Previous Article | Next Article 
Journal of Virology, April 1999, p. 3197-3209, Vol. 73, No. 4
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Transcriptional Repression of Human Hepatitis B
Virus Genes by a bZIP Family Member, E4BP4
Chao-Kuen
Lai and
Ling-Pai
Ting*
Institute of Microbiology and Immunology,
School of Life Science, National Yang-Ming University, Shih-Pai,
Taipei 11221, Taiwan, Republic of China
Received 22 September 1998/Accepted 17 December 1998
 |
ABSTRACT |
Box
is an essential element of both the upstream regulatory
sequence of the core promoter and the second enhancer, which positively
regulate the transcription of human hepatitis B virus (HBV) genes. In
this paper, we describe the cloning and characterization of a box
binding protein, E4BP4. E4BP4 is a bZIP type of transcription factor.
Overexpression of E4BP4 represses the stimulating activity of box
in the upstream regulatory sequence of the core promoter and the second
enhancer in differentiated human hepatoma cell lines. E4BP4 can also
suppress the transcription of HBV genes and the production of HBV
virions in a transient-transfection system that mimics the viral
infection in vivo. Expression of an E4BP4 antisense transcript can,
instead, elevate the transcription of the core promoter. A low
abundance of E4BP4 protein and mRNA in differentiated human hepatoma
cell lines is detected, and E4BP4 is not a major component of box
binding proteins in untransfected differentiated human hepatoma cell
lines. C/EBP
and C/EBP
, in contrast, are major components of the
box
binding activity present in nuclear extracts. E4BP4 has a
stronger binding affinity towards box
than the endogenous box
binding activity present in nuclear extracts. Structure and function
analysis of E4BP4 reveals that DNA binding activity is sufficient to
confer the negative regulatory function of E4BP4. These results
indicate that binding site occlusion is the mechanism whereby E4BP4
suppresses transcription in HBV.
 |
INTRODUCTION |
Hepatitis B virus (HBV) is a small
DNA virus with a partially double-stranded 3.2-kb genome. The genome
organization of HBV is very compact, with four overlapping open reading
frames coding for the surface, core, polymerase, and X proteins. The
transcription of these open reading frames is under the control of four
promoters: two for surface, one for core and polymerase, and one for X. Two enhancers, enhancer I and enhancer II, play important roles in the
transcription regulation of these viral genes. The core promoter is
composed of the basal core promoter and its upstream regulatory sequence (70). This promoter produces two 3.5-kb RNAs, i.e., the precore and pregenomic RNAs. Pregenomic RNA has dual functions: (i)
it can be packaged into nucleocapsids (core particles) along with viral
polymerase and serve as the template for reverse transcription, and
(ii) it can serve as mRNA that encodes the core and polymerase proteins. Regulated expression of pregenomic RNA plays a pivotal role
in the control of the viral replication cycle. A detailed understanding
of the transcription control of viral genes may reveal new targets for
therapeutic intervention.
The second enhancer of HBV has a unique bipartite structure in that the
cooperation of two noncontiguous elements, box
and box
, is
required for its enhancer function. It stimulates the transcriptional
activity of the simian virus 40 (SV40) early promoter and the HBV
surface and X promoters (67, 68). The second enhancer is
colocalized with the core upstream regulatory sequence (CURS). Box
,
for example, is not only an essential component of the second enhancer
but also a potent stimulatory element of the CURS. In other words, box
can activate the basal core promoter from an upstream position in
differentiated human hepatoma cell lines (HepG2 and HuH-7) (69,
70). A negative regulatory element, designated NRE, which
represses the activities of enhancer II and the core promoter, was
identified upstream of the CURS (44). The core promoter
provides a valuable system to study the positive and negative
transcription regulation of eukaryotic promoters.
Transcription regulation is governed by a constellation of
trans-acting cellular factors that bind to specific
cis-acting elements that act in either a positive or
negative manner. Transcription initiation by RNA polymerase II involves
a stepwise assembly of general transcription factors or a holoenzyme on
a promoter template to form a preinitiation complex. Transcription
activators may stimulate transcription by increasing the assembly of a
preinitiation complex. Several distinct models have been proposed as
the mechanism of transcription repression (20, 21, 24, 25, 29, 42, 52). In the competition model, repressors may bind directly at or
near a transcription start site and compete with the formation of a
preinitiation complex in the promoter. Alternatively, activators and
repressors may compete for overlapping or closely linked binding sites.
In the activator-sequestering model, repressors stoichiometrically bind
to particular activators through protein-protein interactions, leading
to the formation of complexes with reduced or no DNA binding activity.
In the quenching model, repressors and activators may bind to adjacent,
nonoverlapping DNA sequences, but the repressors neutralize the ability
of the activators to transmit stimulatory signals to the basal
transcription machinery. In the fourth model, direct repression,
repressors may bind to any of the basal transcription factors, with RNA
polymerase II itself, or with a corepressor that ultimately targets the
basal machinery. Such interaction may interfere with the formation or
the activity of the basal transcription preinitiation complex.
We have previously shown that C/EBP-like proteins can bind to box
.
C/EBPs (CCAAT/enhancer binding proteins) are a family of highly
conserved, leucine zipper-type (bZIP) DNA binding proteins. Members
identified so far are C/EBP
, C/EBP
(also known as NF-IL6, CRP2,
LAP, and AGP/EBP), C/EBP
(also known as NF-IL6
and CRP3), C/EBP
, CRP1, Ig-C/EBP, and GADD153 (also known as CHOP) (1, 5,
6, 15, 31, 32, 36, 53, 54, 65). Different C/EBP family members
are characterized by a high degree of sequence homology in the leucine
zipper and basic regions. They have, however, much less conserved
N-terminal regulatory and transactivation domains (5, 35).
C/EBPs have the potential to form homo- and heterodimers with C/EBP
family members or bZIP proteins or to interact with proteins that do
not contain leucine zippers. Dimerization of C/EBPs is generally
required for their DNA binding and transcription activation function
(3, 10, 16, 18, 26, 33, 34, 37-41, 45, 46, 48, 58-65).
In this paper, we describe the cloning and characterization of a box
binding protein, E4BP4. Overexpression of E4BP4 represses the
stimulating activity of box
in the CURS and the second enhancer. E4BP4 can also repress the transcription of HBV genes and the production of HBV virions in a transient-transfection system. Overexpression of an E4BP4 antisense transcript, on the other hand, can
elevate the transcription of the core promoter. Though present in low
abundance, E4BP4 can bind to the box
sequence with higher affinity
than the box
binding activity present in nuclear extracts. Evidence
that binding site occlusion is most likely the mechanism whereby E4BP4
suppresses transcription in HBV is presented.
 |
MATERIALS AND METHODS |
Isolation of cDNA clones.
A
ZAPII cDNA library (prepared
from Stratagene's ZAP cDNA synthesis kit) of human hepatoma HepG2
cells was screened with concatemerized double-stranded synthetic
oligonucleotides of box
by the method of Singh (57). The
oligonucleotides contained the box
sequence
gatCCAAGGTCTTACATAAGAGGACTCTT and its complement, which
corresponded to the box
sequence extending from nucleotide (nt)
1644 to 1669 of HBV plus an MboI 5' overhang. The
oligonucleotides were concatemerized to ~500 bp in size with T4
polynucleotide kinase and T4 DNA ligase and labeled with
[
-32P]dCTP by random prime labeling. All positive
plaques were picked, replated, and clonally purified through secondary
and tertiary screenings. cDNA inserts from positive clones were excised
in the form of pBluescript plasmid (pSKP4) by coinfection with helper phage. DNA sequences were determined by dideoxy chain termination methods.
Plasmids.
The HBV sequence used in the study is of the
adw subtype. Numbering of the HBV sequence begins at the
unique EcoRI site, which is nt 1. All reporter plasmids used
in transfection experiments contain a head-to-tail trimeric tandem
repeat, referred to as A3, of a 237-bp BclI-BamHI
fragment from the SV40 polyadenylation signal. A3 is placed 5' of
promoter sequences of interest and has been shown to stop transcription
readthrough from spurious upstream initiation.
Plasmids pSV2CAT, p
/BCP-CAT, pCURS/BCP-CAT, p(1613-1851)CAT,
p(1687-1851)CAT, pSVpCAT/ENII, pSVpCAT/
, and pHBV3.6 were described previously (44, 67, 68, 70).
The recombinant E4BP4 expression plasmid pXa-2-P4 was generated by
cloning of the
BamHI-
KpnI fragment containing the
E4BP4
open reading frame into the
BamHI and
KpnI
sites of the PinPoint
Xa-2 vector
(Promega).
The plasmid pCMVP4 was generated by moving the cDNA inserts of pSKP4
into the
BamHI and
KpnI sites downstream of the
cytomegalovirus
(CMV) immediate-early promoter (CMVIE) in pCMVIE. To
generate
the FLAG-tagged E4BP4 construct, the
BamHI-
KpnI fragment containing
the cDNA insert of
pCMVP4 was cloned into the
BglII and
KpnI sites
downstream of the CMVIE in the pFLAG-CMV2 expression vector (Kodak,
New
Haven, Conn.). The resulting plasmid, pf:E4BP4, was digested
with
ApaI and
SalI and then recircularized to generate
pf:E4BP4

Apa
and pf:E4BP4

Sal, respectively. The plasmid
pf:E4BP4Pvu was generated
by cloning the
BamHI-
PvuII fragment from pf:E4BP4 into
BglII-
and
SmaI-digested pFLAG-CMV2. To remove
the repression domain
of E4BP4, pCMVP4 was first digested with
BstBI to derive a 5.6-kb
BstBI fragment, which
was subsequently digested with
BamHI, followed
by filling in
of all 3'-recessed ends with the Klenow fragment
of
Escherichia
coli DNA polymerase. Two
BamHI-
BstBI
fragments
of 4,513 and 1087 bp, were generated. An 885-bp
BamHI-
HaeIII fragment
was derived from the
digestion of the 1,087-bp
BamHI-
BstBI fragment
with
HaeIII. The 4,513-bp
BamHI-
BstBI
and 885-bp
BamHI-
HaeIII
fragments were ligated
together to generate pCMVP4

Hae/BstB. The
BamHI-
KpnI fragment of pCMVP4

Hae/BstB was
cloned into the
BglII
and
KpnI sites of the
pFLAG-CMV2 expression vector to generate
the plasmid
pf:E4BP4

