 10 and 11]), a C/EBP consensus sequence (lanes 12 and 13), and nonspecific competitor HNF1 (lane 14) in abolishing box  DNA-protein complexes formed by endogenous box  binding proteins present in nuclear extracts are shown. Lane 1, no protein; lane 2, 5 µg of nuclear protein of the 0.5 M NaCl eluent from HepG2 cells and no competitor; lanes 3 to 14, 5 µg of nuclear protein of the 0.5 M NaCl eluent form HepG2 cells in the presence of different unlabeled competitors at various molar excesses as indicated. (B and C) supershifting of box  binding complexes formed by nuclear extracts by antibodies against different members of the C/EBP family. Lane 1, no protein; lane 2, 5 µg of nuclear protein of the 0.5 M NaCl fraction from HuH-7 (B) or HepG2 (panel C) cells; lanes 3 to 6, cold wild-type box , AB, CD, or C/EBP consensus sequence was added at a 125-fold molar excess for competition experiments; lanes 7 to 13, anti-C/EBP, anti-C/EBP, and anti-C/EBP antibodies (0.5 µg each) alone or in combinations were added for supershifting.

View larger version (89K): [in this window] [in a new window]   FIG. 10.   Competition for binding to the box  sequence by recombinant E4BP4 and the endogenous box  binding activity present in nuclear extracts. The ability of recombinant E4BP4 protein to outcompete endogenous box  binding activity present in nuclear extracts was determined. Gel shift competition experiments were performed with end-labeled wild-type box  oligonucleotide and 7.5 µg of protein prepared from the 0.5 M NaCl fraction of HuH-7 (lanes 2 to 5) or HepG2 (lanes 6 to 9) nuclear extracts. Mixtures were preincubated with 1 (lanes 3 and 7), 2 (lanes 4 and 8), or 4 (lanes 5 and 9) µl of recombinant E4BP4 protein before loading. Lane 1, box  alone; lane 10, mixture of box  and 4 µl of recombinant E4BP4 protein.

View larger version (13K): [in this window] [in a new window]   FIG. 11.   Binding affinities of recombinant E4BP4 and the endogenous box  binding activity towards the box  sequence (Scatchard plot analysis). A series of gel shift assays were performed with fixed amounts of the 0.5 M NaCl fraction of HuH-7 nuclear extracts (NE) or recombinant E4BP4 protein in the presence of increasing amounts of 32P-end-labeled box  oligonucleotides. The bands representing free and bound oligonucleotides were identified and isolated. After drying, the radioactivities of these bands were quantified with a Molecular Dynamics PhosphorImager. The dissociation constants (Kd) were determined by the standard method of Scatchard plot analysis.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

In this paper, we describe the cloning of a bZIP type of transcription factor, E4BP4, that specifically binds to the box  sequence in HBV. Box  is an essential element of both the CURS and the second enhancer, which positively regulate the transcription of HBV genes (68, 70). E4BP4 appears to function as a negative transcription regulator at box . Overexpression of E4BP4 represses the stimulating activity of box  in the CURS and the second enhancer in constructs containing CAT reporters. E4BP4 can also repress the transcription of HBV genes and the production of HBV virions in a transient-transfection system that mimics the viral infection in vivo. In addition, expression of an E4BP4 antisense construct can elevate the transcription of HBV genes.

The following results suggest that binding site occlusion is the mechanism whereby E4BP4 suppresses transcription in HBV: (i) E4BP4 and the endogenous box  binding protein(s) bind to the same sequence in box , (ii) E4BP4 readily outcompetes the endogenous box  binding activity present in nuclear extracts in a dose-dependent manner, (iii) E4BP4 has a stronger binding affinity towards the box  sequence than the endogenous box  binding activity present in nuclear extracts, (iv) examination of the structure-function relationship of E4BP4 reveals that DNA binding activity is sufficient to confer the negative regulatory function of E4BP4, and (v) E4BP4 does not bind either C/EBP or C/EBP to a significant extent when coexpressed in human hepatoma cells (data not shown).

In addition to box , E4BP4 also binds to the E4 promoter of adenovirus, the IL-1 promoter, the gamma interferon promoter, and the A site of the IL-3 promoter. Among these promoters, overexpression of E4BP4 has been shown to suppress the transcriptional activity of the E4 promoter of adenovirus and the IL-1 promoter like that of box . The exact repression mechanism of E4BP4 on the E4 and IL-1 promoters has not been completely elucidated. It is not clear, for example, if positive factors bind to overlapping or identical sites in these promoters and if E4BP4 functions by binding site occlusion as is the ease for box  of HBV (11, 12). An earlier report showed that E4BP4 could act as an active repressor to suppress the transcriptional activity of a basal promoter in the presence of an E4BP4 binding site, probably via an interaction with Dr1 (13, 14). Dr1 is a TBP binding protein, which can down regulate both basal and activated transcription at a variety of promoters (28, 66). In the same report, a repression domain that was required for suppression of transcription and interaction with Dr1 by E4BP4 was described (14). This repression domain, however, is not required for the repression of the activity of box  in HBV. E4BP4, therefore, represses HBV transcription by binding site occlusion rather than by acting as an active repressor. Interestingly, E4BP4 may also function as an activator of transcription. Overexpression of E4BP4 (NF-IL3A) activates the transcriptional activity of the A site of the IL-3 promoter in a binding-site-specific manner (27, 71). Furthermore, although E4BP4 can bind to the human gamma interferon promoter, it does not confer either an activating or a repressing function (71). It is possible that the different regulation by E4BP4 is influenced by the nucleotide sequences surrounding the specific binding sites, the presence or absence of other factors binding to overlapping or identical sites, and/or the presence or absence of proteins interacting with E4BP4.

Mutant EF can compete fairly efficiently with the wild-type sequence in binding to cellular factors present in a 0.5 M NaCl fraction. This result appears to be at odds with that of our prior study that the EF mutant will not bind to cellular factors in extracts prepared in similar ways (68). The reason for this discrepancy is unknown. The fact that anti-C/EBP and - antibodies can almost completely supershift the box  binding activity nevertheless strongly supports our conclusion that C/EBP and - are major box  binding factors.

Box  is an essential component of both the CURS and the second enhancer. In both cases, it has a stimulatory effect in the differentiated human hepatoma cell lines HuH-7 and HepG2 (68, 70). E4BP4 does not appear to be a major component of the box  binding activity, and E4BP4 is present in low abundance in HuH-7 or HepG2 cells. Given the strong binding affinity of E4BP4 towards box  and the ability of a small amount of E4BP4 to significantly suppress the activity of box , E4BP4 appears to be at a sufficient level to exert a negative regulatory effect on HBV transcription and replication. C/EBP and C/EBP, in contrast, are major components of the box  binding activity present in nuclear extracts as demonstrated by supershift experiments. Overexpression of C/EBP or C/EBP can potentiate the stimulating activity of box  (data not shown). Moreover, recombinant C/EBP protein can bind to the same sequence in box  as recombinant E4BP4 and the endogenous box  binding activity present in nuclear extracts (data not shown). However, the DNA-protein complexes formed by endogenous box  binding activity derived from nuclear extracts migrated differently from those formed by homodimers of either C/EBP or C/EBP (data not shown). These results suggested that both C/EBP and C/EBP would heterodimerize with each other or with other binding proteins when binding to the box  sequence. In addition to the formation of homodimers, C/EBPs have been reported to form heterodimers with other C/EBP family members or other bZIP proteins such as CREB, C/ATF, and AP1 (18, 26, 33, 34, 37, 38, 48, 61-65). C/EBPs may also interact with proteins that do not contain leucine zippers, such as YY1, Rb, Rel, NF-B, Sp1, TBP, TFIIB, or glucocorticoid receptor (3, 10, 16, 39-41, 45, 46, 58-60). The nature of the partners that heterodimerize with either C/EBP or C/EBP to form the endogenous box  binding activity in nuclear extracts is yet to be determined.

Transcription of HBV genes displays a strong preference for liver and differentiated hepatoma cell lines (2, 7, 17, 22). This preference has been attributed to the circumscribed action of certain liver-enriched transcription activators, including HNF1, HNF3, and HNF4, binding to the cis-acting regulatory elements present in the HBV genome (for example, HNF3 and HNF4 on both the X promoter/enhancer I and core promoter/enhancer II and HNF1 and HNF4 on the large surface promoter) (8, 9, 19, 23, 30, 43, 47, 49, 50, 51, 72). On the other hand, E4BP4 is a negative transcription factor for HBV transcription. It is intriguing that E4BP4 transcripts are present in larger amounts in many tissues other than liver. The potent suppression of box  activity by E4BP4 may contribute to the preferential silencing of HBV gene expression in tissues other than liver.