Hae/BstB. All of these constructs were confirmed
by DNA
sequencing.
The E4BP4 antisense plasmid pCMV4Ns/s was generated by cloning of the
378-bp
SalI-
SspI fragment, which corresponds to
the
5'-end region of E4BP4 from nt 117 to 494, into the
SalI-
SmaI
sites of the pCMVIE expression
vector.
Bacterial fusion proteins.
The E4BP4 expression construct
pXa-2-P4 was used to express biotinylated fusion proteins in strain
JM109. JM109 cells harboring E4BP4 vectors were grown to log phase and
induced with 100 µM isopropyl-
-D-thiogalactopyranoside
(IPTG) (Sigma). Six hours following induction, the bacteria were
centrifuged and lysed in 1 mg of lysozyme per ml-0.1% Triton
X-100-200 U of DNase. The lysates were then clarified by
centrifugation at 10,000 × g for 15 min at 4°C and
mixed with avidin resin (Promega). Following a 6-h incubation, the
resin was washed three times in cold buffer (50 mM Tris-HCl, 4 mM
dithiothreitol [DTT], 2 mM EDTA, 10% glycerol). If the fusion
protein was to be eluted, the pelleted resin was washed with buffer
containing 5 mM biotin. The eluent was aliquoted, quickly frozen under
liquid nitrogen, and kept frozen at
70°C.
Preparation of anti-E4BP4 polyclonal antibody.
Rabbits were
immunized with a 16-amino-acid peptide corresponding to amino acids 446 to 461 of E4BP4. After three booster injections with conjugated peptide
(the carrier protein was keyhole limpet hemocyanin or bovine serum
albumin), rabbit sera were tested for reactivity with E4BP4 by
immunoprecipitation and Western blotting.
Cell lines, transfection, and CAT assay.
The culture and
transfection of human hepatoma cell lines HepG2 and HuH-7 were
performed as previously described (7). All plasmids used in
one set of experiments were simultaneously prepared, checked for
supercoiled forms, aliquoted in small amounts, and stored in 70%
ethanol. Each set of experiments was performed with two different
preparations of plasmids and repeated two to three times for each
preparation. The chloramphenicol acetyltransferase (CAT) activity was
normalized against the CAT activity exhibited by a control plasmid,
pSV2CAT, which was taken as 100%. In pSV2CAT, the expression of the
CAT gene is driven by the SV40 early promoter and 72-bp enhancer. When
the CAT activity was high, assays were performed on serially diluted
cell lysates to ensure that CAT activity fell in a linear range for all assays.
Preparation and heparin-Sepharose fractionation of nuclear
extracts.
Fractionated nuclear extracts from differentiated human
hepatoma cell lines HepG2 and HuH-7 were prepared as previously
described (8, 68). The crude and fractionated nuclear
extracts were aliquoted, quickly frozen under liquid nitrogen, and kept
frozen at
70°C.
Preparation of mini-nuclear extracts from transfected cells.
Mini-nuclear extracts were prepared by the method of Schreiber et al.
(56). HuH-7 cells were transiently transfected with pFLAG-CMV2, pf:E4BP4, and expression plasmids containing deletion mutants of f:E4BP4 by the calcium phosphate precipitation method. Forty-eight hours later, transfected HuH-7 cells were collected, washed
with Tris-buffered saline (TBS) (10 mM Tris-HCl [pH 7.45] and 150 mM
NaCl), and pelleted by centrifugation at 1,500 × g for
5 min. The cell pellet was resuspended in TBS, transferred into an
Eppendorf tube, and pelleted again by being spun for 20 s in a
microcentrifuge. TBS was removed, and the cell pellet was resuspended
in cold buffer A (10 mM HEPES [pH 7.9], 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, and 0.5 mM phenylmethylsulfonyl fluoride) by gentle
pipetting. The cells were allowed to swell on ice for 15 min, after
which a 10% solution of Nonidet P-40 was added and the tube was
vigorously vortexed for 10 s. The homogenate was centrifuged for
30 s in a microcentrifuge. The nuclear pellet was resuspended in
ice-cold buffer C (20 mM HEPES [pH 7.9], 0.4 M NaCl, 1 mM EDTA, 1 mM
EGTA, 1 mM DTT, and 1 mM phenylmethylsulfonyl fluoride), and the tube
was vigorously rocked at 4°C for 15 min on a shaking plate. The
nuclear extract was centrifuged for 5 min in a microcentrifuge at
4°C, and the supernatant was aliquoted, quickly frozen under liquid
nitrogen, and kept frozen at
70°C.
Gel shift analysis.
The probe was prepared with annealed
double-stranded oligonucleotide (100 ng) corresponding to the box
sequence of HBV (Fig. 1A) and end labeled
with [
-32P]ATP and T4 polynucleotide kinase. Gel
shifting and competition experiments were done as previously described
(68) except that 5 instead of 10 µg of nuclear extract was
used (68). Supershifts were generated with anti-E4BP4
antiserum, anti-FLAG M2 monoclonal antibody (Kodak), or anti-C/EBP
polyclonal antibody for C/EBP
, C/EBP
, or C/EBP
(Santa Cruz
Biotechnology, Santa Cruz, Calif.).

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 1.
Binding specificity of recombinant E4BP4 protein. (A)
Summary of the oligonucleotide sequences of wild-type box nt 1636 to 1668 [WT(36)] and 1646 to 1668 [WT(46)] and mutants AB, CD, EF,
GH, IJ, and YZ and their binding activities toward recombinant E4BP4.
In the WT(36) oligonucleotide, the lowercase letters represent the
sequence which is different from the HBV sequence. In mutants, the
lowercase letters represent the mutated nucleotides. (B) Competition of
binding of recombinant E4BP4 protein to wild-type box sequence
[WT(36)] by wild-type box sequence [either WT(36) or WT(46)] or
six box mutants in gel shift assays. Recombinant E4BP4 protein was
first incubated with competing cold oligonucleotides in molar excess
and then tested for its binding to labeled WT36 probe. Lane 1, labeled
WT(36) probe with no protein; lane 2: labeled WT(36) probe with
recombinant E4BP4 protein but no competitor; lanes 3 to 20, labeled
WT(36) probe with recombinant E4BP4 protein and different unlabeled
competitors at various molar excesses as indicated. HNF1 is a
nonspecific competitor.
|
|
For Scatchard plot analysis, 7.5 µg of HuH-7 nuclear extract (0.5 M
NaCl fraction) and 7 µl of recombinant E4BP4 protein were
incubated
with different amounts of
32P-end-labeled box

oligonucleotides ranging from 0.032 to 1.411
ng. The resulting
protein-DNA complexes were separated in a 4%
polyacrylamide gel, and
the bands representing free and bound
ligands were identified; this was
followed by drying and quantification
with a Molecular Dynamics
PhosphorImager. Standard Scatchard plot
analysis allowed determination
of the appropriate
Kd values (
4,
55).
Northern blotting.
Total cellular RNA was prepared from
HepG2 cells, HuH-7 cells, or transfected HuH-7 cells with the RNAzol B
kit (Cinna/Tiotecx Laboratories, Inc., Houston, Tex.). Twenty or 40 µg of total cellular RNA was electrophoretically separated on a 1%
formaldehyde-agarose gel and transferred to a Hybond nylon membrane
(Amersham). In addition, nitrocellulose filters containing
approximately 2 µg of poly(A)+ RNAs from 16 different
adult human tissues (Clontech, Palo Alto, Calif.) were used for
Northern analysis. These membranes were hybridized with a
32P-random-prime-labeled 554-bp EcoRI fragment
of the E4BP4 cDNA probe or 1,960-bp PstI fragment of the HBV
DNA probe and washed at a high stringency under standard conditions.
These blots were exposed to Fuji X-ray film at
70°C with an
intensifying screen. The signals were normalized by hybridization with
a probe for the
-actin or glyceraldehyde-3-phosphate dehydrogenase
(G3PDH) gene followed by quantitation with a Molecular Dynamics PhosphorImager.
Assay for endogenous DNA polymerase activity.
To assay for
endogenous DNA polymerase activity, the culture supernatant was
collected 3 days after transient transfection, treated with 1% Nonidet
P-40 for 4 h at room temperature, and centrifuged at 17,000 × g for 30 min at 4°C. The supernatant was then
centrifuged at 227,000 × g for 1 h at 4°C. The
pellet from the second centrifugation, which contains HBV viral core
particles, was resuspended in TNE buffer (10 mM Tris-HCl [pH 7.5], 50 mM NaCl, and 0.1 mM EDTA) and assayed for endogenous polymerase
activity as previously described (70).
Western blotting.
HuH-7 cells were transfected with
pFLAG-CMV2, pf:E4BP4, and plasmids containing deletion mutants of
f:E4BP4. After 48 h, cells were collected and lysed in Laemmli
sample buffer at 95°C for 10 min. Proteins were separated by
electrophoresis through a 10 or 12.5% polyacrylamide gel, transferred
onto a Hybond (Amersham) enhanced chemiluminescence (ECL)
nitrocellulose membrane, and probed with 6 µg of monoclonal anti-FLAG
antibody (Kodak) per ml or with a 1,000× dilution of polyclonal
anti-E4BP4 antibody. Blots were incubated with anti-rabbit or
anti-mouse immunoglobulin G (IgG)-horseradish peroxidase conjugate
(Promega), and immunoreactive proteins were visualized with
4-chloro-1-naphthol (Sigma) or by using the ECL system (Amersham).
Immunofluorescence.
HuH-7 cells cultured on Chamber Slides
(Nunc) were transfected with pFLAG-CMV2, pf:E4BP4, and plasmids
containing deletion mutants of f:E4BP4. Following washing in
phosphate-buffered saline (PBS), the cells were fixed with 2%
formaldehyde in PBS for 20 min at room temperature, permeabilized by
expoure to cold acetone for 3 min, and washed once with PBS. The
permeabilized cells were detected with 6 µg of monoclonal anti-FLAG
antibody (Kodak) per ml for 1 h and then with fluorescein
isothiocyanate-conjugated goat anti-mouse IgG (Cappel) and 0.1 µg of
Hoechst 33258 per ml in 1% bovine serum albumin-PBS for 1 h at
room temperature. Finally, the cells were washed three times with PBS
and examined by fluorescence microscopy.
 |
RESULTS |
E4BP4 as a box
binding protein.
To search for the box
binding protein(s), we screened a cDNA library made from a
differentiated human hepatoma cell line, HepG2, with labeled
concatemers of the box
sequence. A cDNA which was identical to that
of a previously described transcription factor, E4BP4 (also named
NF-IL3A), was obtained. A member of the bZIP family, E4BP4 has been
identified as a binding protein for a variety of promoters, including
the ATF site in the E4 promoter of adenovirus, the CRE/ATF-like site of
the interleukin-1
(IL-1
) promoter, the gamma interferon promoter,
and the A site of the IL-3 promoter (11, 12, 27, 71). E4BP4
contains 462 amino acids. The bZIP domain of E4BP4 is located in the
N-terminal region of the protein (see Fig. 6A). E4BP4 has been shown to
function as a dimer (12).
To examine the binding specificity of E4BP4, recombinant E4BP4 protein
was obtained by fusion of the E4BP4 open reading frame
with that of the
1.3S subunit of the
Proprionibacterium shermanii transcarboxylase. Labeled double-stranded oligonucleotides (nt
1636 to
1668) corresponding to the wild-type box

sequence were
incubated
with recombinant E4BP4 protein in gel shift assays.
Oligonucleotides
containing different mutated box

sequences
were added in molar
excess as competitors in gel shift assays.
As shown in Fig.
1B, mutants
IJ, GH, EF, and YZ competed efficiently
for binding, while mutants AB
and CD did not. These results, summarized
in Fig.
1A, indicated that
the sequence from nt 1650 to 1662 in
box

was the binding site for
E4BP4. This segment contains the
sequence cTTACaTAAg (the lowercase
letters represent the sequence
which is different from the consensus
E4BP4 binding sequence),
which resembled the consensus E4BP4 binding
sequence (A/G)T(G/T)A(T/C)GTAA(T/C)
(
12).
We then examined the binding specificity of overexpressed E4BP4 protein
in cells. E4BP4 was first epitope tagged with the
FLAG sequence at its
N terminus. The coding sequence of FLAG-E4BP4
was then cloned
downstream of the CMVIE in the expression plasmid
pf:E4BP4. An empty
vector, pFLAG-CMV2, was included as a negative
control. The expression
of E4BP4 was detected with both anti-FLAG
monoclonal antibody and
anti-E4BP4 antiserum. The anti-E4BP4 antiserum
was raised against a
peptide derived from the C-terminal region
of E4BP4 (see Materials and
Methods). Antihemagglutinin (anti-HA)
monoclonal antibody and/or
preimmune serum was used as a negative
control.
HuH-7 cells were transfected with pf:E4BP4 or empty vector in
transient-transfection assays. Total cell lysates from untransfected
and transfected cells were obtained for Western and gel shift
experiments. As shown in Fig.
2A, two
forms of E4BP4 were detected
with anti-E4BP4 antiserum in
pf:E4BP4-transfected cells. Only
the larger form of E4BP4 was detected
with anti-FLAG monoclonal
antibody. The small form of E4BP4 is most
likely the translation
product from the AUG initiation codon of E4BP4
in the FLAG-tagged
E4BP4 from a downstream position. The apparent
molecular masses
of these two forms of E4BP4 are approximately 64 and
61 kDa instead
of the estimated 51 kDa. The reason for this discrepancy
is not
clear, although an earlier report suggests that phosphorylation
may play a role (
11). No signal was observed in cells
transfected
with empty vectors or in untransfected cells. No signal was
observed
with preimmune serum or anti-HA antibody.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 2.
DNA binding specificity of overexpressed E4BP4. HuH-7
cells at a density of 1.1 × 107 cells per
15-cm-diameter plate were untransfected (un) or transfected with 62.5 µg of pFLAG-CMV2 (flag) or pf:E4BP4 as indicated. Mini-nuclear
extracts were prepared as described in Materials and Methods. (A) E4BP4
expression in transfectants determined by Western blot analysis.
Mini-nuclear extracts (20 µg per lane) were used for Western blot
analysis, with 1,000× dilutions of anti-E4BP4 (lanes 1 to 3) and
preimmune serum (lanes 4 to 6), 6 µg of anti-FLAG ( flag) antibody
per ml (lanes 7-9), and 10 µg of anti-HA antibody per ml (lanes 10 to 12). Immunoreactive proteins were visualized with
4-chloro-1-naphthol. (B) Binding of E4BP4 to the box sequence. Five
micrograms of mini-nuclear extracts was incubated with 105
cpm of labeled box probe [WT(36)] in gel shift experiments. The
sources of nuclear extracts are indicated. For supershift experiments,
1 µl of preimmune serum (lane 5) or anti-E4BP4 (lane 6) or 3 µg of
anti-FLAG antibody (lane 11) was added. (C) DNA binding specificity of
E4BP4. Five micrograms of mini-nuclear extracts was incubated with the
labeled wild-type box probe [WT(36)] in the presence of unlabeled
WT(36) or different mutant competitors at various molar excesses as
indicated.
|
|
Nuclear extracts derived from the transfected cells described above
were used in gel shift assays. As shown in Fig.
2B, box

binding
activity was present in both untransfected cells and
cells transfected
with pf:E4BP4 or empty vector. In the nuclear
extracts obtained from
pf:E4BP4 transfectants, a supershift of
box

binding activity by
anti-FLAG and anti-E4BP4 antibodies
was observed. This supershift was
not seen with a control preimmune
serum. These results indicated that
E4BP4 could indeed bind to
the box

sequence. They also showed that
E4BP4 is not a major
component of endogenous box

binding proteins
(Fig.
2C). Moreover,
inclusion of unlabeled competing oligonucleotides
in molar excess
showed that wild-type box

and the EF sequences
could effectively
abolish the box

binding activity that was
supershifted with
anti-FLAG antibody. FLAG-tagged E4BP4 expressed in
transient transfection,
therefore, exhibited the same binding
specificity as its bacterially
expressed counterpart. Identical results
were obtained with another
E4BP4-transfected differentiated human
hepatoma cell line, HepG2
(data not
shown).
To determine the intracellular localization of E4BP4,
immunofluorescence of E4BP4-transfected and untransfected
HuH-7 cells
with anti-FLAG antibody was performed. E4BP4 was detected
as a
nuclear protein. Identical results were obtained with anti-E4BP4
antiserum (data not
shown).
Repression of the transcription stimulation effect of box
by
E4BP4.
We have previously shown that a single copy of the box
sequence in an upstream position stimulates the transcription of the
HBV basal core promoter in both HepG2 and HuH-7 cells (68). To examine the effect of E4BP4 on box
, the reporter plasmid p
/BCP-CAT was cotransfected with pf:E4BP4 or pFLAG-CMV2 vector in
HepG2 and HuH-7 cells. p
/BCP-CAT contains a CAT reporter gene, driven by the HBV basal core promoter, which is preceded by an upstream
box
sequence. Increasing amounts of E4BP4 expression plasmids were
cotransfected with the reporter plasmid. The expression level of
f:E4BP4 and the transcriptional activity of the basal core promoter as
measured by CAT assays were determined (Fig. 3). Coexpression of E4BP4 reduced the CAT
activity by 35- and 14-fold in HepG2 and HuH-7 cells, respectively
(Fig. 3). Cotransfection with pFLAG-CMV2, which had no insert, had no
significant effect. It is worth noting that the suppression by E4BP4
was observed with the expression of E4BP4 at a very low level (data not
shown). Since the promoter activity of the basal core promoter
(pBCP-CAT) is already very low, it is difficult to examine the effect
of E4BP4 on the basal core promoter directly. To circumvent this problem, we placed another positive element from the CURS upstream of
the basal core promoter instead of box
. This reporter plasmid, p(1687-1851)CAT, contained an extra sequence from nt 1687 to 1743 in
addition to the basal core promoter. E4BP4 decreased the activity of
p(1687-1851)CAT by threefold (Fig. 4).
Weak suppression of the basal promoter by E4BP4 has been previously
noted (12). Taken together, these data indicated that E4BP4
suppressed the transcription-stimulatory activity of the basal core
promoter mediated by box
.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 3.
Repression of the box activity by E4BP4. HuH-7
(lanes 1 to 14) and HepG2 (lanes 15 to 28) cells were transfected with
8 µg of pBCP-CAT only (lanes 1 and 15), 8 µg of p /BCP-CAT only
(lanes 2 and 16), 8 µg of p /BCP-CAT plus 31.2, 62.5, 125, 250, 500, or 1,000 ng of pf:E4BP4 (lanes 3 to 8 and 17 to 22, respectively),
or 8 µg of p /BCP-CAT plus 31.2, 62.5, 125, 250, 500 or 1,000 ng of
pFLAG-CMV2 (lanes 9 to 14 and 23 to 28, respectively). The cell
densities for HuH-7 and HepG2 cells were 1.5 × 106
and 2.8 × 106 per 5-cm-diameter plate, respectively.
The ability of a cotransfected expression vector to modulate the box
activity was determined by CAT assay. (A) Autoradiogram of CAT
activities in a representative assay. (B) Diagram showing the
suppression of CAT activity produced by p /BCP-CAT in the presence of
an increasing amount of cotransfected pf:E4BP4. The diagram shows the
CAT activity exhibited by p /BCP-CAT relative to that of pBCP-CAT.
Results were quantitated by PhosphorImager counting as described in
Materials and Methods.
|
|

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 4.
Repression of the activities of the CURS and second
enhancer by E4BP4. HepG2 cells at a density of 1.4 × 106 per well in a six-well plate were either transfected
with 4 µg of pBCP-CAT or cotransfected with p /BCP-CAT,
pCURS/BCP-CAT, pNRE-CURS/BCP-CAT, pSVpCAT/ENII, pSVpCAT/ , or a
p(1687-1851)CAT control plasmid in the presence of 500 ng of either
pCMVP4 (CMV-E4BP4) or pCMVIE (CMV). The diagram shows the CAT activity
exhibited by p /BCP-CAT relative to that of pBCP-CAT. Results were
quantitated with a PhosphorImager as described in Materials and
Methods. The data represent the mean results obtained from at least
four experiments. Error bars represent the standard errors of the mean
values obtained.
|
|
Since box

is a functional element of the CURS (nt 1636 to 1741),
the effect of E4BP4 on the entire CURS was determined.
The positive
regulatory activity of the CURS was reduced sevenfold
in HepG2 cells
(Fig.
4).
Box

is an essential component of enhancer II of HBV. Enhancer II
has a unique bipartite structure, and the cooperation of
two
noncontiguous sequence motifs, box

and box

, is required
for its
function (
68). As shown in Fig.
4, E4BP4 could also
suppress
the stimulating activity of enhancer II. This suppressive
effect was
seen with the enhancer in its entirety (from nt 1636
to 1741) as well
as with its minimal essential elements (box
and box

).
We have previously identified a negative regulatory element designated
NRE. The sequence from nt 1613 to 1621 is essential
for NRE activity.
Located upstream of the CURS, NRE represses
the activity of CURS and
enhancer II (reference
44 and our unpublished
results). We then examined whether E4BP4 could suppress the
transcription-stimulatory
activity of the CURS in the presence of NRE.
A 25-fold reduction
in CAT activity was observed in HepG2 cells (Fig.
4). E4BP4 therefore
suppressed the stimulating activity of the CURS in
the absence
or presence of
NRE.
E4BP4 suppresses HBV replication.
So far, we have shown that
E4BP4 can suppress the activity of box
, which is a major component
of the CURS and enhancer II. Enhancer II activates the transcription of
both the large and middle/major surface promoters, while the CURS
activates that of the core promoter (67, 70). The negative
regulatory effects seen with E4BP4, therefore, may have a significant
impact on viral gene expression and replication. To test this, we
resorted to transient transfection with a more-than-unit-length HBV
genome, pHBV3.6, into differentiated human hepatoma HuH-7 cells. Viral gene expression and production of mature virions that closely mimic
viral infection in vivo have been seen after transfection (70). The effect of E4BP4 on the transcription and
replication of HBV was tested by cotransfecting an E4BP4 expression
plasmid, pf:E4BP4, or an empty vector, pFLAG-CMV2, with pHBV3.6. Three days after transfection, the amounts of the 2.4-kb large surface, 2.1-kb middle and major surface, and 3.5-kb precore and pregenomic transcripts were measured by Northern hybridization. The expression of
G3PDH was used as an internal control. As shown in Fig.
5B, expression of E4BP4 reduced the
expression of viral RNAs by five- to sixfold. The production of mature
virions was quantified by an endogenous DNA polymerase activity assay.
As shown in Fig. 5A, E4BP4 reduced the production of virions 20-fold.
This was seen with pf:E4BP4 but not pFLAG-CMV2. These results clearly
demonstrated that E4BP4 suppressed the gene expression and replication
of HBV.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 5.
Repression of the production of HBV virions and gene
expression by E4BP4. Forty-five micrograms of plasmid HBV3.6, which
contains a more-than-unit-length HBV viral genome, was transfected into
HuH-7 cells at a density of 1.1 × 107 cells per
15-cm-diameter plate alone (lanes 1) or with 30 µg of pFLAG-CMV2
(flag) (lanes 3) or pf:E4BP4 (lanes 2). A pSV2CAT vector, which
contains a CAT reporter gene driven by the SV40 early promoter and
72-bp enhancer, was included in all transfections as an internal
control for transfection efficiency. (A) Production of virions. Media
from the transfectants were collected 3 days after transfection to
assay for the production of HBV virions and core particles. The amounts
of virions and core particles produced were quantified by the
endogenous DNA polymerase activity assay. L and NC, linear and nicked
circular forms, respectively, of HBV DNA. Numbers on the left are
kilobases. (B) Northern blot analysis of HBV transcripts. The
intracellular RNAs were collected at day 3 posttransfection. Twenty
micrograms of total RNA of each sample was analyzed by Northern
hybridization with the entire HBV DNA as the probe. The same blot was
reprobed with G3PDH to ensure equal loading of RNA samples.
|
|
Identification of E4BP4 regions essential for the suppression of
HBV gene expression.
Earlier studies have identified a repression
domain at the C-terminal portion of E4BP4 (12, 13). To test
the involvement of this repression domain in the suppression of HBV
gene expression, we tested several E4BP4 mutants, which included a
series of C-terminal deletion mutants (pf:E4BP4
Apa, pf:E4BP4Pvu, and
pf:E4BP4
Sal) and an internal deletion mutant lacking the repression
domain (pf:E4BP4
Hae/BstB) (Fig.
6A). All of these mutants
were tagged with the FLAG epitope. These mutants were individually
cotransfected into HuH-7 cells with a reporter plasmid, p
/BCP-CAT,
or a control plasmid, p(1687-1851)CAT, which lacked the box
sequence. The levels of expression and the intracellular localizations
of E4BP4 proteins were determined by Western blotting and
immunofluorescence. The box
binding activities and the effects of
transcription suppression of these mutants were examined with gel
shifting experiments and CAT assays. All of these mutants were
expressed at roughly comparable levels (Fig. 6B). All of these mutant
proteins except f:E4BP4
Sal were localized only in the nucleus. In
Fig. 6C, the localization of a representative f:E4BP4Pvu mutant is
shown (left panel). The f:E4BP4
Sal was present mainly in the
nucleus, but a faint signal could be detected in the cytoplasm (right
panel).




View larger version (180K):
[in this window]
[in a new window]
|
FIG. 6.
Minimal essential region of E4BP4 required for
transcription repression. HuH-7 cells were cotransfected with either
p /BCP-CAT or p(1687-1851)CAT plus either pf:E4BP4 or one of the four
E4BP4 deletion constructs pf:E4BP4 Hae/BstB ( H/B), pf:E4BP4 Apa
( Apa), pf:E4BP4Pvu (Pvu), and pf:E4BP4 Sal ( Sal).
Cotransfection with an insertless pFLAG-CMV2 was also included as a
negative control. (A) Repression functions of different E4BP4 deletion
mutants. The diagram displays the repression of the CAT activity
exhibited by p /BCP-CAT or p(1687-1851)CAT by a cotransfected
wild-type E4BP4 or deletion mutants of E4BP4. The resulting CAT
activities were normalized against those obtained with a p /BCP-CAT
reporter alone. (B) Expression of E4BP4 protein by transfectants.
Protein expression by untransfected cells (un) (lanes 1 and 8) and
cells transfected with either wild-type E4BP4 (f.l) (lanes 2 and 9) or
its deletion mutants (with a whole cell lysate of 105
cells/lane) was analyzed by Western blotting with anti-FLAG monoclonal
antibody and the ECL system as described in Materials and Methods.
Numbers on the left are kilodaltons. (C) Localization of f:E4BP4Pvu and
f:E4BP4 Sal mutant proteins. The localization of f:E4BP4Pvu (left
panels) and f:E4BP4 Sal (right panels) mutant proteins was detected
with anti-FLAG monoclonal antibody and a fluorescein
isothiocyanate-conjugated goat anti-mouse IgG (bottom panels). The
nuclear DNA was stained with Hoechst 33258 (top panels). (D) DNA
binding activity of wild-type E4BP4 and its various deletion mutants.
Gel shift experiments were performed with end-labeled box oligonucleotide in the presence of 5 µg of mini-nuclear extracts
obtained from untransfected cells (lanes 14 and 15) and cells
transfected with either wild-type E4BP4 (lanes 2 and 3) or different
deletion mutants of E4BP4 (lanes 4 to 11). For lanes 3, 5, 7, 9, 11, 13, and 15, 3 µg of anti-FLAG monoclonal antibody ( flag) was
added for supershifting. No antibody was added in lanes 2, 4, 6, 8, 10, 12, and 14.
|
|
Nuclear extracts of transfected HuH-7 cells were prepared to examine
the box

binding activities of these different E4BP4
mutant
proteins. Supershifting with anti-FLAG antibody was done
to verify the
specific binding of box

by E4BP4. As shown in
Fig.
6D, most of
these mutants could bind to box

. In contrast,
the f:E4BP4

Sal
mutant did not bind to box

despite its predominant
localization in
the nucleus. It has been shown that E4BP4 dimers
bind to DNA much
better than monomers (
12). The mutant f:E4BP4

Sal
lacks
the leucine zipper dimerization domain but retains a basic
region. The
fact that f:E4BP4

Sal could not bind to box

most
likely resulted
from its inability to form dimers. Mutants containing
the DNA binding
domain suppressed the activity of the reporter
plasmid, p

/BCP-CAT.
The f:E4BP4Pvu mutant, which contained an
intact DNA binding domain,
suppressed the activity of box

with
the same efficiency as the
wild-type f:E4BP4 (Fig.
6A). These
results showed that the ability to
bind to box

, but not the
presence of the repression domain, was
essential for the suppression
of box

activity by E4BP4.
Interestingly, only wild-type f:E4BP4
repressed the activity of
p(1687-1851)CAT. These results indicated
that suppression of box

or
basal promoter activity is mediated
by different domains. DNA binding
activity is required for the
suppression of the
transcription-stimulatory effect of box

.
The repression domain, in
contrast, is essential for the repression
of basal promoter
activity.
Negative regulatory effects of E4BP4 in human hepatoma cells.
Northern hybridization was performed to analyze the expression pattern
of E4BP4. A 1.9-kb E4BP4 transcript was detected in total RNAs
extracted from HepG2 and HuH-7 cells, which are differentiated human
hepatoma cell lines (Fig. 7A). As a
control, the blot was reprobed with a radiolabeled G3PDH cDNA for equal
loading of RNA samples. In addition, poly(A)+ RNAs from a
variety of human tissues were subjected to Northern blot analysis. The
1.9-kb E4BP4 message could be detected in all tissues. Modest
expression was seen in brain, liver, and thymus, while very strong
expression was seen in peripheral blood leukocytes, skeletal muscle,
and testis (Fig. 7B). These blots were subsequently reprobed with a
radiolabeled human
-actin cDNA to ensure equal loading. The modest
level of E4BP4 expression in liver was in line with the observation
that there was very little supershifting by anti-E4BP4 antibody of box
binding activity in nuclear extracts derived from untransfected
HepG2 and HuH-7 cells (Fig. 2B). To test the involvement of E4BP4 in
the negative regulation of HBV promoters, we overexpressed an E4BP4
antisense transcript and measured the transcriptional activity of a
cotransfected basal core promoter. The E4BP4 antisense transcript was
driven by the CMV promoter, while an insertless vector containing only
the CMV promoter was used as a negative control. As shown in Fig.
8, the activity of the basal core
promoter in the presence of an upstream box
or the CURS was
increased by threefold. The activation of the basal core promoter by
another upstream element containing nt 1687 to 1743, was not
significantly affected.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 7.
Expression of E4BP4 RNA. (A) Expression of E4BP4 mRNA in
the human hepatoma cell lines HuH-7 and HepG2. Thirty-five micrograms
each of total RNAs from HuH-7 (lane 1) and HepG2 (lane 2) cells was
loaded for Northern blotting. The filter was probed with a 554-bp
EcoRI fragment of E4BP4 cDNA (upper panel) or G3PDH cDNA
(lower panel). Numbers on the left are kilobases. (B) Expression of
E4BP4 mRNA in various human tissues. Approximately 2 µg of
poly(A)+ RNAs from various human tissues (Clontech) was
used for Northern blot analysis. The tissue origins of the RNA samples
are indicated. The filters were probed with a 554-bp EcoRI
fragment of E4BP4 cDNA (upper panel) or -actin cDNA (lower panel).
Probing with either G3PDH or -actin is to ensure approximately equal
loading of RNA samples. PB, peripheral blood.
|
|

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 8.
Elevation of the activities of box and the CURS by
E4BP4 antisense RNA. Three micrograms of plasmid p /BCP-CAT,
pCURS/BCP-CAT, or p(1687-1851)CAT was cotransfected with either 3 µg
of pCMV4Ns/s, which is an antisense E4BP4 expression construct, or 2.35 µg of a control vector, pCMVIE (CMV), into HuH-7 (top panel) and
HepG2 (bottom panel) cells. The promoter activity of p /BCP-CAT,
pCURS/BCP-CAT, or p(1687-1851)CAT was measured by CAT assay. The CAT
activity exhibited by each promoter in cells cotransfected with the
antisense construct is normalized against that in cells cotransfected
with the control vector pCMVIE. Error bars indicate standard errors of
the means.
|
|
The results described above indicate that there is a low abundance of
E4BP4 protein and mRNA in liver and differentiated human
hepatoma cell
lines and that E4BP4 is not a major component of
box

binding
proteins in untransfected HepG2 and HuH-7 cells.
Despite this, the
amount of E4BP4 appears to be sufficient to
exert a negative regulatory
effect on the HBV core promoter in
these differentiated human hepatoma
cell lines. In support of
this argument, a small amount of E4BP4 can
significantly suppress
the activity of box

, as shown in Fig.
3.
E4BP4-mediated suppression of transcription.
Box
stimulated the basal core promoter activity in HuH-7 and HepG2 cells.
Box
is also an essential component of enhancer II. E4BP4, however,
suppressed the stimulatory function of box
in the context of the
CURS and enhancer II. E4BP4 does not appear to be a major component of
box
binding proteins in HepG2 and HuH-7 cells. For example, the box
sequence (CAAGGTCTTACATAAGAGGACTCTT [nt 1645 to 1669])
is similar to the consensus C/EBP binding site (A/G/C)T(T/G)NNG(T/C)AA(T/G). We previously reported that box
binding proteins were C/EBP-like proteins (68). To test
whether members of the C/EBP family are present among box
binding
proteins in HepG2 and HuH-7 cells, gel shift experiments were performed with the labeled box
sequence in the presence of, as unlabeled competing sequences, the C/EBP consensus sequence or the mutant box
sequence AB, CD, or EF. As shown in Fig.
9A, mutant EF, carrying mutations in box
and the C/EBP consensus sequence, but not mutants AB and CD,
carrying mutations in box
, could compete as effectively for box
binding as the wild-type box
sequence. This shows that these
endogenous C/EBP-like proteins have the same binding site specificity
as E4BP4. We have noticed that EF could compete for box
binding,
which was different from our previous observation (68).
These gel shift and competition experiments were done as previously
described except that 5 instead of 10 µg of nuclear extract was used.
Whether this minor modification or other conditions that we could not
control for led to this change in result is not clear. This result,
however, does not change our conclusion that C/EBP-like proteins are
major box
binding proteins in liver cells (see Fig. 9B and C and
Discussion).


View larger version (94K):
[in this window]
[in a new window]
|
FIG. 9.
C/EBP and C/EBP are box binding proteins. (A)
Binding site specificity of endogenous box binding protein
determined by gel shift experiments in the presence of competing
oligonucleotides in excess. The relative efficiencies of wild-type box
(WT) (Lanes 3 to 5), three mutated forms of box sequences (AB
[lanes 6 and 7], CD [lanes 8 and 9], and EF [lanes 10 and 11]), a
C/EBP consensus sequence (lanes 12 and 13), and nonspecific competitor
HNF1 (lane 14) in abolishing box DNA-protein complexes formed by
endogenous box binding proteins present in nuclear extracts are
shown. Lane 1, no protein; lane 2, 5 µg of nuclear protein of the 0.5 M NaCl eluent from HepG2 cells and no competitor; lanes 3 to 14, 5 µg
of nuclear protein of the 0.5 M NaCl eluent form HepG2 cells in the
presence of different unlabeled competitors at various molar excesses
as indicated. (B and C) supershifting of box binding complexes
formed by nuclear extracts by antibodies against different members of
the C/EBP family. Lane 1, no protein; lane 2, 5 µg of nuclear protein
of the 0.5 M NaCl fraction from HuH-7 (B) or HepG2 (panel C) cells;
lanes 3 to 6, cold wild-type box , AB, CD, or C/EBP consensus
sequence was added at a 125-fold molar excess for competition
experiments; lanes 7 to 13, anti-C/EBP , anti-C/EBP , and
anti-C/EBP antibodies (0.5 µg each) alone or in combinations were
added for supershifting.
|
|
To identify which C/EBP family protein(s) could bind to the box

DNA
sequence, anti-C/EBP

, -

, and -

antibodies were used
in
supershift experiments. Anti-C/EBP

antibody could significantly
supershift the protein-DNA complexes formed by the box

sequence
after incubation with nuclear extracts derived from HuH-7 (Fig.
9B) and
HepG2 (Fig.
9C) cells. Anti-C/EBP

antibody caused modest
supershifting. Anti-C/EBP

antibody did not display any apparent
activity. When combinations of anti-C/EBP antibodies were tested,
a
mixture of anti-C/EBP

and anti-C/EBP

antibodies supershifted
almost all of the box

-protein complexes. Identical results were
obtained with nuclear extracts derived from HepG2 and HuH-7 cells.
C/EBP

and C/EBP

, therefore, can bind to the box

sequence in
both HuH-7 and HepG2 cells, where box

displays stimulating
activity.
E4BP4 and endogenous box

binding proteins apparently all bind to
the same sequence in box

. We then tested whether binding
site
occlusion might be the mechanism of suppression mediated
by E4BP4. In
this scenario, occupancy of box

by E4BP4 might
hinder the binding,
and therefore the function, of positive regulatory
factors such as
endogenous box

binding proteins. To test this
possibility,
fractionated nuclear extracts of HuH-7 and HepG2
cells were incubated
with labeled box

sequences in the presence
of increasing amounts of
recombinant E4BP4 protein. The DNA-protein
complexes formed by box

and endogenous box

binding proteins
migrated differently from that
formed by box

and E4BP4. As shown
in Fig.
10, recombinant E4BP4 could compete out
the endogenous
proteins present in nuclear extracts in binding to box

in a
dose-dependent manner. We then determined the binding affinity
of recombinant E4BP4 and endogenous box

binding proteins for
the
box

sequence by Scatchard plot analysis. For Scatchard plot
analysis, known amounts of recombinant E4BP4 protein and a 0.5
M NaCl
fraction of nuclear extracts obtained from HuH-7 cells
were incubated
with increasing amounts of end-labeled box

oligonucleotides
ranging
from 0.032 to 1.411 ng. The resulting protein-DNA complexes
were
separated on a 4% polyacrylamide gel. After drying of the
gels, the
bands representing the free and bound oligonucleotides
were identified,
and their relative intensities were quantified
with a Molecular
Dynamics PhosphorImager. Scatchard plots were
done by plotting the
ratio of the amount of the protein bound
DNA to that of the free DNA
against the amount of protein-bound
DNA. Recombinant E4BP4 protein and
a 0.5 M NaCl fraction of nuclear
extracts obtained from HuH-7 cells had
apparent dissociation constants
of 0.08 and 0.26 nM, respectively (Fig.
11). Recombinant E4BP4,
therefore,
bound to the box

sequence with a stronger affinity
than endogenous
box

binding proteins (threefold stronger).

View larger version (89K):
[in this window]
[in a new window]
|
FIG. 10.
Competition for binding to the box sequence by
recombinant E4BP4 and the endogenous box binding activity present
in nuclear extracts. The ability of recombinant E4BP4 protein to
outcompete endogenous box binding activity present in nuclear
extracts was determined. Gel shift competition experiments were
performed with end-labeled wild-type box oligonucleotide and 7.5 µg of protein prepared from the 0.5 M NaCl fraction of HuH-7 (lanes 2 to 5) or HepG2 (lanes 6 to 9) nuclear extracts. Mixtures were
preincubated with 1 (lanes 3 and 7), 2 (lanes 4 and 8), or 4 (lanes 5 and 9) µl of recombinant E4BP4 protein before loading. Lane 1, box
alone; lane 10, mixture of box and 4 µl of recombinant E4BP4
protein.
|
|

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 11.
Binding affinities of recombinant E4BP4 and the
endogenous box binding activity towards the box sequence
(Scatchard plot analysis). A series of gel shift assays were performed
with fixed amounts of the 0.5 M NaCl fraction of HuH-7 nuclear extracts
(NE) or recombinant E4BP4 protein in the presence of increasing amounts
of 32P-end-labeled box oligonucleotides. The bands
representing free and bound oligonucleotides were identified and
isolated. After drying, the radioactivities of these bands were
quantified with a Molecular Dynamics PhosphorImager. The dissociation
constants (Kd) were determined by the standard method of Scatchard plot
analysis.
|
|
 |
DISCUSSION |
In this paper, we describe the cloning of a bZIP type of
transcription factor, E4BP4, that specifically binds to the box
sequence in HBV. Box
is an essential element of both the CURS and
the second enhancer, which positively regulate the transcription of HBV
genes (68, 70). E4BP4 appears to function as a negative transcription regulator at box
. Overexpression of E4BP4 represses the stimulating activity of box
in the CURS and the second enhancer in constructs containing CAT reporters. E4BP4 can also repress the
transcription of HBV genes and the production of HBV virions in a
transient-transfection system that mimics the viral infection in vivo.
In addition, expression of an E4BP4 antisense construct can elevate the
transcription of HBV genes.
The following results suggest that binding site occlusion is the
mechanism whereby E4BP4 suppresses transcription in HBV: (i) E4BP4 and
the endogenous box
binding protein(s) bind to the same sequence in
box
, (ii) E4BP4 readily outcompetes the endogenous box
binding
activity present in nuclear extracts in a dose-dependent manner, (iii)
E4BP4 has a stronger binding affinity towards the box
sequence than
the endogenous box
binding activity present in nuclear extracts,
(iv) examination of the structure-function relationship of E4BP4
reveals that DNA binding activity is sufficient to confer the negative
regulatory function of E4BP4, and (v) E4BP4 does not bind either
C/EBP
or C/EBP
to a significant extent when coexpressed in human
hepatoma cells (data not shown).
In addition to box
, E4BP4 also binds to the E4 promoter of
adenovirus, the IL-1
promoter, the gamma interferon promoter, and
the A site of the IL-3 promoter. Among these promoters, overexpression of E4BP4 has been shown to suppress the transcriptional activity of the
E4 promoter of adenovirus and the IL-1
promoter like that of box
. The exact repression mechanism of E4BP4 on the E4 and IL-1
promoters has not been completely elucidated. It is not clear, for
example, if positive factors bind to overlapping or identical sites in
these promoters and if E4BP4 functions by binding site occlusion as is
the ease for box
of HBV (11, 12). An earlier report
showed that E4BP4 could act as an active repressor to suppress the
transcriptional activity of a basal promoter in the presence of an
E4BP4 binding site, probably via an interaction with Dr1 (13,
14). Dr1 is a TBP binding protein, which can down regulate both
basal and activated transcription at a variety of promoters (28,
66). In the same report, a repression domain that was required
for suppression of transcription and interaction with Dr1 by E4BP4 was
described (14). This repression domain, however, is not
required for the repression of the activity of box
in HBV. E4BP4,
therefore, represses HBV transcription by binding site occlusion rather
than by acting as an active repressor. Interestingly, E4BP4 may also
function as an activator of transcription. Overexpression of E4BP4
(NF-IL3A) activates the transcriptional activity of the A site of the
IL-3 promoter in a binding-site-specific manner (27, 71).
Furthermore, although E4BP4 can bind to the human gamma interferon
promoter, it does not confer either an activating or a repressing
function (71). It is possible that the different regulation
by E4BP4 is influenced by the nucleotide sequences surrounding the
specific binding sites, the presence or absence of other factors
binding to overlapping or identical sites, and/or the presence or
absence of proteins interacting with E4BP4.
Mutant EF can compete fairly efficiently with the wild-type sequence in
binding to cellular factors present in a 0.5 M NaCl fraction. This
result appears to be at odds with that of our prior study that the EF
mutant will not bind to cellular factors in extracts prepared in
similar ways (68). The reason for this discrepancy is
unknown. The fact that anti-C/EBP
and -
antibodies can almost
completely supershift the box
binding activity nevertheless strongly supports our conclusion that C/EBP
and -
are major box
binding factors.
Box
is an essential component of both the CURS and the second
enhancer. In both cases, it has a stimulatory effect in the differentiated human hepatoma cell lines HuH-7 and HepG2 (68, 70). E4BP4 does not appear to be a major component of the box
binding activity, and E4BP4 is present in low abundance in HuH-7 or
HepG2 cells. Given the strong binding affinity of E4BP4 towards box
and the ability of a small amount of E4BP4 to significantly suppress
the activity of box
, E4BP4 appears to be at a sufficient level to
exert a negative regulatory effect on HBV transcription and
replication. C/EBP
and C/EBP
, in contrast, are major components of the box
binding activity present in nuclear extracts as
demonstrated by supershift experiments. Overexpression of C/EBP
or
C/EBP
can potentiate the stimulating activity of box
(data not
shown). Moreover, recombinant C/EBP
protein can bind to the same
sequence in box
as recombinant E4BP4 and the endogenous box
binding activity present in nuclear extracts (data not shown). However, the DNA-protein complexes formed by endogenous box
binding activity derived from nuclear extracts migrated differently from those formed by
homodimers of either C/EBP
or C/EBP
(data not shown). These
results suggested that both C/EBP
and C/EBP
would heterodimerize with each other or with other binding proteins when binding to the box
sequence. In addition to the formation of homodimers, C/EBPs have
been reported to form heterodimers with other C/EBP family members or
other bZIP proteins such as CREB, C/ATF, and AP1 (18, 26, 33, 34,
37, 38, 48, 61-65). C/EBPs may also interact with proteins that
do not contain leucine zippers, such as YY1, Rb, Rel, NF-
B, Sp1,
TBP, TFIIB, or glucocorticoid receptor (3, 10, 16, 39-41, 45, 46,
58-60). The nature of the partners that heterodimerize with
either C/EBP
or C/EBP
to form the endogenous box
binding
activity in nuclear extracts is yet to be determined.
Transcription of HBV genes displays a strong preference for liver and
differentiated hepatoma cell lines (2, 7, 17, 22). This
preference has been attributed to the circumscribed action of
certain liver-enriched transcription activators, including HNF1, HNF3,
and HNF4, binding to the cis-acting regulatory elements present in the HBV genome (for example, HNF3 and HNF4 on both the X
promoter/enhancer I and core promoter/enhancer II and HNF1 and HNF4 on
the large surface promoter) (8, 9, 19, 23, 30, 43, 47, 49, 50, 51,
72). On the other hand, E4BP4 is a negative transcription factor
for HBV transcription. It is intriguing that E4BP4 transcripts are
present in larger amounts in many tissues other than liver. The potent
suppression of box
activity by E4BP4 may contribute to the
preferential silencing of HBV gene expression in tissues other than liver.
 |
ACKNOWLEDGMENTS |
We are grateful to Shiuh-Wen Luoh for stimulating discussions
during the course of these experiments and for critical reading of the manuscript.
This study was supported by research grants
NSC-83-0419-B010-081MH, NSC-84-2331-B010-032MH,
NSC-85-2331-B010-003MH, NSC86-2314-B-010-036, and
NSC87-2315-B-010-002-MH from the National Science Council and
V86-349 and V87-401 from the Veterans General Hospital, Republic of China.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institute of
Microbiology and Immunology, School of Life Science, National Yang-Ming University, Shih-Pai, Taipei 11221, Taiwan. Phone: 886-2-28222400. Fax:
886-2-28212880. E-mail: lpting{at}ym.edu.tw.
 |
REFERENCES |
| 1.
|
Akira, S.,
H. Isshiki,
T. Sugita,
O. Tanabe,
S. Kinoshita,
Y. Nishio,
T. Nakajima,
T. Hirano, and T. Kishimoto.
1990.
A nuclear factor for IL-6 expression (NF-IL6) is a member of a C/EBP family.
EMBO J.
9:1897-1906[Medline].
|
| 2.
|
Araki, K.,
J. Miyazaki,
O. Hino,
N. Tomita,
O. Chisaka,
K. Matsubara, and K. Yamamura.
1989.
Expression and replication of hepatitis B virus genome in transgenic mice.
Proc. Natl. Acad. Sci. USA
86:207-211[Abstract/Free Full Text].
|
| 3.
|
Bauknecht, T.,
R. H. See, and Y. Shi.
1996.
A novel C/EBP -YY1 complex controls the cell-type-specific activity of the human papillomavirus type 18 upstream regulatory region.
J. Virol.
70:7695-7705[Abstract].
|
| 4.
|
Cao, X.,
S. L. Teitelbaum,
H.-J. Zhu,
L. Zhang,
X. Feng, and F. P. Ross.
1996.
Competition for a unique response element mediates retinoic acid inhibition of vitamin D3-stimulated transcription.
J. Biol. Chem.
271:20650-20654[Abstract/Free Full Text].
|
| 5.
|
Cao, Z.,
R. M. Umek, and S. L. McKnight.
1991.
Regulated expression of three C/EBP isoforms during adipose conversion of 3T3-L1 cells.
Genes Dev.
5:1538-1552[Abstract/Free Full Text].
|
| 6.
|
Chang, C.-J.,
T.-T. Chen,
H.-Y. Lei,
D.-S. Chen, and S.-C. Lee.
1990.
Molecular cloning of a transcription factor, AGP/EBP, that belongs to members of the C/EBP family.
Mol. Cell. Biol.
10:6642-6653[Abstract/Free Full Text].
|
| 7.
|
Chang, H.-K., and L.-P. Ting.
1989.
The surface gene promoter of the human hepatitis B virus displays a preference for differentiate hepatocytes.
Virology
170:176-183[Medline].
|
| 8.
|
Chang, H.-K.,
B.-Y. Wang,
C.-L. Wei, and L.-P. Ting.
1989.
A liver-specific nuclear factor interacts with the promoter region of the large surface protein gene of human hepatitis B virus.
Mol. Cell. Biol.
9:5189-5197[Abstract/Free Full Text].
|
| 9.
|
Chen, M.,
S. Hieng,
X. Qian,
R. Costa, and J. H. Ou.
1994.
Regulation of hepatitis B virus ENI activity by hepatocyte-enriched transcription factor HNF3.
Virology
205:127-132[Medline].
|
| 10.
|
Chen, P.-L.,
D. J. Riley,
S. Chen-Kiang, and W.-H. Lee.
1996.
Retinoblastoma protein directly interacts with and activates the transcription factor NF-IL6.
Proc. Natl. Acad. Sci. USA
93:465-469[Abstract/Free Full Text].
|
| 11.
|
Chen, W. J.,
K. S. Lewis,
G. Chandra,
J. P. Cogswell,
S. W. Stinnett,
S. H. Kadwell, and J. G. Gray.
1995.
Characterization of human E4BP4, a phosphorylated bZIP factor.
Biochim. Biophys. Acta
1264:388-396[Medline].
|
| 12.
|
Cowell, I. G.,
A. Skinner, and H. C. Hurst.
1992.
Transcriptional repression by a novel member of the bZIP family of transcription factors.
Mol. Cell. Biol.
12:3070-3077[Abstract/Free Full Text].
|
| 13.
|
Cowell, I. G., and H. C. Hurst.
1994.
Transcriptional repression by the human bZIP factor E4BP: definition of a minimal repression domain.
Nucleic Acids Res.
22:59-65[Abstract/Free Full Text].
|
| 14.
|
Cowell, I. G., and H. C. Hurst.
1996.
Protein-protein interaction between the transcriptional repressor E4BP4 and the TBP-binding protein Dr1.
Nucleic Acids Res.
24:3607-3613[Abstract/Free Full Text].
|
| 15.
|
Descombes, P.,
M. Chojkier,
S. Lichtsteiner,
E. Falvey, and U. Schibler.
1990.
LAP, a novel member of the C/EBP gene family, encodes a liver-enriched transcriptional activator protein.
Genes Dev.
4:1541-1551[Abstract/Free Full Text].
|
| 16.
|
Diehl, J. A., and M. Hannink.
1994.
Identification a C/EBP-Rel complex in avian lymphoid cells.
Mol. Cell. Biol.
14:6635-6646[Abstract/Free Full Text].
|
| 17.
|
Farza, H.,
M. Hadchouel,
J. Scotto,
P. Tiollais,
C. Babinet, and C. Pourcel.
1988.
Replication and gene expression of hepatitis B virus in a transgenic mouse that contains the complete viral genome.
J. Virol.
62:4144-4152[Abstract/Free Full Text].
|
| 18.
|
Fawcett, T. W.,
H. B. Eastman,
J. L. Martindale, and N. J. Holbrook.
1996.
Physical and functional association between GADD153 and CCAAT/enhancer-binding protein during cellular stress.
J. Biol. Chem.
271:14285-14289[Abstract/Free Full Text].
|
| 19.
|
Garcia, A. D.,
P. Ostapchuk, and P. Hearing.
1993.
Functional interaction of nuclear factors EF-C, HNF-4, and RXR with hepatitis B virus enhancer I.
J. Virol.
67:3940-3950[Abstract/Free Full Text].
|
| 20.
|
Gray, S., and M. Levine.
1996.
Transcriptional repression in development.
Curr. Opin. Cell Biol.
8:358-364[Medline].
|
| 21.
|
Gray, S.,
P. Szymanski, and M. Levine.
1994.
Short-range repression permits multiple enhancers to function autonomously within a complex promoter.
Genes Dev.
8:1829-1838[Abstract/Free Full Text].
|
| 22.
|
Guidotti, L. G.,
B. Matzke,
H. Schaller, and F. V. Chisari.
1995.
High-level hepatitis B virus replication in transgenic mice.
J. Virol.
69:6158-6169[Abstract].
|
| 23.
|
Guo, W.,
M. Chen,
T. S. B. Yen, and J.-H. Ou.
1993.
Hepatocyte-specific expression of the hepatitis B virus core promoter depends on both positive and negative regulation.
Mol. Cell. Biol.
13:443-448[Abstract/Free Full Text].
|
| 24.
|
Hanna-Rose, W., and U. Hansen.
1996.
Active repression mechanisms of eukaryotic transcription repressors.
Trends Genet.
12:229-234[Medline].
|
| 25.
|
Herschbach, B. M., and A. D. Johnson.
1993.
Transcriptional repression in eukaryotes.
Annu. Rev. Cell Biol.
9:479-509.
|
| 26.
|
Hsu, W.,
T. K. Kerppola,
P.-L. Chen,
T. Curran, and S. Chen-Kiang.
1994.
Fos and Jun repress transcription activation by NF-IL6 through association at the basic zipper region.
Mol. Cell. Biol.
14:268-276[Abstract/Free Full Text].
|
| 27.
|
Ikushima, S.,
T. Inukai,
T. Inaba,
S. D. Nimer,
J. L. Cleveland, and A. T. Look.
1997.
Pivotal role for the NFIL3/E4BP4 transcription factor in interleukin 3-mediated survival of pro-B lymphocytes.
Proc. Natl. Acad. Sci. USA
94:2609-2614[Abstract/Free Full Text].
|
| 28.
|
Inostroza, J. A.,
F. H. Mermelstein,
I. Ha,
W. S. Lane, and D. Reinberg.
1992.
Dr1, a TATA-binding protein-associated phosphoprotein and inhibitor of class II gene transcription.
Cell
70:477-489[Medline].
|
| 29.
|
Jackson, M. E.
1991.
Negative regulation of eukaryotic transcription.
J. Cell Sci.
100:1-7[Free Full Text].
|
| 30.
|
Johnson, J. L.,
A. K. Raney, and A. McLachlan.
1995.
Characterization of a functional hepatocyte nuclear factor 3 binding site in the hepatitis B virus nucleocapsid promoter.
Virology
208:147-158[Medline].
|
| 31.
|
Johnson, P. F.,
W. H. Landschulz,
B. J. Graver, and S. L. McKnight.
1987.
Identification of a rat liver nuclear protein that binds to the enhancer core element of three animal viruses.
Genes Dev.
1:133-146[Abstract/Free Full Text].
|
| 32.
|
Katz, S.,
E. Kowenz-Leutz,
C. Muller,
K. Meese,
S. A. Ness, and A. Leutz.
1993.
The NF-M transcription factor is related to C/EBP and play a role in signal transduction, differentiation and leukemogenesis of avian myelomonocytic cells.
EMBO J.
12:1321-1332[Medline].
|
| 33.
|
Kinoshita, S.,
S. Akira, and T. Kishimoto.
1992.
A member of the C/EBP family, NF-IL6 , forms a heterodimer and transcriptionally synergizes with NF-IL6.
Proc. Natl. Acad. Sci. USA
89:1473-1476[Abstract/Free Full Text].
|
| 34.
|
Klampfer, L.,
T. H. Lee,
W. Hsu,
J. Vilcek, and S. Chen-Kiang.
1994.
NF-IL6 and AP-1 cooperatively modulate the activation of the TSG-6 gene by tumor necrosis factor alpha and interleukin-1.
Mol. Cell. Biol.
14:6561-6569[Abstract/Free Full Text].
|
| 35.
|
Lamb, P., and S. L. McKnight.
1991.
Diversity and specificity in transcriptional regulation: the benefits of heterotypic dimerization.
Trends Biochem. Sci.
16:417-422[Medline].
|
| 36.
|
Landschulz, W. H.,
P. F. Johnson,
E. Y. Adashi,
B. J. Graves, and S. L. McKnight.
1988.
Isolation of a recombinant copy of the gene encoding C/EBP.
Genes Dev.
2:786-800[Abstract/Free Full Text].
|
| 37.
|
Landschulz, W. H.,
P. F. Johnson, and S. L. McKnight.
1988.
The leucine zipper: a hypothetical structure common to a new class of DNA binding proteins.
Science
240:1759-1764[Abstract/Free Full Text].
|
| 38.
|
Landschulz, W. H.,
P. F. Johnson, and S. L. McKnight.
1989.
The DNA binding domain of the rat liver nuclear protein C/EBP is bipartite.
Science
243:1681-1688[Abstract/Free Full Text].
|
| 39.
|
LeClair, K. P.,
M. A. Blanar, and P. A. Sharp.
1992.
The p50 subunit of NF- B associates with NF-IL6 transcription factor.
Proc. Natl. Acad. Sci. USA
89:8145-8149[Abstract/Free Full Text].
|
| 40.
|
Lee, Y.-H.,
M. Yano,
S.-Y. Liu,
E. Matsunaga,
P. F. Johnson, and F. J. Gonzalez.
1994.
A novel cis-acting element controlling the rat CYP2D5 gene and requiring cooperativity between C/EBP and an Sp1 factor.
Mol. Cell. Biol.
14:1383-1394[Abstract/Free Full Text].
|
| 41.
|
Lee, Y.-H.,
S. C. Williams,
M. Baer,
E. Sterneck,
F. J. Gonzalez, and P. F. Johnson.
1997.
The ability of C/EBP but not C/EBP to synergize with an Sp1 protein is specified by the leucine zipper and activation domain.
Mol. Cell. Biol.
17:2038-2047[Abstract].
|
| 42.
|
Levine, M., and J. L. Manley.
1989.
Transcriptional repression of eukaryotic promoters.
Cell
59:405-408[Medline].
|
| 43.
|
Li, M.,
Y.-H. Xie,
X. Wu,
Y.-Y. Kong, and Y. Wang.
1995.
HNF3 binds and activates the second enhancer, ENII, of hepatitis B virus.
Virology
214:371-378[Medline].
|
| 44.
|
Lo, W.-Y., and L.-P. Ting.
1994.
Repression of enhancer II activity by a negative regulatory element in the hepatitis B virus genome.
J. Virol.
68:1758-1764[Abstract/Free Full Text].
|
| 45.
|
Nerlov, C., and E. B. Ziff.
1995.
CCAAT/enhancer binding protein- amino acid motifs with dual TBP and TFIIB binding ability co-operate to activate transcription in both yeast and mammalian cells.
EMBO J.
14:4318-4328[Medline].
|
| 46.
|
Nishio, Y.,
H. Isshiki,
T. Kishimoto, and S. Akira.
1993.
A nuclear factor for interleukin-6 expression (NF-IL6) and the glucocorticoid receptor synergistically activate transcription of the rat 1-acid glycoprotein gene via direct protein-protein interaction.
Mol. Cell. Biol.
13:1854-1862[Abstract/Free Full Text].
|
| 47.
|
Ori, A., and Y. Shaul.
1995.
Hepatitis B virus enhancer binds and is activated by the hepatocyte nuclear factor 3.
Virology
207:98-106[Medline].
|
| 48.
|
Poli, V.,
F. P. Mancini, and R. Cortese.
1990.
IL-6DBP, a nuclear protein involved in interleukin-6 signal transduction, defines a new family of leucine zipper proteins related to C/EBP.
Cell
63:643-653[Medline].
|
| 49.
|
Raney, A. K.,
A. J. Easton,
D. R. Milich, and A. McLachlan.
1991.
Promoter-specific transactivation of hepatitis B virus transcription by a glutamine- and proline-rich domain of hepatocyte nuclear factor 1.
J. Virol.
65:5774-5781[Abstract/Free Full Text].
|
| 50.
|
Raney, A. K.,
J. L. Johnson,
C. N. A. Palmer, and A. McLachlan.
1997.
Members of the nuclear receptor superfamily regulate transcription from the hepatitis B virus nucleocapsid promoter.
J. Virol.
71:1058-1071[Abstract].
|
| 51.
|
Raney, A. K.,
P. Zhang, and A. McLachlan.
1995.
Regulation of transcription from the hepatitis B virus large surface antigen promoter by hepatocyte nuclear factor 3.
J. Virol.
69:3265-3272[Abstract].
|
| 52.
|
Renkawitz, R.
1990.
Transcriptional repression in eukaryotes.
Trends Genet.
6:192-197[Medline].
|
| 53.
|
Roman, C.,
J. S. Platero,
J. Shuman, and K. Calame.
1990.
Ig/EBP-1: a ubiquitously expressed immunoglobulin enhancer binding protein that is similar to C/EBP and heterodimerizes with C/EBP.
Genes Dev.
4:1404-1415[Abstract/Free Full Text].
|
| 54.
|
Ron, D., and J. F. Habener.
1992.
CHOP, a novel developmentally regulated nuclear protein that dimerizes with transcription factors C/EBP and LAP and functions as a dominant-negative inhibitor of gene transcription.
Genes Dev.
6:439-453[Abstract/Free Full Text].
|
| 55.
|
Scatchard, G.
1949.
The attractions of proteins for small molecules and ions.
Ann. N.Y. Acad. Sci.
51:660-673.
|
| 56.
|
Schreiber, E.,
P. Matthias,
M. M. Müller, and W. Schaffner.
1989.
Rapid detection of octamer binding proteins with "mini-extract", prepared from a small number of cells.
Nucleic Acids Res.
17:6419[Free Full Text].
|
| 57.
|
Singh, H.
1993.
Specific recognition site probes for isolating genes encoding DNA-binding proteins.
Methods Enzymol.
218:551-567[Medline].
|
| 58.
|
Stein, B., and A. S. Baldwin, Jr.
1993.
Distinct mechanisms for regulation of the interleukin-8 gene involve synergism and cooperativity between C/EBP and NF- B.
Mol. Cell. Biol.
13:7191-7198[Abstract/Free Full Text].
|
| 59.
|
Stein, B., and M.-X. Yang.
1995.
Repression of the interleukin-6 promoter by estrogen receptor is mediated by NF- B and C/EBP .
Mol. Cell. Biol.
15:4971-4979[Abstract].
|
| 60.
|
Stein, B.,
P. C. Cogswell, and A. S. Baldwin, Jr.
1993.
Functional and physical associations between NF- B and C/EBP family members: a Rel domain-bZIP interaction.
Mol. Cell. Biol.
13:3964-3974[Abstract/Free Full Text].
|
| 61.
|
Tsukada, J.,
K. Saito,
W. R. Waterman,
A. C. Webb, and P. E. Auron.
1994.
Transcription factors NF-IL6 and CREB recognize a common essential site in the human prointerleukin 1 gene.
Mol. Cell. Biol.
14:7285-7297[Abstract/Free Full Text].
|
| 62.
|
Ubeda, M.,
X.-Z. Wang,
H. Zinszner,
I. Wu,
J. F. Habener, and D. Ron.
1996.
Stress-induced binding of the transcription factor CHOP to a novel DNA control element.
Mol. Cell. Biol.
16:1479-1489[Abstract].
|
| 63.
|
Vallejo, M.,
D. Ron,
C. P. Miller, and J. F. Habener.
1993.
C/ATF, a member of the activating transcription factor family of DNA-binding proteins, dimerizes with CCAAT/enhancer-binding proteins and directs their binding to cAMP response elements.
Proc. Natl. Acad. Sci. USA
90:4679-4683[Abstract/Free Full Text].
|
| 64.
|
Vinson, C. R.,
P. B. Sigler, and S. L. McKnight.
1989.
Scissors-grip model for DNA recognition by a family of leucine zipper proteins.
Science
246:911-916[Abstract/Free Full Text].
|
| 65.
|
Williams, S. C.,
C. A. Cantwell, and P. F. Johnson.
1991.
A family of C/EBP-related proteins capable of forming covalently linked leucine zipper dimers in vitro.
Genes Dev.
5:1553-1567[Abstract/Free Full Text].
|
| 66.
|
Yeung, K. C.,
J. A. Inostroza,
F. H. Mermelstein,
C. Kannabiran, and D. Reinberg.
1994.
Structure-function analysis of the TBP-binding protein Dr1 reveals a mechanism for repression of class II gene transcription.
Genes Dev.
8:2097-2109[Abstract/Free Full Text].
|
| 67.
|
Yuh, C.-H., and L.-P. Ting.
1990.
The genome of hepatitis B virus contains a second enhancer: cooperation of two elements within this enhancer is required for its function.
J. Virol.
64:4281-4287[Abstract/Free Full Text].
|
| 68.
|
Yuh, C.-H., and L.-P. Ting.
1991.
C/EBP-like proteins binding to the functional box- and box- of the second enhancer of hepatitis B virus.
Mol. Cell. Biol.
11:5044-5052[Abstract/Free Full Text].
|
| 69.
|
Yuh, C.-H., and L.-P. Ting.
1993.
Differentiated liver cell specificity of the second enhancer of hepatitis B virus.
J. Virol.
67:142-149[Abstract/Free Full Text].
|
| 70.
|
Yuh, C.-H.,
Y.-L. Chang, and L.-P. Ting.
1992.
Transcriptional regulation of precore and pregenomic RNAs of hepatitis B virus.
J. Virol.
66:4073-4084[Abstract/Free Full Text].
|
| 71.
|
Zhang, W.,
J. Zhang,
M. Kornuc,
K. Kwan,
R. Frank, and S. D. Nimer.
1995.
Molecular cloning and characterization of NF-IL3A, a transcriptional activator of the human interleukin-3 promoter.
Mol. Cell. Biol.
15:6055-6063[Abstract].
|
| 72.
|
Zhou, D.-X., and T. S. B. Yen.
1991.
The ubiquitous transcription factor Oct-1 and the liver-specific factor HNF-1 are both required to activate transcription of a hepatitis B virus promoter.
Mol. Cell. Biol.
11:1353-1359[Abstract/Free Full Text].
|
Journal of Virology, April 1999, p. 3197-3209, Vol. 73, No. 4
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Williams, V., Brichler, S., Radjef, N., Lebon, P., Goffard, A., Hober, D., Fagard, R., Kremsdorf, D., Deny, P., Gordien, E.
(2009). Hepatitis delta virus proteins repress hepatitis B virus enhancers and activate the alpha/beta interferon-inducible MxA gene. J. Gen. Virol.
90: 2759-2767
[Abstract]
[Full Text]
-
Silvestris, F., Cafforio, P., De Matteo, M., Calvani, N., Frassanito, M. A., Dammacco, F.
(2008). Negative Regulation of the Osteoblast Function in Multiple Myeloma through the Repressor Gene E4BP4 Activated by Malignant Plasma Cells. Clin. Cancer Res.
14: 6081-6091
[Abstract]
[Full Text]
-
Ohno, T., Onishi, Y., Ishida, N.
(2007). A novel E4BP4 element drives circadian expression of mPeriod2. Nucleic Acids Res
35: 648-655
[Abstract]
[Full Text]
-
Yang, C.-Y., Kuo, T.-H., Ting, L.-P.
(2006). Human Hepatitis B Viral e Antigen Interacts with Cellular Interleukin-1 Receptor Accessory Protein and Triggers Interleukin-1 Response. J. Biol. Chem.
281: 34525-34536
[Abstract]
[Full Text]
-
Hough, C., Cuthbert, C. D., Notley, C., Brown, C., Hegadorn, C., Berber, E., Lillicrap, D.
(2005). Cell type-specific regulation of von Willebrand factor expression by the E4BP4 transcriptional repressor. Blood
105: 1531-1539
[Abstract]
[Full Text]
-
Junghans, D., Chauvet, S., Buhler, E., Dudley, K., Sykes, T., Henderson, C. E.
(2004). The CES-2-related transcription factor E4BP4 is an intrinsic regulator of motoneuron growth and survival. Development
131: 4425-4434
[Abstract]
[Full Text]
-
Lin, S.-J., Shu, P.-Y., Chang, C., Ng, A.-K., Hu, C.-p.
(2003). IL-4 Suppresses the Expression and the Replication of Hepatitis B Virus in the Hepatocellular Carcinoma Cell Line Hep3B. J. Immunol.
171: 4708-4716
[Abstract]
[Full Text]
-
Ozkurt, I. C., Tetradis, S.
(2003). Parathyroid Hormone-induced E4BP4/NFIL3 Down-regulates Transcription in Osteoblasts. J. Biol. Chem.
278: 26803-26809
[Abstract]
[Full Text]
-
Tang, H., McLachlan, A.
(2002). Mechanisms of Inhibition of Nuclear Hormone Receptor-Dependent Hepatitis B Virus Replication by Hepatocyte Nuclear Factor 3{beta}. J. Virol.
76: 8572-8581
[Abstract]
[Full Text]
-
Yu, Y.-L., Chiang, Y.-J., Yen, J. J. Y.
(2002). GATA Factors Are Essential for Transcription of the Survival Gene E4bp4 and the Viability Response of Interleukin-3 in Ba/F3 Hematopoietic Cells. J. Biol. Chem.
277: 27144-27153
[Abstract]
[Full Text]
-
Ishida, H., Ueda, K., Ohkawa, K., Kanazawa, Y., Hosui, A., Nakanishi, F., Mita, E., Kasahara, A., Sasaki, Y., Hori, M., Hayashi, N.
(2000). Identification of Multiple Transcription Factors, HLF, FTF, and E4BP4, Controlling Hepatitis B Virus Enhancer II. J. Virol.
74: 1241-1251
[Abstract]
[Full Text]
-
Nishimura, Y., Tanaka, T.
(2001). Calcium-dependent Activation of Nuclear Factor Regulated by Interleukin 3/Adenovirus E4 Promoter-binding Protein Gene Expression by Calcineurin/Nuclear Factor of Activated T Cells and Calcium/Calmodulin-dependent Protein Kinase Signaling. J. Biol. Chem.
276: 19921-19928
[Abstract]
[Full Text]
-
Sun, C.-T., Lo, W.-Y., Wang, I.-H., Lo, Y.-H., Shiou, S.-R., Lai, C.-K., Ting, L.-P.
(2001). Transcription Repression of Human Hepatitis B Virus Genes by Negative Regulatory Element-binding Protein/SON. J. Biol. Chem.
276: 24059-24067
[Abstract]
[Full Text]